High-grade Tumor Cells Research Articles

Oncogenic role of lncRNA SBF2-AS1 in bladder cancer

IntroductionBladder cancer is a malignant neoplasm with increasing incidence rates. LncRNAs play an important role in cancer, including development, prognosis, and response to therapies. It is known that lncRNA SBF2-AS1 was associated with cell proliferation and worse prognosis in various tumor types, but its role remains incompletely understood in bladder cancer. In this context, our objective was to evaluate the effect of lncRNA SBF2-AS1 silencing on bladder cancer cells. MethodsJ82 and UM-UC-3 high-grade bladder tumor cells were treated with two siRNAs specific for SBF2-AS1 to evaluate cytotoxicity, clonogenic survival, morphology, cell migration, and cell cycle progression. ResultsExpression inhibition of SBF2-AS1 resulted in cytotoxicity, morphological changes, and decreased clone formation and cell migration. Cell cycle alterations were not observed. ConclusionOur study revealed that SBF2-AS1 plays an oncogenic role and holds promise as a potential target for the treatment of bladder cancer.

6850 A Case of Anaplastic Thyroid Carcinoma With a Complete Metabolic Response to Pembrolizumab

Abstract Disclosure: E. Tirthani: None. J.T. Kung: None. Background: Anaplastic thyroid carcinoma (ATC) is an aggressive disease with limited therapeutic options and generally poor prognosis. Post-surgery, most patients are treated with a combination of chemotherapy, radiation, and tyrosine kinase inhibitors +/- immune checkpoint inhibitors. We describe a unique case of ATC with a complete metabolic response to pembrolizumab, a selective PD-1 inhibitor, as evidenced by imaging. Clinical Case: A 69-year-old female presented to the clinic for evaluation of a rapidly enlarging neck mass. The initial ultrasound showed a large mixed cystic-solid right thyroid nodule with irregular margins with micro- and macrocalcifications, which was biopsied. Cytology showed discohesive high-grade malignant tumor cells with enlarged nuclei, nuclear hyperchromasia in the background of necrosis, and dense neutrophilic infiltration concerning for ATC. A CT scan of the neck and chest showed a complex cystic thyroid mass with central necrosis and calcification with paratracheal, supraclavicular, and mediastinal lymphadenopathy. MRI of the brain was negative for metastatic disease. The patient underwent a total thyroidectomy with right and left level 6 and 7 neck dissection. Intra-operatively, gross extrathyroidal extension of the tumor was noted to the right carotid, larynx, right recurrent laryngeal nerve, and esophagus, with residual tumor left behind near the larynx. Pathology confirmed stage IVC ATC, positive for PIK3CA, NF1, p53 mutations, and BRAF negative. 90% of tumor cells showed PD-L1 expression on immunohistochemical staining. The post-surgical PET scan showed two discrete, well-defined foci of very intense FDG uptake, corresponding to the right lower cervical and para-esophageal lymph nodes with no evidence of distant metastasis. Systemic chemotherapy with carboplatin and paclitaxel (5 cycles) was initiated with concurrent intensity modulated radiation therapy (total 60 Gy/40 fractions to thyroid bed and bilateral neck). Repeat imaging showed minimal change in the size of the PET-positive lymph nodes. Immunotherapy was initiated and with just 2 cycles of 400 mg IV pembrolizumab, a repeat PET scan was obtained, which showed a complete metabolic response to therapy. Minimal residual FDG activity in the right supraclavicular region was thought to be secondary to posttreatment changes. The patient was able to resume her activities of daily living and had an improvement in appetite. The plan is to continue 400 mg IV pembrolizumab every 6 weeks while cautiously assessing for adverse effects from immunotherapy. Conclusion: It is rare to see a complete metabolic response to therapy with pembrolizumab without concurrent use of tyrosine kinase inhibitors in patients with ATC. A high tumoral PD-L1 expression may be the key to having this kind of dramatic response. Presentation: 6/3/2024

Abstract 2988: TUG1 exosomal lncRNA sponges let-7 miRNA family members and advances prostate cancer

Abstract Exosomal long-non coding RNAs (lncRNAs) play an important role in cancer progression and have potential prognostic biomarker potential in several cancers including prostate cancer (PCa). Taurine-upregulated gene 1 (TUG1) is an oncogenic lncRNA overexpressed in PCa. This exosomal lncRNA has been reported to promote PCa migration, invasion and Epithelial-Mesenchymal Transition (EMT). However, TUG1 PCa prognostic mechanisms remain to be elucidated. This study aimed to profile differentially expressed lncRNAs in PCa high-grade tumor cells (PC-3) cells compared to low-grade PCa tumor cells (LNCaP). This was achieved by using a 384-well plate of PCa lncRNA gene panel. A human lncRNA database, LncSEA and other bioinformatics tools were used for annotation and enrichment analysis. RT-qPCR was used to confirm the gene array data. Up or down-regulation of ±2 and p <0.05 were considered significant. Forty two (42%) percent and 14% of lncRNAs were shown to be up and downregulated, respectively. Notably, TUG1 was shown to be upregulated in PC-3 cells from PCR array and RT-qPCR results. Bioinformatics analysis revealed that TUG1 is involved in several cancer hallmarks including apoptosis evasion, migration, invasion and EMT. Furthermore, lncRNA/miRNA complexes regulate a series of oncogenic signaling pathways and this study demonstrated that TUG1 sponges the let-7 miRNA family members (a highly conserved tumor suppressor miRNA family) and promotes PCa progression. Precise mechanisms of TUG1/let-7 axis in PCa prognosis need to be largely elucidated as this may hold potential to understanding lncRNA/miRNA-mediated PCa progression and thus be targeted for novel therapeutics. Citation Format: Rahaba Makgotso Marima, Mandisa Mbeje, Jeyalakshmi Kandhavelu, Clement Penny, Zodwa Dlamini. TUG1 exosomal lncRNA sponges let-7 miRNA family members and advances prostate cancer [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 2988.

To Assess Drug Delivery System Nanocarrier at Industrial Production: Establishment of Liposomal Surface Using Physicochemical Properties

Liposomes have been reported to be useful nanocarrier, however, there are number of challenges to resolve before they can be optimized for drug delivery. Liposomes are taken up by cell in the reticuloendothelial system (RES). Polyethyleneglycol (PEG) modification on the liposomal membrane forms a fixed aqueous layer and thus prevents uptake by the RES. The physicochemical properties of liposomes that are most commonly evaluated particle size and zeta potential are not sufficient indicator of the passive targeting effect by PEG modification. In contrast, the fixed aqueous layer thickness (FALT) around liposomal surface was clear to be regulated to be the utilized action in the body. It was showed that the FALT value of PEG-modified liposomes containing doxorubicin increased with the increase in the molecular weight of PEG. Furthermore, PEG modification with a combination of high- and low- molecular weight PEGs on liposomal membranes showed in optimal results with respect to FALT and a higher antitumor effect. In addition, we designed and synthesized a novel PEG-lipid, different double arms PEG (DDA-PEG), which consisted of two PEG chains of 500 and 2000 in one molecule to develop more useful PEG-modified liposomes. DDA-PEG was found to have superior antitumor activity and was associated with the prevention of tumor metastasis. Furthermore, we sought to (-)-epigallocatechin-3-O-gallate (EGCG) functions as a target ligand of the 67-kDa laminin receptor (67LR), which is expressed on high-grade tumor cells. EGCG-PEG-modified liposome appear to have superior antitumor activity against high 67LR-expressing tumor cells, as the liposomes had dual effects.

Liposarcoma Involving Serous Fluid Cavities-A Case Series Illustrating Clinical Implications and the Diagnostic Role of Exfoliative Cytology.

Introduction: Cytological diagnosis of sarcomas requires detailed cytomorphological assessment and integration of immunocytochemistry and/or molecular testing. The role of exfoliative cytology, as compared to aspiration cytology, is less understood. This case series describes well-differentiated/dedifferentiated liposarcomas in effusions, with cytomorphological features, ancillary test results and clinical outcomes detailed. Methods: A computerized search of the department pathology archives was performed for sarcomatous effusions with histological diagnosis or clinical history of well-differentiated/dedifferentiated liposarcoma. Clinical progress, cytology slides, immunocytochemistry and molecular test results were reviewed. Results: Six patients were identified. In 5 patients with clinical follow up, 4 (80%) were deceased within 5 months of malignant effusion. One patient was alive with 12 years disease-free survival after radical resection with adjuvant radiotherapy. Three patients showed dedifferentiation on histology, and high-grade (dedifferentiated) tumor cells were present in effusion cytology of 2 patients. Two showed well-differentiated components only on biopsy, but high-grade (dedifferentiated) tumor cells were identified in cytology. The high-grade tumor cells displayed marked nuclear irregularity, enlargement, size variation, with macronucleoli and multinucleation. Well-differentiated lipomatous components were demonstrated in 4 patients (66.7%), comprising of multivacuolated lipoblasts and atypical lipocytes. CDK4 and MDM2 immunoreactivity in all 3 cases with cell blocks, and CDK4 and MDM2 amplification in one were successfully demonstrated. Conclusion: Lipomatous and dedifferentiated components can be sampled and cytomorphologically identified on effusion fluids of liposarcomas, with sufficient cellularity for immunocytochemistry and molecular testing. Although generally associated with poor prognosis, long disease-free survival with sarcomatous effusion is possible with radical surgery and adjuvant treatment.

Single-cell molecular profiling using ex vivo functional readouts fuels precision oncology in glioblastoma.

Functional profiling of freshly isolated glioblastoma (GBM) cells is being evaluated as a next-generation method for precision oncology. While promising, its success largely depends on the method to evaluate treatment activity which requires sufficient resolution and specificity. Here, we describe the 'precision oncology by single-cell profiling using ex vivo readouts of functionality' (PROSPERO) assay to evaluate the intrinsic susceptibility of high-grade brain tumor cells to respond to therapy. Different from other assays, PROSPERO extends beyond life/death screening by rapidly evaluating acute molecular drug responses at single-cell resolution. The PROSPERO assay was developed by correlating short-term single-cell molecular signatures using mass cytometry by time-of-flight (CyTOF) to long-term cytotoxicity readouts in representative patient-derived glioblastoma cell cultures (n = 14) that were exposed to radiotherapy and the small-molecule p53/MDM2 inhibitor AMG232. The predictive model was subsequently projected to evaluate drug activity in freshly resected GBM samples from patients (n = 34). Here, PROSPERO revealed an overall limited capacity of tumor cells to respond to therapy, as reflected by the inability to induce key molecular markers upon ex vivo treatment exposure, while retaining proliferative capacity, insights that were validated in patient-derived xenograft (PDX) models. This approach also allowed the investigation of cellular plasticity, which in PDCLs highlighted therapy-induced proneural-to-mesenchymal (PMT) transitions, while in patients' samples this was more heterogeneous. PROSPERO provides a precise way to evaluate therapy efficacy by measuring molecular drug responses using specific biomarker changes in freshly resected brain tumor samples, in addition to providing key functional insights in cellular behavior, which may ultimately complement standard, clinical biomarker evaluations.

High grade acinic cell carcinoma of the breast with clear cytoplasm mimics clear cell carcinoma in a BRCA1 mutation carrier: a case report and review of the literature on the molecular analysis.

Acinic cell carcinoma of the breast is an extremely rare tumor. To the best of our knowledge, only one case is reported to have bilateral tumors and had both BRCA1 and TP53 mutation. Herein, we report another case of acinic cell carcinoma of the breast in a 29-years-old female carrying germline BRCA1 and TP53 mutation, and the tumor showed a complex combination of histological features which had not only the reported common features such as diffuse infiltrative small acinar or glandular structures mixed with solid nests, but also the uncommon widespread clear cells, high grade tumor cells. The immunohistochemical profile of the tumor cells was strongly positive for lysozyme and triple negative for ER, PR, HER2. Although she had bilateral high grade breast cancers, this patient refused postoperative adjuvant therapy this time and has been doing well in the past 12 months. As a rare form of triple-negative breast cancer with a relatively not so bad prognosis, more reports are needed to understand its biological characteristics.

MCQ corner

1. Selenocysteine is coded by UGA UAG UAA AUG Ans: A. UGA Explanation Selenocysteine (SeCys/SeC) is the 21st amino acid and is found in thioredoxin reductase, glutathione peroxidase, 5’-deiodinase, and selenoprotein P. It is an exceptional case where a stop codon codes for an amino acid. The other stop codons are UAA and UAG. The ability of the protein synthetic apparatus to identify a selenocysteine-specific UGA codon involves the selenocysteine insertion element, a stem-loop structure in the untranslated region of the mRNA.[1] 2. A child with diarrhea for 2 days came to your out-patient department (OPD). On examination, the signs of dehydration were marked and the child was treated with oral rehydration solution (ORS). Glucose absorption was facilitated by which receptors? SGLT1 SGLT2 GLUT4 Sodium–hydrogen antiporter Ans: A. SGLT1 Explanation Absorption of glucose from the intestinal lumen to intestinal cells is by the cotransport mechanism. It is an active transport system and can transport against the concentration gradient.[2] 3. Skeletal derivative of the second pharyngeal arch is Malleus Incus Stapes Maxilla Ans: C. Stapes Explanation Maxilla, malleus, and incus are derived from the first arch.[3] 4. Blastocyst makes contact with a uterus on <3 days 5–7 days 8–11 days 15–16 days Ans: B. 5–7 days Explanation Contact of the blastocyst with endometrium occurs at the time of implantation. Implantation occurs at around 5-7 days.[4] 5. The father of antiseptic surgery is Louis Pasteur Robert Koch Julius Petri Joseph Lister Ans. D. Joseph Lister Explanation Louis Pasteur – the father of microbiology, Robert Koch – the father of microbiology (with Louis Pasteur), and the father of medical bacteriology, Julius Petri – invented the Petri dish.[5] 6. Following were the findings in a Glucose tolerance test (GTT). Fasting blood glucose <75 mg/dl; all blood samples show low blood glucose; urine glucose – nil. The possible diagnosis is Alimentary glycosuria Diabetes mellitus Hypopituitarism Diabetes insipidus Ans. C. Hypopituitarism Explanation In alimentary glycosuria, there will be a peak in the first sample after glucose load and sugar will appear in urine. In diabetes mellitus, fasting and the next two samples will show higher values than the normal reference range and the sample does not return to baseline at the end of the test. In hypopituitarism, there is hypoglycemia and the patient feels fatigued and stressed. In diabetes insipidus, GTT is mostly unaffected.[6] 7. A 10-year-old boy with a history of atopy presented with seasonal recurrent bilateral conjunctivitis and complained of blurred vision for the past 1 week. On lid eversion, giant papillae were seen. All of the following could be seen by slit-lamp examination except: Vascular pannus and punctate epithelial erosions involving the superior cornea. An oval epithelial ulceration with underlying stromal opacification in the central cornea Limbal follicles Conjunctival symblepharon Ans. D. Conjunctival symblepharon Explanation A conjunctival symblepharon is seen in the case of autoimmune disorders such as Sjogren’s syndrome, sarcoidosis, lichen planus, granulomatosis with polyangiitis, etc.[7] 8. Which of the following breast lesion is a noninvasive malignancy? Tubular carcinoma and mucinous carcinoma Intraductal carcinoma of the comedo type Infiltrating ductal carcinoma and lobular carcinoma Medullary carcinoma, including atypical medullary lesions Ans. B. Intraductal carcinoma of the comedo type Explanation A comedo-type ductal carcinoma in situ (DCIS), also known as comedocarcinoma insitu, is the high-grade subtype of DCIS. It completely fills and dilates the ducts and lobules in terminal duct lobular units with plugs of high-grade tumor cells with central necrosis “comedonecrosis.”[8] 9. In patients who develop a documented episode of deep-vein thrombosis, the most significant long-term sequelae are: Claudication Recurrent foot infections Development of stasis ulcer Pulmonary embolization Ans. C-Development of stasis ulcer Explanation Chronic symptoms may occur after 6 weeks or beyond. Pulmonary embolization is the most common complication but is seen as an acute complication.[9] 10. Identify the test from the diagram. Rothera’s test Benedict’s test Barfoed’s test Seliwanoff’s test Ans. A. Rothera’s testFigure 1: Purple permanganate coloured ring [Ferro-penta cyanine complex] at the junction of two fluidsExplanation Rothera’s test was done to identify the presence of ketone bodies in a urine sample. Benedict’s test will contain a green/yellow/orange/brick red precipitate at the bottom. Barfoed’s test has a red scum at the top of the fluid and a little red precipitate at the bottom. Seliwanoff’s test will have a cherry red color.[10] Financial support and sponsorship Nil. Conflicts of interest There are no conflicts of interest.

Continuous liquid interface production of 3D printed drug-loaded spacers to improve prostate cancer brachytherapy treatment

Brachytherapy, which is the placement of radioactive seeds directly into tissue such as the prostate, is an important curative treatment for prostate cancer. By delivering a high dose of radiation from within the prostate gland, brachytherapy is an effective method of killing prostate cancer cells while limiting radiation dose to normal tissue. The main shortcomings of this treatment are: less efficacy against high grade tumor cells, acute urinary retention, and sub-acute urinary frequency and urgency. One strategy to improve brachytherapy is to incorporate therapeutics into brachytherapy. Drugs, such as docetaxel, can improve therapeutic efficacy, and dexamethasone is known to decrease urinary side effects. However, both therapeutics have high systemic side effects. To overcome this challenge, we hypothesized that we can incorporate therapeutics into the inert polymer spacers that are used to correctly space brachytherapy seeds during brachytherapy to enable local drug delivery. To accomplish this, we engineered 3D printed drug-loaded brachytherapy spacers using continuous liquid interface production (CLIP) with different surface patterns to control drug release. These devices have the same physical size as existing spacers, allowing them to easily replace commercial spacers. We examined these drug-loaded spacers using docetaxel and dexamethasone as model drugs in a murine model of prostate cancer. We found that drug-loaded spacers led to higher therapeutic efficacy for brachytherapy, and there was no discernable systemic toxicity from the drug-loaded spacers. Statement of significanceThere has been high interest in the application of 3D printing to engineer novel medical devices. However, such efforts have been limited by the lack of technologies that can fabricate devices suitable for real world medical applications. In this study, we demonstrate a unique application for 3D printing to enhance brachytherapy for cancer treatment. We engineered drug-loaded brachytherapy spacers that can be fabricated using Continuous Liquid Interface Production (CLIP) 3D printing, allowing tunable printing of drug-loaded devices, and implanted intraoperatively with brachytherapy seeds. In combined chemotherapy and brachytherapy we are able to achieve greater therapeutic efficacy through local drug delivery and without systemic toxicities. We believe our work will facilitate further investigation in medical applications of 3D printing.

Abstract 2430: The role of cellular iron and the homeostatic iron regulator (HFE) in high-grade brain tumor cell migration

Abstract High-grade brain tumors such as grade III astrocytoma and glioblastoma represent among the most difficult to manage malignancies facing oncological practice. Diffuse migration and invasion into adjacent healthy brain tissue yields complete surgical resection of these tumors unfeasible. As a result, despite receiving maximal surgical resection and an aggressive course of chemoradiation, the majority of high-grade brain tumor patients suffer from recurrent disease. Increased expression levels of the homeostatic iron regulator gene (HFE) in high-grade brain tumors have been correlated with poorer outcomes. HFE is known to influence cellular iron metabolism by inhibiting transferrin-mediated iron uptake yet little is known regarding how HFE or iron impact the migratory capabilities of high-grade brain tumor cells. In order to better understand how HFE expression and cellular iron metabolism influence cell migration in high grade brain tumors, we utilized brain tumor cell lines that had been genetically manipulated to express different levels of HFE. We observed that knocking down HFE in KR158 or LN229 glioma cell lines resulted in significantly decreased migratory capacity. Since HFE is known to inhibit transferrin mediated iron uptake, we studied how directly modulating the iron status of glioma cells impacted their ability to migrate. Treatment of a panel of glioma cell lines: LN229, T98G, U87, KR158, with iron in the form of hemin or ferric ammonium citrate resulted in significantly reduced migration. Furthermore, the iron-induced reduction in migration could be rescued by the addition of deferoxamine, an iron chelator. Cell viability in response to the iron treatments was assayed and found to not be significantly altered - suggesting that cellular iron status was influencing migratory capacity independent of cell viability. To gain mechanistic insights into HFE and iron-induced effects on cell migration, we analyzed the Chinese Glioma Genome Atlas (CGGA) for correlations between HFE and the Rho GTPases RHOA, RAC1, and CDC42 – genes which are known to play a crucial role in determining the migratory capacity of cancer cells. Interestingly, we found statistically significant correlations between the Rho GTPases RHOA, RAC1, CDC42 and HFE in both grade III astrocytoma and glioblastoma patient cohorts. Immunoblotting of iron treated glioma cell lines demonstrated that expression of RhoA and Cdc42 was reduced suggesting that alterations in Rho GTPase expression and signaling may play a role in iron-induced effects on cell migration. Our results demonstrate that targeting cancer cell iron metabolism as an addition to existing treatment regimens may be a promising avenue for further investigation. Citation Format: Ganesh Shenoy, Katie Troike, Kondaiah Palsa, Madison Kuhn, Quinn Wade, Becky Slagle-Webb, Amanda Snyder, Chachrit Khunsriraksakul, Justin D. Lathia, Dhimant Desai, Hong-Gang Wang, Elizabeth Proctor, James R. Connor. The role of cellular iron and the homeostatic iron regulator (HFE) in high-grade brain tumor cell migration [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2022; 2022 Apr 8-13. Philadelphia (PA): AACR; Cancer Res 2022;82(12_Suppl):Abstract nr 2430.

Long-Term Survival of Combined Hepatocellular-Cholangiocarcinoma: A Nationwide Study.

Combined hepatocellular-cholangiocarcinoma (HCC-CC) is an aggressive primary liver cancer. However, the clinical features are not clearly understood because of limited literature and the complex nature of both hepatocellular carcinoma (HCC) and cholangiocarcinoma (CC). The records of 100,754 patients with newly diagnosed liver cancer between 2004 and 2013 were obtained from the Taiwan Cancer Registry. The primary outcome measures were overall survival and local recurrence-free survival. The median follow-up time was 60 months (29-120 months). HCC-CC tended to share some characteristics with HCC, including increased frequency of stage I cases, high individual tumor rates, and similar patterns of viral hepatitis B and hepatitis C infections. In contrast, HCC-CC showed malignant behavior similar to that of CC, as high-grade tumor cell differentiation and presentation of jaundice were predominant in HCC-CC and CC compared with HCC. Overall survival and local recurrence-free survival rates of HCC-CC were between HCC and CC rates. The mortality rate of HCC-CC was 79.2% (HCC, 77.5%; CC, 93.5%) and the local recurrence rate of HCC-CC was 65.3% (HCC, 74.6%; CC, 88.4%). Surgical treatment was an independent factor for the long-term prognosis of HCC-CC, whereas transarterial chemoembolization (TAcE) promoted survival in both surgical and nonsurgical groups. Our data confirmed that, although it reflects the malignant behavior of CC, HCC-CC should mainly be characterized as a subtype of HCC. With careful selection of patients, curative resection and TAcE might benefit the survival of patients with HCC-CC. Combined hepatocellular-cholangiocarcinoma (HCC-CC) is a rare cancer that shares demographic characteristics, as well as survival probabilities, with both hepatocellular carcinoma and cholangiocarcinoma. It occurs frequently in patients with hepatitis B virus infection, cirrhotic liver background, and early-stage disease. Compared with 20% of initial resection rates of its counterparts, HCC-CC has higher initial resection rate (55%). Although short-term overall survival is inferior to HCC, its long-term overall survival is similar with HCC.

Single-cell analysis of copy-number alterations in serous ovarian cancer reveals substantial heterogeneity in both low- and high-grade tumors

ABSTRACT Unusually high aneuploidy is a hallmark of epithelial serous ovarian cancer (SOC). Previous analyses have focused on aneuploidy on average across all tumor cells. With the expansion of single-cell sequencing technologies, however, an analysis of copy number heterogeneity cell-to-cell is now technically feasible. Here, we describe an analysis of single-cell RNA sequencing (scRNA-seq) data to infer arm-level aneuploidy in individual serous ovarian cancer cells. By first clustering high-quality sequenced epithelial versus non-epithelial cells, high-confidence tumor cell populations were identified. InferCNV was used to predict segmented copy-number alterations (CNAs), which were then used to determine arm-level aneuploidy at the single-cell level. Control comparisons of normal cells to normal cells showed zero arm-level aneuploidy, whereas a median of four aneuploid events were detectable in cancer cells. A heterogeneity analysis of high-grade tumor cells compared to low-grade tumor cells showed similar levels of cell-to-cell variation between cancer grades. Metastatic tumors potentially showed selection pressure with reduced cell-to-cell variation compared to cells from primary tumors. Minor cell populations with CNAs similar to metastatic cells were identified within the matched primary tumors. Taken together, these results provide a minimum estimate for single-cell aneuploidy in serous ovarian cancer and demonstrate the utility of single-cell sequencing for CNA analysis.

Identification of oncolytic vaccinia restriction factors in canine high-grade mammary tumor cells using single-cell transcriptomics.

Mammary carcinoma, including triple-negative breast carcinomas (TNBC) are tumor-types for which human and canine pathologies are closely related at the molecular level. The efficacy of an oncolytic vaccinia virus (VV) was compared in low-passage primary carcinoma cells from TNBC versus non-TNBC. Non-TNBC cells were 28 fold more sensitive to VV than TNBC cells in which VV replication is impaired. Single-cell RNA-seq performed on two different TNBC cell samples, infected or not with VV, highlighted three distinct populations: naïve cells, bystander cells, defined as cells exposed to the virus but not infected and infected cells. The transcriptomes of these three populations showed striking variations in the modulation of pathways regulated by cytokines and growth factors. We hypothesized that the pool of genes expressed in the bystander populations was enriched in antiviral genes. Bioinformatic analysis suggested that the reduced activity of the virus was associated with a higher mesenchymal status of the cells. In addition, we demonstrated experimentally that high expression of one gene, DDIT4, is detrimental to VV production. Considering that DDIT4 is associated with a poor prognosis in various cancers including TNBC, our data highlight DDIT4 as a candidate resistance marker for oncolytic poxvirus therapy. This information could be used to design new generations of oncolytic poxviruses. Beyond the field of gene therapy, this study demonstrates that single-cell transcriptomics can be used to identify cellular factors influencing viral replication.

Increased expression levels of Syntaxin 1A and Synaptobrevin 2/Vesicle-Associated Membrane Protein-2 are associated with the progression of bladder cancer.

Gene expression is tightly regulated in time and space through a multitude of factors consisting of signaling molecules. Soluble N-ethylmaleimide-sensitive-factor attachment protein receptors (SNARE) are membrane proteins responsible for the intercellular trafficking of signals through endocytosis and exocytosis of vesicles. Altered expression of SNARE proteins in cellular communication is the major hallmark of cancer phenotypes as indicated in recent studies. SNAREs play an important role in maintaining cell growth and epithelial membrane permeability of the bladder and are not only involved in cancer progression but also metastatic cell invasion through SNARE-mediated trafficking. Synaptobrevin2/Vesicle associated membrane protein-2 (v-SNARE) and Syntaxin (t-SNARE) form a vesicular docking complex during endocytosis. Some earlier studies have shown a critical role of SNARE in colon, lungs, and breast cancer progression and metastasis. In this study, we analyzed the relative expression of the STX1A and VAMP2 (SYB2) for their possible association in the progression and metastasis of bladder cancer. The profiling of the genes showed a significant increase in STX1A and VAMP2 expression (p < 0.001) in high-grade tumor cells compared to normal and low-grade tumors. These findings suggest that elevated expression of STX1A and VAMP2 might have caused the abnormal progression and invasion of cancer cells leading to the transformation of cells into high-grade tumor in bladder cancer.

Abstract 2678: Antitumor effect against 67 kDa laminin receptor expressed on high-grade tumor cells

Abstract [Purpose] In chemotherapy for cancer, liposomes as drug delivery system (DDS) carriers are expected to have a useful effect. The aim of this study was, therefore to evaluate the antitumor effects of, and elucidate the mechanisms underlying, (-)-epigallocatechin-3-O-gallate (EGCG) and polyethyleneglycol (PEG)-modified liposomes. EGCG functions as a target ligand of the 67 kDa laminin receptor (67LR), which is expressed on high-grade tumor cells. An EGCG derivative was synthesized for binding to the end site of PEG structure. In this study, the antitumor effects of EGCG-modified liposomes as active-targeting liposome were evaluated. [Methods] Liposome was loaded with doxorubicin (DOX) as an antitumor agent. C57BL/6 mice were subcutaneously inoculated with B16F10 mouse melanoma cells (5x105 cells/animal). Each sample was administered intravenously with 2.5 mg/kg DOX. EGCG solution (EGCG sol.) was also administered intravenously at 11.3 mg/kg, based on the amount of EGCG modification in DOX-loaded EGCG-PEG-modified liposomes (EPL). Caspase-3 was evaluated as 7-amino-4-trifluoromethyl coumarin (Ex: 400 nm, Em: 505 nm), following a reaction with the fluorescent substrate DEVD-AFC. Caspase-8 was determined reacted with DEVD-pNA and detected as chromophore p-nitroanilin (λ: 400nm). [Results and Discussion] EPL significantly decreased tumor size against B16F10 mouse melanoma cells, in mice bearing 67LR-high-expression tumors. The tumor weight of the EPL group was significantly lower than that of the control (p&amp;lt;0.01). Typical passive-targeting liposomes (PL) accumulated into the tumors due to improved blood circulation and an enhanced permeability and retention (EPR) effect, and decreased tumor weight. On the other hand, EPL disappeared from the blood immediately, compared with PL or PL + EGCG sol. DOX concentration of liver and spleen in EPL group did not increase, indicating that the rapid disappearance of EPL from the blood was not due to reticuloendothelial system (RES) trapping. Caspase-3 activity, which indicates apoptosis induction, was also elevated only in the EPL group, and the caspase-3 activity of the PL + EGCG sol. group was the same as that of the PL group. Hence, it was important that EGCG was included to modify the liposomes via PEG, as soluble EGCG did not accumulate at a high enough concentration to exert an apoptotic effect. Moreover, EPL significantly increased caspase-8 activity. It was suggested that EPL-induced apoptosis occurred due to caspase-8 activity induced following the binding of EGCG to 67LR as a cell-death ligand. In conclusion, it was suggested that EPL was a superior antitumor agent in high 67LR-expressing tumor cells as the liposomes had dual effects, namely antitumor effects due to the loaded DOX and apoptosis induced by the bound EGCG. Citation Format: Ikumi Sugiyama, Yasuyuki Sadzuka. Antitumor effect against 67 kDa laminin receptor expressed on high-grade tumor cells [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2018; 2018 Apr 14-18; Chicago, IL. Philadelphia (PA): AACR; Cancer Res 2018;78(13 Suppl):Abstract nr 2678.

Prognostic Implications of Histological Clear Cells in High-Grade Intracranial Ependymal Tumors: A Retrospective Analysis from a Tertiary Care Hospital in Pakistan.

Background:Clear cell variant in ependymal tumors is rare. We aimed to compare the features and outcome of the World Health Organization (WHO) Grade 3 ependymal tumors with clear cells to the WHO Grade 3 classic anaplastic ependymoma (AE).Materials and Methods:A retrospective cohort study conducted at the Department of Neurosurgery, Aga Khan University, Pakistan, from 2003 to 2013. The medical records and radiology of patients with proven histopathology were reviewed. The analysis was done on SPSS 20.Results:Nine cases of clear cell variant and 23 cases of classic AE were found, both of which combined equated to 4% of the total tumor burden in 11 years. The median age of clear cell ependymoma (CCE) and AE were 49 and 37 years, respectively. Presenting symptoms included headache in 66% of CCE and 63% in AE, raised intracranial pressure accounting for 33% of CCE and 54% of AE, dizziness in 22% CCE and 39% AE, while seizures presented equally in both. Supratentorial location was observed in 77% CCE and 48% AE. Both showed hypointense signals on T1-weighted images of magnetic resonance imaging (MRI) while T2-weighted images showed hyperintensity in all cases of CCE but only 80% of AE. MRI characteristics such as the presence of cystic component were found in 89% of CCE and 68% of AE, necrosis in 33% CCE, and 22% AE, hemorrhagic in 22% CCE and 9% AE, and equivalent contrast enhancement. Gross total resection was achieved in 5 (55%) patients of CCE, compared to 6 (26%) patients in AE. Subtotal resection was done in 4 (44%) patients of CCE and 15 (65%) patients of AE. Radiotherapy was given to 5 (55%) patients of CCE and 12 (52%) patients of AE. Recurrence was observed in 77% cases of CCE and 70% of AE, with metastasis in 29% of AE and in only one patient of CCE. Repeat surgery was done in 3 (33%) cases of CCE and 8 (35%) cases of AE. Median progression-free survival and overall survival were 9 and 13 months, respectively, in CCE while 14 and 18 months, respectively, for AE.Conclusion:Clear cells in the WHO Grade 3 ependymal tumors are found mainly in a comparatively older adult population with a predilection for supratentorial location and are more aggressive in behavior with poorer outcome than AE.

Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase.

Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle.

Cell adhesion molecule profiles, proliferation activity and p53 expression in advanced epithelial ovarian cancer induced malignant ascites—Correlation of tissue microarray and cytology microarray

IntroductionPeritoneal dissemination accompanied by ascites formation is common in epithelial ovarian cancer (EOC). Adhesion molecules are crucial in metastatic spread and the latter involves epithelial-mesenchymal transition (EMT). This study aimed at: (1) clarifying whether E-cadherin and β-catenin expression and proliferative activity in metastatic ovarian cancer are inter-related; (2) Identifying possible correlations between cell adhesion molecular expression profiles, the proliferative activity and p53 expression of tumor cells and tumor grade and stage; (3) testing the cytology microarray (CMA) technique in analyzing metastasis formation. Material and methodsBoth tumorous and ascitic samples from 27 EOC patients were examined by using tissue microarray (TMA) and cytology microarray (CMA), respectively. CMA blocks were constructed using cores from each cell block of the ascitic specimens. Expression of E-cadherin, β-catenin, Ki-67 and p53 was immunohistochemically detected both in TMA and CMA blocks. ResultsE-cadherin expression was higher in ascitic cells than in primary tumor cells (p = .294). β-catenin expression was significantly lower in ascitic cells than in primary tumor cells (p = .006). Expression of Ki-67 was lower and expression of p53 was higher in primary tumors than in ascitic cells, for p53 the difference was significant (p = .001). Both Ki-67 and p53 expression elevated significantly in high-grade primary tumor cells and in ascites cells (p = .039, and p = .004, respectively). ConclusionEpithelial-mesenchymal transition- mesenchymal-epithelial transition is suggested as the best descriptive term for our IHC observations which accompany increased proliferative activity of ascitic cells.The CMA method is an adequate and reliable method for the analysis of ascitic tumor cells disseminating from ovarian malignancies.

Dual-effect liposomes with increased antitumor effects against 67-kDa laminin receptor-overexpressing tumor cells

This study sought to evaluate the antitumor effects of and elucidate the mechanisms underlying (−)-epigallocatechin-3-O-gallate (EGCG) and polyethyleneglycol (PEG)-modified liposomes. EGCG functions as a target ligand of the 67-kDa laminin receptor (67LR), which is expressed on high-grade tumor cells. An EGCG derivative was synthesized for binding to the end of PEG. Doxorubicin (DOX)-loaded EGCG-PEG-modified liposome (EPL) significantly decreased tumor size in mice bearing high 67LR-high-expressing tumors. Caspase-3 activity, which indicates induction of apoptosis, was also elevated only in the EPL group. The importance of PEG for the antitumor effects of EGCG was noted, as soluble EGCG did not accumulate at a sufficient concentration to exert an apoptotic effect. Moreover, EPL significantly increased caspase-8 activity, suggesting that EPL-induced apoptosis occurred due to caspase-8 activity induced following the binding of EGCG to 67LR as a cell-death ligand. In conclusion, EPL appear to have superior antitumor activity against high 67LR-expressing tumor cells, as the liposomes had dual effects, namely antitumor effects due to the loaded DOX and apoptosis induced by the bound EGCG.

Abstract B07: Regaining epigenetic control of the Hippo pathway to inhibit sarcomagenesis

Abstract Nearly 11,000 individuals in the United States and 200,000 individuals worldwide are diagnosed with a form of soft-tissue sarcoma (STS) every year. STS is a rare heterogeneous and complex family of disease associated with no uniform underlying genetic abnormality. However, sarcoma treatment has not changed significantly in 25 years. Patients are limited to surgery, radiotherapy, and chemotherapy. Therefore, the discovery of novel targets and mechanisms is critical. The Hippo pathway functions as a signaling hub facilitating cellular responses to multiple stimuli during tumorigenesis. The most important downstream effector of the Hippo pathway is Yes-activated protein (YAP), a transcriptional coactivator that promotes pro-proliferation and suppresses apoptosis. Inactivation of the Hippo pathway promotes nuclear localization of YAP. Whereas many studies have defined YAP1's transcriptional targets in epithelial tumors and normal tissues, its role in mesenchymal tumors is unclear. Here, we confirm that increased YAP1 mRNA expression correlates with worse overall survival in undifferentiated pleomorphic sarcoma (UPS) patients and that YAP1 protein levels are frequently elevated in human sarcomas. Furthermore, immunohistochemical (IHC) analysis of human sarcoma tissue microarray (TMA) showed that YAP levels are dramatically increased in the nuclei of high-grade UPS tumor cells, compared with normal skeletal, adipose, and arterial tissue. UPS is one of the more commonly diagnosed and aggressive subtypes of sarcomas found in adults. To define mechanisms of YAP1-mediated sarcomagenesis, we developed a novel genetic mouse model in which YAP1 is conditionally deleted from KrasG12D+; Trp53fl/fl (KP) UPS tumors (KPY). Microarray analysis of both tumors revealed that YAP1 loss inhibits expression of NF-κB signaling components and transcriptional targets. Consistent with these findings, ChIP-seq and super-enhancer analysis of human UPS tumors (n=3) revealed that many of the 900 identified UPS super enhancers regulate expression of NF-κB targets dependent on YAP1 in our system. This finding is particularly relevant as NF-κB is a key regulator of muscle cell proliferation and suppresses differentiation by inhibiting expression of the myogenic transcription factor, MYOD1. Together, these data suggest that upregulation of YAP1 activity promotes NF-κB-mediated proliferation and inhibits differentiation. Importantly, we have discovered that a combination of JQ1, a BET family inhibitor, and vorinostat (SAHA), a histone deacetylase (HDAC) inhibitor, decreases YAP1 expression, YAP1 protein stability, and sarcoma cell proliferation. Mechanistically, SAHA/JQ1 treatment significantly increases expression of the tumor suppressor angiomotin (AMOT), which binds YAP1, sequesters it in the cytoplasm, and facilitates its degradation. We have also found that AMOT expression is lost in sarcomas compared with normal muscle tissue, likely due to epigenetic suppression. SAHA/JQ1 treatment also decreased gene expression of YAP1 targets and caused reexpression of the muscle differentiation markers p57, MEF2C, and MYOD1. Based on these data we will investigate the efficacy of SAHA/JQ1 against UPS and other sarcomas in vivo using subcutaneous and autochthonous mouse models. We will probe the ability of SAHA/JQ1 treatment to inhibit YAP1 in vivo, to suppress NF-κB dependent mechanisms of cell proliferation and tumorigenesis, and to promote terminal differentiation of sarcoma cells. Ultimately, we will determine whether this approach represents a novel course of targeted treatment for sarcoma patients. Citation Format: Shuai Ye, Koreana Pak, Jennifer Shah, Susan Chor, Shaun Egolf, Gloria Marino, T.S. Karin Eisinger-Mathason. Regaining epigenetic control of the Hippo pathway to inhibit sarcomagenesis [abstract]. In: Proceedings of the AACR Conference on Advances in Sarcomas: From Basic Science to Clinical Translation; May 16-19, 2017; Philadelphia, PA. Philadelphia (PA): AACR; Clin Cancer Res 2018;24(2_Suppl):Abstract nr B07.