Gujarat Research Articles

Grassland Cheetah (Acinonyx jubatus) Introduction to Hill Forests in India: Habitat Analysis Error?

Due to population viability issues, Cheetah brought to India from Africa and their Indian progeny were confined to the enclosures since 2.5 years, and fed with livestock meat and refrained from hunting in the open. Grasslands, savanna or semi-arid habitat in western Indian states of Rajasthan or Gujarat may be more suitable habitat for the African Cheetah subspecies introduction in India than the forested, hilly tracts in the Madhya Pradesh state such as Kuno national park, where their current location. Cheetah mainly dwell or hunt in the plains savanna habitat in Africa. Cheetah diet in Africa mainly consists of Antelopes (grown up weight<50 kg) or small mammals like hare and occasionally livestock such as sheep, goat comprise. Breeding and release of such small mammals in the Cheetah habitat and community participation may be helpful, than the “Chital” i.e. Spotted deer i.e. (full grown weight >80 kg) prevailing and promoted at Kuno presently.

Co-Occurrences of Forms of Child Undernutrition in India: Insights from the National Family Health Survey

Background: The composite index of anthropometric failure (CIAF) studies co-occurrences of three forms of child undernutrition: stunting (S), wasting (W), and underweight (U). This study attempts to modify it through the inclusion of a fourth form of undernutrition, that is, anaemia (A), serving as a proxy for micronutrient deficiencies among under-five children in India. Methods: Spatial and multivariate analyses were employed to analyse the co-occurrences of child undernutrition with reference to the child’s and mother’s characteristics using National Family Health Survey (NFHS) data. Results: The modified index of “CIAF + Anaemia” identified thirteen manifestations of child undernutrition in India, the most prevalent co-occurrence being “only anaemia” (30%), followed by a triple burden or co-occurrence of stunting, underweight, and anaemia (SUA) (12%). The prevalence of the quadruple burden of child undernutrition (SWUA) was found to be highest in the states of Jharkhand and Gujarat (7%). A higher likelihood of the co-occurrence of “SUA” was observed among underweight mothers (16%), whereas that of “only anaemia” was observed more among overweight mothers (35%) compared to their counterparts. The co-occurrences “SUA” and “SWUA” were found to be moderately clustered among the districts of India. Conclusions: Overall, the study reinforces the need for early identification and specialised treatment approaches for children burdened with multiple forms of undernutrition to prevent its scarring effect.

The Impact of Foreign Direct Investment on India's Sectoral and Regional Economic Growth: An Analytical Study

The research investigates how Foreign Direct Investment (FDI) affects Indian development by studying its sectorial and geographical placements. The research evaluates how FDI affects GDP growth, industrial expansion, and employment generation and establishes what draws investors to India. The research uses data from the DPIIT Department for Promotion of Industry and Internal Trade and secondary sources to conduct statistical assessments of FDI movements and their economic impact. The highest inflow of foreign direct investment segments between services, computer software, hardware, and trading, but the states of Maharashtra, Karnataka and Gujarat receive the most investments because they offer robust infrastructure and supportive policies. The available investment capital mainly flows toward sections of India that already possess adequate development, which produces unequal distribution throughout the country. The tax treaties between Mauritius and Singapore make them dominant sources of FDI in the country. The report advises implementing new policies because it suggests establishing updated regulations with infrastructure initiatives alongside special incentives for upcoming technology sectors. The Indian economy needs to solve investment inequality and administrative bottlenecks to improve its appeal to worldwide investors. Ministerial and investor groups can use the findings to develop strategies that maximize their FDI-mediated economic expansion.

Empowering Maternal Healthcare through IoT- Driven Long-Term Monitoring: System Architecture and Assessment

During pregnancy, it is crucial to monitor maternal health to ensure the well-being of both the mother and the unborn baby. Numerous studies conducted thus far have presented a range of maternal health monitoring systems. However, these studies tend to concentrate on particular health concerns and frequently depend on limited-term data- gathering approaches like questionnaires. Furthermore, there is a lack of long-term studies evaluating the requirements and challenges of continuous monitoring. Our team has successfully developed an advanced system that utilizes cutting-edge Inter- net-of-Things (IoT) technology to continuously monitor maternal health both before and after childbirth. This cutting-edge system integrates various data collection mechanisms to precisely record crucial health metrics, including stress levels, sleep pat- terns, and physical activity. We conducted a comprehensive study with actual pregnant women from the Vadodara region of Gujarat State, India, to validate the effectiveness of our system. Our extensive research has unequivocally demonstrated the practicality, energy efficiency, and the data reliability of this system we have established. This system has been proven to be highly effective in monitoring the health of expectant mothers for the entire duration of their nine-month pregnancy. Our maternal health monitoring system, utilizing IoT technology, offers an exceptional framework for ongoing monitoring throughout both pregnancy and the postpartum period. Rest assured that our system is the ultimate solution for monitoring maternal health. It has been implemented and evaluated, providing valuable insights into its feasibility, energy efficiency, and data reliability. This positions it as a strong candidate for improving maternal care and seamless integration with existing healthcare systems.

Diagnosis and Management of Pseudo-Pericarditis due to Theileriosis in Cattle

Theileriosis is one of the common economic concerns in cattle, and normally hyalomma ticks transmit it. The estimated economic loss due to tropical theileriosis in India is INR 8,426.7 crore (Narladkar, 2018). Cattle have been thought to be susceptible animals in older days; however, the disease is also prevalent in buffalo, sheep and goats. Pale mucus membrane, enlarged lymph nodes, progressive weight loss and high fever are the routinely observed clinical signs in cattle (Patel et al., 2022). Blood smear examination and molecular confirmation are widely adopted for diagnosis. In large ruminants, various unusual clinical signs, including exophthalmos and pseudo-pericarditis, have been reported for a long time (Prajapati et al., 2019). Pseudo-pericarditis refers to jugular engorgement and edema of the brisket and ventral abdominal wall resulting from pressure at the cranial and caudal vena cava, which return blood to the heart (Radostits et al., 2000). The reported condition must be differentiated from true pericarditis for proper therapeutic management. In this case, the diagnosis of pseudopericarditis has been described along with management in cattle Ca s e Hi s to ry a n d Ob s e r vat i o n An eight-year-old crossbred cow with a history of brisket edema for the last 3 months, laboured breathing, enlarged pre-scapular lymph node and blackish bloody diarrhoea was brought for treatment at Veterinary Clinical Complex, Deesa, Gujarat India (Fig. 1A). Primary examination revealed a pale conjunctival mucus membrane and 103ºF rectal temperature. Ferroscopy carried out to rule out the presence of a foreign body was found to be negative. A small amount of faeces was collected to evaluate the parasitic load in the body, and no ova of any parasites were found. 2 mL of blood was collected for further investigation. The complete blood count revealed white blood cells 20.34 x 103/µL,, red blood cells 1.71 x 106/μL, haemoglobin 2.2 g/dL, packed cell volume 7.05 %, platelets 360 x 103/μL, lymphocyte 27%, monocyte 1 % and neutrophils 72 %. The field-stained blood smear examination revealed Koch’s blue bodies in lymphocytes (Fig. 1B). Meanwhile, an ultrasonographic evaluation of the thorax was carried out using a 2-5 MHz convex probe, and an accumulation of fluid around the heart was recorded (Fig. 1C). Further, PCR done for molecular confirmation of T. annulata infection using forward primer CCAGGACCACCCTCAAGTTC and reverse

Production and Marketing of Chilli in Middle Gujarat

Background: Gujarat state has favorable climatic condition for fruits and vegetables cultivation. The study was taken up to find the cost and return from chilli cultivation and their marketing channels. Methods: The data were collected using primary survey method while cost concept and Acharya’s formula were used to analyze the data in this study. Result: The study revealed that cost C2 was ₹ 201738.0 per ha in chilli cultivation while gross income was ₹ 485369.6 per ha. The net return was ₹ 278738 per ha and benefit cost ratio over total cost was 2.41 in the study area. Among the three-marketing channel found in the study area, channel III (5.59) was the most efficient marketing channel. This implies that need to encourage the marketing of chilli through channel III in the study area. Labour shortage and higher input prices were the major production constraint while less price received by farmers and labour problems were the major marketing constraint faced by farmers in the study area. This implies that there is need to use advanced mechanical tools and technology while production and marketing which ultimately lead to strengthen supply chain and reduce post-harvest losses.

Variations in Agriculture Credit Allocation: Evidence from Mann Whitney U Test

Background: Farmers need credit to meet the production costs and invest in agriculture activities, and with rising input costs, the situation becomes increasingly challenging, necessitating more accessible and adequate financial support. However, the untested notions of farmers' misutilization of agriculture credit restrict the banks and government from increasing the credit limit for farmers. Objective: This study was formulated to understand credit allocation purposes and their extent and to test any difference in allocation for agricultural and non-agricultural purposes. Methods: An ex-post facto study was conducted in the two districts of Gujarat state of India, where more acreage was under rice cultivation. With a purposive selection of talukas and villages, a sample size of 230 was finalized and contacted randomly using an interview schedule. The Mann-Whitney U test was performed to know any significant difference between the allocation scores for agricultural and non-agricultural purposes. Results and Conclusions: Descriptive statistics as frequency and percentages showed credit allocation for short-term agricultural activities such as procuring seeds (69.20%) and fertilizers (66.50%). Conversely, a notably lower credit allocation towards long-term investments like purchasing livestock and machinery (74.73%, 54.30% opted never) indicates a preference for immediate over long-term agricultural needs. The Mann-Whitney U test results reveal a significant difference (Z = 14.711, p < .001) between the allocation scores for agricultural and non-agricultural purposes, with a higher mean rank for agricultural activities. Though there was a reduction in the diversion of agricultural credit to non-agricultural purposes, the potential for optimal credit utilization has not been fully realized. Significance: The study suggests increasing loan amounts, simplifying application procedures, strengthening extension services, expanding Direct Benefit Transfer schemes, conducting financial literacy programs, and implementing robust monitoring and awareness campaigns to enhance efficient and ethical loan use, thereby fostering sustainable agricultural development.

Using Corporate Social Responsibility as A Tool to Reduce the Menace of Open Defecation and Improve Standards of Sanitation in the Villages of Mehsana, Gujarat

All Corporates as per under Section 135 of the Companies Act 2013 and Companies (Corporate Social Responsibility Policy) Rules 2014 have to spend a part of their profits in the areas designated by the Act. Eradicating hunger, poverty & malnutrition, promoting preventive health care & sanitation & making available safe drinking water is one such important focus area. ONGC Mehsana took up project for construction of individual household toilets in fifteen villages thereby leading to improvement insanitation and living conditions of these villages.The main aim of this paper is to study in detail the impact caused on the improvement in the sanitation index of these villages and the reduction in the waste generation thereby leading to open defecation free villages in the state of Gujarat. ONGC took up this project into consideration under CSR and after conducting a need identification study and necessary infrastructure was brought into place. The major issues discussed in the paper are the improvement in the sanitation index techniques and changes brought about due to the conJISEM struction of the household toilets. Multiple-choice questionnaire was circulated among the beneficiaries to document the process and record the changes. Relevant information was referred from primary sources published by ONGC Limited. It has been found that the construction of these household individual toilets has led to improvement in the sanitation of the villages leading to improved living conditions in the villages.

576. Chandipura virus infection: Time to think beyond Encephalitis?

Abstract Background Chandipura virus, first isolated in 1965, has caused several outbreaks in India, including significant ones in 2003-2004 in central India and in 2024 in western India. Typically affecting children aged 6-15, recent cases have shown an increase in extra-neurological manifestations. Baseline characteristics of patients Methods This study, conducted at a tertiary care hospital in western India from July 1 to August 13, 2024, examined the epidemiology, clinical profile, and treatment outcomes of patients with Chandipura virus infections. It was a single-center, observational study including all patients with confirmed Chandipura virus infection (RT-PCR positive in CSF or sera). laboratory characteristics of Patients Results Baseline Characteristics: This study involved 51 patients with a mean age of 10.27 (2.32) years, with 55% being male. All the patients were from endemic areas of Gujarat in India. The majority of the patients (90%) were immunocompetent. All cases (100%) were diagnosed positive on RT-PCR of CSF or sera. Clinical and Laboratory Characteristics: Common symptoms included fever (100%), headache (70%), altered sensorium (75%), circulatory collapse and shock (35%), and convulsions (25%). Symptoms lasted an average of 5.1 days. Liver dysfunction occurred in 60% of cases, and 19% had acute kidney injury. Abnormal PT, aPTT, and INR levels were found in up to 75% of cases. The main diagnoses were acute viral encephalitis (50%) and encephalitis with MODS due to circulatory collapse (40%). All 51 patients received standard treatment per Indian government guidelines, including IV fluids, paracetamol, and management of airway, breathing, circulation, intracranial hypertension, and seizures. The median hospital stay was 6 days. Of the 51 patients, 37 died—21 from circulatory collapse and 16 from encephalitic symptoms. The remaining 14 survivors will be monitored for residual neurological issues. Conclusion In high-dengue-endemic countries like India, diagnosing CHPV, which can mimic hemorrhagic fever, is challenging. Diagnosis is often delayed, leading to poorer outcomes. Most patients showed symptoms of hemorrhagic fever combined with encephalitic features, highlighting the need for further research on CHPV’s impact on blood vessel endothelial cells. Disclosures All Authors: No reported disclosures

Microplastics in rivers of Gujarat (India) until the Arabian Sea: assessment of the sources, distribution and associated environmental risk.

Microplastics (MPs) have become a notable concern and are released into the environment through the disposal or fragmentation of large plastics. Rivers have been the major pathways for MPs present in the oceans, which significantly affects the marine environment. In the current study, water samples were collected from the upper stream and downstream of Damanganga and Tapi rivers across different sites in the state of Gujarat, India for exploration of MPs contamination. Additionally, samples were also collected from Dumas Beach to detect the presence of MPs. MPs were extracted from the samples through sieving, density separation and wet peroxide oxidation (WPO) techniques which were subsequently analyzed using μ-FTIR, optical microscope, Pyrolysis GCMS (Py-GCMS) and SEM. The concentration of MPs was also quantified from each stretch of Damanganga, Tapi rivers as well as Dumas Beach. Findings revealed that Damanganga showed a higher concentration (3.53 particles/L) of MPs as compared to others. Further, optical microscope and μ-FTIR analysis confirm the presence of MPs like Polypropylene (PP), Polystyrene (PS), Polyethylene terephthalate (PET), Polyethylene (PE) and Polymethyl Methacrylate (PMMA). Pyrolysis products of PP, PS and Polyamide (PA) were detected from Py-GCMS studies. Additionally, SEM images revealed that MPs were subjected to weathering, oxidation and atmospheric deposition over the years. The study additionally confirmed the flux of MPs in both the rivers and beach due to anthropogenic and industrial effects. Risk assessment of MPs was performed using the Pollutant Loading Index (PLI), which indicated that the overall MPs pollution in the studied sites was marginal. Nevertheless, the PLI scores revealed that Damanganga was the most prone to MP pollution among the three study sites.

An assessment of the performance evaluation of the salt industry in india with special reference to the state of Gujrat

The purpose of this article is to examine the financing and production of the Indian salt industry. Studies have shown that salt is one of the oldest ingredients in food and has played an important role in the history of human civilization. It is an important component of food additives and is more important than food additives. Coastal areas of India, especially the states of Gujarat, Tamil Nadu, Maharashtra, Goa, Karnataka, Andhra Pradesh, Odisha and West Bengal, use seawater for salt production. The ocean is an inexhaustible source of salt. The three states, Gujarat, Tamil Nadu and Rajasthan account for 70%, 15% and 12% of the total salt production in the country. These states also meet the needs of the nation. India is self-sufficient in salt production. More than 95% of salt is produced by the private sector, making it a significant part of India's salt industry. The public sector accounts for only two to three per cent of the total. The mid-western state of Gujarat accounts for about three-quarters of India's annual salt production. The revenue from salt exports is more than the import price. This shows the financial advantage arising from the cost of importing and exporting Indian salt. The Indian salt industry faces many challenges including climate change and health and welfare issues for salt workers: unpredictable weather conditions such as floods and unseasonal rains, short salt seasons and reduced production needs. Therefore, policies need to be implemented properly to mitigate these problems.

One new species and one new record of family Photidae Boeck, 1871 (Amphipoda: Senticaudata) from Gujarat, India

The present study was conducted based on the amphipod specimens collected from the Veraval coast of Gujarat state, India. From the collection, 2 species of family Photidae Boeck, 1871 were identified: Audulla sindhu sp. nov. and Latigammaropsis photisimilis (Ruffo, 1969). Audulla sindhu sp. nov. can be differentiated from its only congener Audulla chelifera Chevreux, 1901 by having gnathopod 2 propodus comparatively longer and slender and presence of uropod 1 inter-ramus spur. Another species Latigammaropsis photisimilis (Ruffo, 1969) is first time reported from India in the study which was only reported from Red Sea (Ruffo, 1969) till now.

Economics of Seed Spices in Gujarat: Analyzing Parity of Cost, Price, and Income

This study analyzes the cost, price, and income parity in three major seed spices cultivated in Gujarat by examining indices of average input prices, Farm Harvest Prices, cost of production, and gross income to evaluate the profitability and challenges faced by farmers. The secondary data on input cost, cost of production and gross income were collected for the period of eleven years from 2011-12 to 2021-22 from the reports of “The Scheme for Farm Cost Studies of Important Crops in Gujarat State” and “The Scheme for Creating a Permanent Machinery for studying Cost of Cultivation/ Production of Principal crops grown in Gujarat state, further analysis of parity indices were estimated by taking 2011-12 as base year. The results indicate that for cumin crop, input prices grew significantly, while farm harvest prices exhibited a non-significant increase. Parity indices between Farm Harvest Prices and input prices remained below 100, indicating that farm harvest prices did not cover rising input costs. However, in years like 2016-17, 2018-19, and 2021-22, the farm harvest price and gross income were favorable, indicating profitability for farmers. In fennel, input prices and production costs showed significant growth, while farm harvest prices and gross income had minimal increases. Parity indices suggested that farm harvest prices were insufficient to cover rising costs in most years, though 2012-13 and 2021-22 were favorable for farmers in terms of both price and income. Coriander, with significant growth in input prices, showed a slight increase in farm harvest prices and a decrease in production costs. Parity indices indicated that the farm harvest price consistently exceeded input prices and the cost of production, ensuring favorable profitability and encouraging investment in coriander cultivation. Overall, the findings underscore the need for policy interventions to stabilize farm harvest prices and control input cost inflation, ensuring sustained profitability for farmers growing seed spices.

Understanding Gen Z Online Shopping Motives Attitudes and Intentions: A study with reference to Gujarat state

The Internet's rapid expansion has greatly accelerated the growth of e-commerce, bringing numerous benefits to consumers, such as personalized products, convenient transactions, and interactive experiences. This study investigates the key factors influencing online shopping intentions among Generation Z (Gen Z) consumers in Gujarat, India. It specifically analyzes the roles of Hedonic Motivation, Simplicity Motivation, and Usefulness Motivation, employing exploratory factor analysis and multiple regression analysis. Data were collected from 400 Gen Z respondents across major cities in Gujarat, including Ahmedabad, Surat, Vadodara, and Rajkot. The results reveal that Simplicity Motivation has the most significant impact, highlighting the importance of user-friendly online platforms. Hedonic Motivation underscores the value of enjoyment and entertainment in shaping shopping preferences, while Usefulness Motivation emphasizes practical benefits such as saving time and money. Based on these findings, businesses are encouraged to focus on creating intuitive user interfaces, incorporating engaging features like virtual try-ons, and promoting the practical advantages of online shopping. For future research, it is recommended to explore additional factors, such as consumer trust and the role of emerging technologies like AI-driven personalization, to gain a deeper understanding of Gen Z’s online shopping behaviors.

Sustaining a social movement through infrastructural followup: activist pedagogies and prefigurative politics in Narmada Bachao Andolan’s schools for life (jeevanshalas)

ABSTRACT This article is based on an exploratory study of jeevanshalas, a network of ‘schools for life’ run by the Narmada Bachao Andolan (NBA), an anti-dam movement in the Indian states of Gujarat, Madhya Pradesh and Maharashtra. Based on participant observation and conversations with movement leaders, teachers, administrators, parents and community volunteers, and on participatory research with children living in the localities of Jeevan Nagar and Trishul, Maharashtra, this article illuminates how the NBA—which did not succeed in its mission of stopping the construction of the Sardar Sarovar Dam— reinvented itself through education. It argues that the jeevanshalas offer a model of long-term sustainability for social movements whose aim is not necessarily to grow the movement’s membership but to catalyse wider societal change that might eliminate the need for the movement. The findings suggest that the NBA’s understanding of the social purpose of education reflects a view of young people as political agents whose voices shape the community’s collective future, in marked contrast with India’s state-run depoliticising education system. The jeevanshalas thus represent a previously under-researched model of social movement led education whose explicit aim is not to train movement agents but to leverage the transformative potential of education to address underlying patterns of oppression. The article theorises this rearticulation of the concept of ‘social movement schools’ through Spivak’s notion of ‘infrastructural followup’, which parallels recent debates about the nature of prefigurative politics.

Hibiscus sidiformis Baill. (Magnoliopsida: Malvales: Malvaceae): A New Addition to the Flora of India

ABSTRACTIn the present communication, Hibiscus sidiformis Baill. is reported as a new record for India from the arid region of Kachchh district, Gujarat state. The newly reported species shows a close similarity with the resembling resident species Hibiscus lobatus (Murray) Kuntze. A detailed taxonomic description with the palynological comparison is provided for the first time. The extension in the native range of H. sidiformis from Africa to Asia is proposed.

From Trust to Transaction: The Role of Micro-Influencer Image Satisfaction and Advertising Trust in Shaping Purchase Intentions

This research tries to explore the factors that contribute to forming attitudes towards micro-influencers on social media. We explore the antecedents through which social media influencers (SMIs) create image satisfaction and advertising trust leading to purchase intention. Taking a sample of 320 Instagram users in Gujarat state, India, the conceptual model was tested using Structural Equation Modelling on AMOS and SPSS statistical software. The study examined the hypothesis testing the attitudes of consumers (image satisfaction and advertising trust) towards SMIs. It was hypothesised that three variables, namely attractiveness, originality and expertise positively affect attitudes of consumers. Through analysis, it was found that all hypotheses were supported except two. Expertise did not impact image satisfaction significantly, and advertising trust did not impact purchase intention significantly. A complete theoretical framework is presented based on the influence of micro-influencers who are increasingly being used for advertising and marketing. This study provides a thorough understanding of the variables influencing purchasing intention, which benefits both academics and practitioners.

What enabled the successful implementation of a quality certification initiative in Bhavnagar, Gujarat? A policy analysis case study.

High-quality health systems are key to improving population health outcomes globally. In India, the National Quality Assurance Standards (NQAS) is a certification policy adopted by the government to improve the quality of care in public health facilities. This policy aims to assess public health facilities through a set of comprehensive, pre-defined standards derived from global best practices. However, only a small number of districts in the country have been able to effectively complete certifications as mandated. Bhavnagar, a district in the state of Gujarat in western India, is a positive deviant that has certified the majority of its primary health facilities. This study attempts to delineate factors that have led to successful quality certifications in Bhavnagar. Qualitative data was collected between December 2023-February 2024, and includes in-depth interviews of staff from state, district, and facility levels (n = 20), and group discussions with facility staff (n = 2). Data has been analysed from the lens of the 'policy triangle', comprising actors (policymakers, managers, implementers), context (political support), content (the policy and interpretation), and processes (plans, implementation, and evaluation). We found that Bhavnagar's political context is supportive of quality certifications, with the district's top managers directing the certification process. The district's mid-level operational team on quality has engaged with innovative solutions to solve checklist-related hurdles in infrastructure like establishing a temporary fire-escape or installing screens between rooms for additional space. A peer-mentoring system, wherein staff from already certified primary health facilities act as mentors to prospective ones, has been instituted. This study consolidates empirical lessons for boosting quality certifications in similar contexts. Further, it engages with quality as not just a technical issue, but a political one that is dependent on actors, their relationships, and the implementation context. In doing so, it deepens current understandings of quality improvement strategies in health systems globally.

Indoor Residual Spraying With Fludora Fusion for Malaria Control in Pyrethroid-Resistant Areas of Gujarat, India: A Community-Randomized Trial.

Background: The development of insecticide resistance in malaria vectors has necessitated a need to evaluate new insecticide molecules with different modes of action. In the present study, Fludora Fusion 562.5 WP-SB (clothianidin 50% + deltamethrin 6.25% AI/kg) was evaluated for its efficacy and residual action for the control of pyrethroid-resistant malaria vector, Anopheles culicifacies (Diptera: Culicidae), during May 2017 to February 2018 in Gujarat state, India. Methods: Fludora Fusion at the dose of 225 mg AI/m2 and bendiocarb at a dose of 400 mg AI/m2 as a positive control were sprayed in 5 villages each in districts of Kheda, Vadodara, and Panchmahal. The persistence of their efficacy on different local surfaces was determined against An. culicifacies. Entomological indices such as indoor resting density, human landing collections, pyrethrum spray collections, and exit trap collections were monitored to assess the impact of spraying. Results: The observed residual action of Fludora Fusion on mud and cement surfaces was for 6 months and bendiocarb for 3-4 months on both surfaces. Indoor resting densities and parous rate of An. culicifacies were significantly lower in houses sprayed with Fludora Fusion compared to bendiocarb-sprayed houses. Daily entomological inoculation rate (EIR) declined from 1.275 during prespray period to 0.5225 in the Fludora Fusion arm and 0.3802 in the Ficam arm in postspray period, indicating a reduction in the malaria transmission potential of An. culicifacies in both arms. Conclusion: Based on the residual action of the Fludora Fusion on most common sprayed surfaces and its effects on the elements of vectorial capacity, Fludora Fusion at 225 mg/m2 dose was found effective for more than 6 months and could be a potential option for the control of resistant mosquito vectors.

A Pertussis outbreak investigation, Amreli district, Gujarat state, India, December 2022 -August 2023

A Pertussis outbreak investigation, Amreli district, Gujarat state, India, December 2022 -August 2023