Growth Hormone Gene Research Articles

Growth Characteristic and the Study of Polymorphism Growth Hormone Genes of Sentul Chicken

The research was conducted to study the characteristics of growth, carcass production and growth hormone gene polymorphisms in various male sentul chickens. The research was conducted using experimental methods with a completely randomized design. The research material was 100 male day old chickens of Sentul. The treatment was a fixed factor, namely the variation of the color of the feathers of various Sentul chickens consisting of: “Abu” Sentul, “Emas” Sentul, “Geni” Sentul, “Debu” Sentul, “Batu” Sentul.. Each experimental unit consisted of 5 chickens and 4 replications. The variables measured included: hatching weight, body weight, body weight gain and the percentage of carcass produced at the age of 8 weeks. Identification of growth hormone gene polymorphisms used the primary design Gallus gallus haplotype GH-h22 growth hormone (GH) gene, complete cds, GenBank: JN675393.1 with forward primer / Sequence: AGGTGGTTCGGTTTTCACTG and reverse primer / Sequence: TCCCTTCTTCCAGGTCCTTT. Characteristics of growth and carcass production data were analyzed by analysis of variance; while to determine the presence of GH gene, polymorphisms were analyzed using the bioedit program. Analysis of variance showed that there were no significant differences (P> 0.05) between hatching weight, body weight, body weight gain and carcass percentage of various Sentul chickens. The results of GH Gallus gallus gene sequencing at base length 80 bp showed a mutation from adinine to cytosine, when comparing sentul chickens and Gallus gallus data in GenBank. The GH gene were present in various sentul chickens with monomorphic characteristics with homozygous genotypes of CC. The results of this study can be concluded that the characteristics of growth and carcass production in various Sentul chickens are relatively the same, as well as the monomorphic GH gene.
 Keywords: Sentul chickens, body weight, carcass percentage, growth hormone gene, monomorphic.

Mapping Growth Hormone Gene of Body Weight Krui Cattle in Pesisir Barat Regency Lampung, Indonesia.

<b>Background and Objective:</b> The growth hormone (GH) gene plays a role in meat growth and has been shown to increase the growth rate and carcass composition after being given GH. For this function, this gene is used as a strong candidate for genetic markers for meat growth traits. The research objective was to map the growth hormone (GH) gene of the bodyweight of Krui cattle in the Pesisir Barat Regency. <b>Materials and Methods:</b> This research used 30 blood samples of 30 Krui cattle. The method used was by taking quantitative data and blood samples from adult Krui cattle in Pesisir Barat Regency and then the blood samples were analyzed by DNA isolation method. PCR amplification used was a pair of GH-Forward primers: 5 'ATC CAC ACC CCC TCC ACA CAGT 3' and GH- reverse: 5 'CAT TTT CCA CCC TCC CCT ACA G 3', as well as digestion using the RFLP method at the Laboratory of Animal Breeding and Genetics of Universitas Gadjah Mada, Yogyakarta. Association between genotype and body weight was analyzed descriptively. <b>Results:</b> The results showed that Krui cattle had polymorphic genes with three genotypes found, namely: CC, CT and TT. Cattle with CT genotype had the largest average body weight or meat production compared to those with other genotypes. <b>Conclusion:</b> These results indicated that the GH gene identifier has strong evidence that it can be used as a selection tool with the help of genotypes of body weight traits of Krui meat production in the Pesisir Barat Regency. Krui cattle with CT genotype can be developed further because it has high economic value with high average body weight and meat production.

Expression of the Growth Hormone Gene during Early Development of Tiger Shovelnose Catfish (Pseudoplatystoma Fasciatum Linnaeus, 1766)

The early development stage of fish is crucial in fish farming, especially catfish species with cannibal characteristics, such as the Tiger Shovelnose Catfish (Pseudoplatystoma fasciatum Linnaeus 1766). Growth plays an essential role in fish’s life, which is influenced by the mechanism of growth hormone (GH). This study analyzed the level of growth hormone (GH) gene expression at several early developmental stages of Tiger Shovelnose Catfish. Samples were taken from an embryo, three days post hatched (dph) larvae to 60 dph juvenile. Isolation of mRNA was carried from the pituitary gland located at the head of the fish. Gene expression analysis was performed using RT-PCR method that compared GH/b-actin genes from band thickness. The results of the analysis showed the highest expression at 60 dph juvenile. The most significant increase in GH gene expression occurred from the egg to three dph larvae (P < 0.05), then decreased to 20 dph juvenile. The increased phenotypic growth was seen from the increased length and weight at 45 dph juveniles. This indicates the amount of growth hormone released at the juvenile stage of 20 dph, thus triggering rapid growth in the next stage at 45 dph juvenile. Growth hormones can act as growth biomarkers in Tiger Shovelnose Catfish. The novelty of this study was to determine the level of GH gene expression in Pseudoplatystoma fasciatum ornamental fish as the object of research. Suggestions for further research to explore genes related to growth mechanisms through transcriptomic and proteomic technologies.

Association of GH gene polymorphism with meat quality traits in meat and wool sheep

Increasing the productivity and effi ciency of lamb production is a key factor in the competitiveness of the meat sheep industry. Therefore, in order to conduct sheep breeding more effectively it is necessary to apply new approaches to increase and improve the quality of products.Considerable interest are modern technologies involving the use of DNA markers, which are widely used in national breeding programs of a number of countries with developed animal husbandry and have a signifi cant impact on improving productivity indicators. A significant number of genes associated with meat productivity and meat quality have been identifi ed. However, in sheep breeding, information about the main genes or loci that affect the growth characteristics and productive traits of sheep is relatively limited. Due to the growing interest in the production of young mutton and lamb, priority is given to the study of genes that control meat productivity. The greatest interests are studies on the evaluation of the polymorphism of the growth hormone (GH) gene, which controls growth and development, as well as infl uencing the meat productivity of sheep. In this regard, the purpose of this work was research aimed at fi nding associations between polymorphic variants of the growth hormone gene and the qualitative characteristics of meat in meat and wool sheep of the genotype ½ Poll Dorset × ½ North Caucasian Meat and Wool breed bred in the Stavropol Territory. The data obtained when studying the histostructure of the m. Longissimus dorsi, depending on the genotypes of GH gene, indicate that the muscle tissue in individuals with AB and BB genotypes was characterized by a large number of muscle fi bers by 5,7 and 6,4 %, their smaller diameter by 7,6 and 9,2 %, and a lower content of connective tissue compared to animals with the genotype AA of GH gene.

P-154 growth hormone supplementation decline quality of maternally aged oocytes via reducing aneuploidy

Abstract Study question Does growth hormone (GH) supplementation ameliorate the quality of oocytes in aged mice via reducing aneuploidy? Summary answer Daily injections of growth hormone for 2 months improve the age-related decline in ovarian reserve, and promote oocyte quality by reducing the aneuploidy rate. What is known already Women of advanced maternal age, particular over 35 years, could consequently bear poor quality oocytes, which are mainly caused by chromosomal aneuploidy. Age-related decline in GH levels may be related to the insufficient reproductive potential in women of advanced maternal age. To date, the role of GH in in vitro fertilization remains controversial. GH has been reported to affect oocyte quality, and studies in vivo have shown that intraperitoneal administration of GH reduces the occurrence rate of spindle/chromosome defects. Study design, size, duration The young (6-week-old) and aged (8-month-old) C57BL/6J mice were used in the study. In the in vivo experiment, aged mice were intraperitoneally injected daily with GH (1.6 mg/kg body weight, n = 85) or the equivalent volume of NS (n = 81) for consecutive for two months. In the in vitro experiment, GV oocytes from aged mice were treated with GH (Gene Science Pharmaceuticals, Changchun, China) (200ng/ml) in M16 medium for 14∼16 hours. Participants/materials, setting, methods We analyzed the number of oocytes and hormone levels to assess ovarian reserve, by immunohistochemistry and ELISA methods. The expression of GHR was measured by real-time quantitative RT-PCR and immunofluorescence. Time–lapse incubator was utilized to record the developmental potential of oocytes and embryos. Immunofluorescence was performed to assess parameters of oocyte quality (mitochondrial functions, ROS level, spindle/chromosome defects, and DNA damage). Chromosome spread and single-cell DNA sequencing were used to analyze chromosome aneuploidy rate. Main results and the role of chance The expression of GHR decreased in aged oocyte (21.68±1.08) and increased after GH treatment(30.64±0.70, P < 0.001). GH ameliorated decline in ovarian reserve of aged mice, with increased ovarian index (0.040%±0.0031 vs 0.023%±0.0019, P < 0.01), number of preantral follicles (7.33±0.89 vs 4.12±0.58, P < 0.05) and antral follicles (8.67±1.2 vs 3.33±0.88, P < 0.05) compared to the aged controls, but no other hormonal differences were detected. After GH supplementation, aged oocyte showed better quality and developmental potential, including restored mitochondrial functions (P < 0.05) and decreased ROS level (19.83±1.50 vs 23.6±1.72, P < 0.05). As expected, GH effectively promoted the fertilization rate (39.9%±1.10 vs 14.4%±0.62, P < 0.001) and early embryo development (P < 0.01). In addition, the spindle/chromosome defects (31.6%±2.12 vs 48.9%±1.83, P < 0.01), DNA damage (16.37±1.76 vs 49.35±2.52, P < 0.001) and aneuploidy rate (21.5%±1.61 vs 34.6%±1.84, P < 0.01) were lower in GH group than that in control group. Overall, GH treatment restored age-related decline in ovarian reserve, and decreased the occurrence rate of aneuploidy caused by spindle/chromosome defects, inducing a better oocyte quality in aged mice. Limitations, reasons for caution The molecular and mechanism of GH to regulate spindle/chromosome function remains to be determined. Besides, future work should be extended to human oocyte to determine whether this mechanism is conserved between mice and humans. Wider implications of the findings Our work expounds a theoretical basis for application of GH to improve the fertility of aged women. Besides, the results also feed new ideas for the prevention and treatment of oocyte quality decline in assisted reproductive technology. Trial registration number not applicable

Detection of Growth Hormone (GH) Gene Polymorphism in Norduz Sheep

Background: The Norduz sheep is a local breed of sheep bred for its meat, milk, progeny and fleece and is one of the genetic resources in the rural areas of Norduz, a district of the Turkish province of Van. The PCR-based method involves amplification of a conserved DNA region and digestion of the PCR products with DNA restriction endonucleases throughout the genome. Based on the resulting polymorphisms, statistical methods can be used to identify the desired genotypes among the alleles found. The objective of this study was to identify the polymorphisms of the growth hormone gene and determine their association with six growth traits in Norduz sheep. Methods: Out of 50 Norduz sheep, three different loci, GHY1, GHY2 and GHY3 (with the length of 599, 690 and 679 bp respectively) of GH gene on chromosome 11 of sheep genome were selected to identify polymorphisms among individuals using the PCR-RFLP technique (GH/MspI). Result: In this research study, no polymorphisms were detected after digesting three loci of the GH gene with the enzyme MspI. The 50 individuals of Norduz sheep had only AB genotypes for all three loci, indicating that no polymorphisms were present in the regions of the GH genes studied.

Can dietary phytogenic mixture improve performance for growth, digestive enzyme activity, blood parameters, and antioxidant and related gene expressions of Nile tilapia, Oreochromis niloticus?

The form of dietary phytogenic inclusion and its physiological causal mechanisms for growth promotion and immune stimulation in fish remain unknown. The study examined the effects of dietary phytogenic mixture extracted from lemon (Citrus limon), onion (Allium cepa), and garlic (Allium sativum) (LOG) on Nile tilapia performance, digestive enzymes, haemato-biochemical indices, oxidative stress, and associated gene expression for 70 days. In this experiment, diets were supplemented with 0, 10, 20, and 30 ml LOG kg−1 in isonitrogenous and isoenergetic diets and fed to tilapia with an average initial body weight (4.23 ± 0.09 g). Compared to the control diet, the dietary LOG at 20 ml kg−1 elicited the highest final body weight (FBW, 35.50 g fish−1), weight gain (WG, 31.2 g fish−1), specific growth rate (SGR, 3.02%, day fish−1), and survival rate (99.33%). Significant quadratic differences in chymotrypsin, trypsin, amylase, and lipase were shown with increasing LOG supplementation. There was a quadratic response in hematology parameters of fish with increasing LOG levels. Significant linear decreases in ALT, AST, cholesterol, and triglyceride were shown with the increased LOG inclusion in the diets. A polynomial correlation in total protein, albumin, and globulin was found under different inclusion levels of LOG while significant quadratic increases in SOD, CAT, and Gpx and significant quadratic decrease in MDA was found with increasing LOG supplementation. The IGM-2, SOD, and CAT gene expressions were quadratically improved; the highest relative expression was obtained by fish received 20 ml LOG kg−1 diet. Growth hormone gene expression was quadratically modulated in the liver and pituitary of fish fed diverse doses of dietary LOG compared with the control. The phytogenic of LOG at 20 ml kg−1 elicited the best tilapia performance and hematological indices, increased antioxidant and digestive enzyme activities, and gene expressions of growth, immunoglobulin and superoxide dismutase.

Polymorphism of growth hormone gene and its association with body measurement traits in Boer goat does

The study examined single nucleotide polymorphisms (SNPs) in the growth hormone gene (GH1) in Boer goat does and their relationship with body measurement traits, namely bodyweight, body length, heart girth, rump height, rump width, ear length, cannon circumference, and head width. Seventy-six Boer goat does between the ages of 2 and 4 years were used as experimental animals. Polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) and deoxyribonucleic acid (DNA) sequencing techniques were used to detect SNPs. Chi-square test was used to measure the genetic equilibrium and a general linear model was used for the marker-trait association analysis. The PCR-RFLP and DNA sequencing results discovered one SNP (G505C) in the exon 5 of the candidate gene with two genotypes observed (AA and AB). The association analysis indicated that bodyweight was associated with the genotypes (P <0.01), but not with any of the morphometric traits. A chi-square analysis indicated that the genotypic frequencies were in Hardy-Weinberg equilibrium. The polymorphism discovered in this study is a putative marker that might assist farmers in improving their does’ bodyweight through marker-assisted selection.

Effects of early low temperature exposure on the growth, glycolipid metabolism and growth hormone (gh) gene methylation in the late stage of Chinese perch (Siniperca chuatsi)

Temperature is an important factor affecting the early development, growth and physiology of fish, as well as on aspects of feeding and metabolism. Here, we investigated the impact of low temperature on the growth, glycolipid metabolism and growth hormone (gh) gene methylation in the late stage of Chinese perch (Siniperca chuatsi). Chinese perch larvae were exposed to temperatures with 21°C (low temperature group (LT)) and 25°C (control group) for 7days, and then the LT group was slowly heated to 25°C and raised at this temperature for two months. Results indicated that the LT group exhibited significantly lower growth rate and weight gain rate than the control group (p<0.05), but no obvious food intake (FI) were detected yet between LT group and control group. The larvae exposed at 21°C relative to the 25°C group had significant decreased transcript levels of GH-IGF axis genes (gh, igf1 and igf2) in Chinese perch juvenile (p<0.05). Further analysis of the DNA methylation levels of gh showed that the LT group had higher at the CpG sites of -3029 and-3032 than the control group in larvae (p<0.05), whereas the DNA methylation levels at CpG sites of -2982 and-3039 of gh were significantly lower compared with the control group in juveniles (p<0.05). In addition, the plasma glucose was significantly increased in the LT group (p<0.05), suggesting the metabolism of blood glucose slowed at low temperature. In larvae, the expressions of glycolipid metabolism genes (ins-ra and ins-rb) in LT group were significantly up-regulated compared to control group in larvae (p<0.05), while down-regulated in juveniles (p<0.05). The expression level of ucp2 mRNA was continuously up-regulated under low temperature stress. All these data demonstrate that early exposure to low temperature affected the growth and glycolipid metabolism of Chinese perch.

Meta-analysis of MspI derived variants of growth hormone gene associated with milk yield in dairy cattle

ObjectiveThe present work aimed to obtain common effect sizes for the gene frequency and association of MspI derived variants of growth hormone (GH) gene with milk yield in dairy cows. MethodsWe performed a systematic review and meta-analysis of 35 published studies identified in literature search from 2000 to 2020 (n = 4164). These studies were specific to fragment size (329) for genotypes viz., CC (224, 105 bp), CD (329, 224, 105 bp) and DD (329 bp). Pooled standard mean differences (SMDs) as effect sizes between allele pairs were derived using different genetic models. The heterogeneity between effects sizes across studies was estimated using I2 Index (%). ResultsThe common effect size for gene frequency of allele C (224, 105 bp) was significantly (P < 0.05) higher in 2881 Bos taurus/cross cows (0.82; 95% CI: 0.74, 0.89; I2 = 97.81%) than 1283 Bos indicus cows (0.15; 95% CI: 0.12, 0.18; I2 = 71.90%), with overall gene frequency was 0.33 (95% CI: 0.21, 0.46; I2 = 99.29%). Additive (CC vs. DD) and dominant (CC + CD vs. DD) did not revealed significant (P > 0.05) association with milk yield. However, completely over dominant (CC + DD vs. CD) and recessive (CC vs. CD + DD) models showed significant (P < 0.05) and positive SMDs with milk yield specially at early lactations. There was no evidence of heterogeneity (I2 = 0.00%) between SMDs across studies. ConclusionsThis meta-analysis suggested potential association of C allele for enhancing milk production of dairy cows.

Association analysis of nucleotide polymorphisms in growth hormone (GH) and its receptor (GHR) with body weight in Californian rabbits

The objective of the present study was to evaluate the influence of the genotypes of two single nucleotide polymorphisms (SNPs) – c.78C&gt;T located in the growth hormone gene (GH) and c.106C&gt;G in the growth hormone receptor gene (GHR) on individual body weight (IBW) during the growing period at 35, 70 and 90 d of age on a total of 107 weaned Californian breed rabbits. The restriction fragments obtained revealed that 74.8% of the rabbits carrying c.78C&gt;T SNP and 52.3% of the rabbits carrying c.106C&gt;G SNP were heterozygous, which indicated a moderate level of genetic diversity in this Californian population. Association analysis based on a single-gene approach revealed that c.78C&gt;T polymorphism in the GH gene had a significant effect (P&lt;0.05) on the weight at 70 and 90 d of age. The highest IBW (2530.4±66.6 g) was observed in rabbits carrying the c.78C&gt;T TT genotype, and detected individuals were significantly affected by the dominance effect. Significant differences were observed between individuals with homozygous c.106C&gt;G CC genotype and those with heterozygous CG genotype. The highest IBW (2462.0±198.3 g) was observed in rabbits carrying the c.106C&gt;G CC genotype and detected individuals were significantly affected by the additive effect. A total of nine combined genotypes of c.78C&gt;T and c.106C&gt;G SNPs was found in the study, of which only four major groups (CT/CC, CC/CG, CT/CG, and CT/GG) were concerned in the diplotype analysis. Significant differences were observed between individuals with CT/CC and CC/CG genotype combinations, and between those with the CC/CG and CT/GG diplotypes. However, the highest IBW at 90 d of age (2447.2±213.8 g) was observed in rabbits carrying the CT/CC genotype combinations. The highest coefficient of determination found for individual body weight at 90 d of age (R2=10.8%) indicated a high effect of genotype combinations. In conclusion, the results obtained suggested that c.78C&gt;T of GH gene and c.106C&gt;G of GHR gene could be useful candidate genes to improve growth performance in Californian rabbits with potential application in rabbit breeding programmes.

Association of growth hormone gene polymorphism with bodyweight Kampung chicken

&lt;p&gt; &lt;strong&gt;Objective&lt;/strong&gt;: The study's goal was to obtain growth hormone gene polymorphism and association growth hormone gene polymorphism with bodyweight Kampung chicken.&lt;/p&gt;&lt;p&gt;&lt;strong&gt;Methods&lt;/strong&gt;: The research material is 50 samples of blood from Kampung chickens aged three months. The method used was included: DNA ektraksi, amplification PCR, characterization and identification using PCR-RFLP with the enzyme MspI. The data collected is of a frequencies genotype and allele. The locus was polymorphic, equilibrium population on the diversity of the gene GH MspI association with body weight at three months of age was an analysis using the mean difference test.&lt;/p&gt;&lt;p&gt;&lt;strong&gt;Results: &lt;/strong&gt;Gene GH MspI of Kampung chicken polymorphic, the gene GH of Kampung chicken is in a population imbalance, gene GH MspI of Kampung chicken has a diversity very informative and has an association polymorphic on the genotype A2A2 significant (P&amp;lt;0.05) with bodyweight Kampung chickens aged three months.&lt;/p&gt;&lt;p&gt;&lt;strong&gt;Conclusions: &lt;/strong&gt;Gene GH MspI of Indonesian chicken has an association with body weight aged three months, polymorphic, and can be used as a reference in making selections to improve genetic quality.&lt;/p&gt;

Evaluation of candidate genotype of GH gene associated with growth, production and reproduction traits in Dairy Cows.

Growth hormone (GH) is a major regulator of postnatal growth and metabolism in mammals and plays a critical role in growth, production and fertility in cattle. The present study was conducted in dairy cattle to find the association of g.48769565 C>T mutation with growth, production and reproduction traits in Sahiwal and Hardhenu cattle. PCR-RFLP was performed to genotype g.48769565 C>T mutation using the MspI restriction enzyme in our resource cattle population. In Hardhenu cattle, the frequencies of C and T alleles were 0.59 and 0.41, respectively, while genotypic frequencies were 0.33, 0.53 and 0.14 for CC, CT and TT respectively. The frequencies of the C and T alleles were 0.24 and 0.76, respectively, in Sahiwal cattle and it was observed that the highest frequency was for the TT genotype (0.58) and the lowest was for the CC genotype (0.06). Chi-square analysis showed that g.48769565C>T SNP loci meet with the Hardy-Weinberg equilibrium in Sahiwal and Hardhenu cattle. From the least-squares analysis, it was observed that CC genotype was significantly associated with total milk yield (TMY), 300days milk yield (300D MY), lactation length (LL), dry period (DP) and artificial insemination (AI)/conception (p<.05). We also observed a significant association (p<.05) of genotype CT with 3-month calves body weight. Cows with TT genotype revealed comparatively favourable service period (SP) and calving interval (CI) in our resource population. These observed differences in their allelic and genotypic frequencies in association with the traits underlying production and fertility can be utilized for genetic improvement in dairy cattle.

Association of single nucleotide polymorphisms in the CAPN, CAST, LEP, GH, and IGF-1 genes with growth parameters and ultrasound characteristics of the Longissimus dorsi muscle in Colombian hair sheep.

Recognition of the genes that influence livestock production characteristics has allowed researchers to identify single nucleotide polymorphisms (SNPs) associated with phenotypic traits that contribute to higher productivity. The objective of this research was to associate SNPs in the genes calpain (CAPN), calpastatin (CAST), leptin (LEP), growth hormone (GH), and insulin-like growth factor 1 (IGF-1) with the growth characteristics birth weight (BW), weaning weight adjusted at 120days (WW), daily pre-weaning gain (PRADG), adjusted weight at 210days (AW210), and daily post-weaning gain (POADG), and the measures of the Longissimus dorsi muscle based on ultrasound, namely loin eye area (LEA), loin depth (LD), and back fat thickness (BFT), in Colombian hair sheep (OPC). The association between phenotypic and genotypic characteristics was made using the PLINK v.1.9 program using linear regression analysis. There was a statistically significant association (p < 0.05) between the CAST polymorphism (M/N) and BW, a tendency (p = 0.07) for an association between the T → C SNP of the CAPN gene and AW210, and a trend (p = 0.07) for an association between the A → G SNP of the IGF-1 locus and POADG. The LEA and BFT characteristics were not associated with a SNP, while PL was significantly affected by SNPs in the GH and IGF-1 genes. In conclusion, all the genes evaluated were polymorphic, the CAST gene significantly influenced BW, and the GH and IGF-1 genes were associated with LD characteristics. These results could be used to identify individuals with favorable genotypes to implement a marker-assisted selection method.

Evaluation of Dietary Probiotic Bacteria and Processed Yeast (GroPro-Aqua) as the Alternative of Antibiotics in Juvenile Olive Flounder Paralichthys olivaceus.

We investigated the three probiotic bacteria and a processed yeast (GroPro-Aqua) as the replacers of antibiotics in juvenile olive flounder. A total of seven diets were used, that is, one basal or control (CON) diet; and six other diets, of which, three diets were prepared by supplementing probiotic bacteria such as Bacillus subtilis WB60 (BSWB60) at 1 × 108 CFU/g diet, Bacillus subtilis SJ10 (BSSJ10) at 1 × 108 CFU/g diet, and Enterococcus faecium SH30 (EFSH30) at 1 × 107 CFU/g diet; one diet with processed yeast (GRO) at 0.35% diet; and two other diets were supplemented with oxytetracycline (OTC) and amoxicillin (AMO) at 4 g/kg of each. Triplicate groups of fish (average 12.1 g) were fed one of the diets for eight weeks. At the end of the feeding trial, the fish that were fed the probiotic bacteria-supplemented diets had a significantly higher final weight, weight gain, and specific growth rate compared to the CON, OTC, and AMO diets. Fish that were fed the GRO diet had significantly higher feed efficiency and protein efficiency ratios than those of the fish that were fed the CON diet. Serum glutamic pyruvic transaminase, glutamic oxaloacetic transaminase, glucose, and total protein were not affected by the diets. Lysozyme activity in fish that were fed the BSSJ10, BSWB60, and EFSH30 diets were significantly higher compared to the CON and OTC diets, whereas myeloperoxidase activity of fish fed the BSWB60 and EFSH30 diets were significantly higher than those of fish fed the CON and AMO diets. Flounder growth hormone gene expressions of fish that were fed BSWB60 and GRO diets were significantly higher compared to the CON, OTC, and AMO diets. The interleukin-1β gene expression of fish that were fed the BSSJ10, BSWB60, EFSH30, OTC, and GRO diets was significantly higher than those of fish fed the CON diet. The interleukin-10 gene expression of fish that were fed the BSSJ10, EFSH30, and GRO diets was significantly higher than those of fish fed the CON and AMO diets. Posterior intestinal histology of fish showed significantly higher villi length in fish that were fed the BSSJ10, BSWB60, EFSH30, and GRO diets compared to the CON diet. After 15 days of challenge test with pathogenic bacteria Edwardsiella tarda, the cumulative survival rate of fish that were fed the BSSJ10, BSWB60, EFSH30, and GRO diets were significantly higher than those of fish that were fed the CON diet. Overall, the results indicate that dietary supplementation of B. subtilis (108 CFU/g diet), E. faecium (107 CFU/g diet), and processed yeast (GroPro-Aqua at 0.35% diet) could replace the antibiotics in terms of improving growth, immunity, gut health, and disease resistance in juvenile olive flounder.

Exploring single nucleotide polymorphisms in GH, IGF-I, MC4R and DGAT1 genes as predictors for growth performance in dromedary camel using multiple linear regression analysis

Understanding the genetic factors influencing the growth traits of animal is very important for an accurate selection and genetic improvement of these quantitative traits. Therefore, the aim of this study was to identify polymorphisms in growth hormone (GH), insulin-like growth factor-I (IGF-I), melanocortin-4 receptor (MC4R) and diacylglycerol O-acyltransferase 1 (DGAT1) genes and their association with body weight and daily gain in dromedary camels. Blood samples were collected from seventy camels using vacutainer tube containing EDTA as an anticoagulant for DNA extraction. PCR-DNA sequencing approach was performed to investigate polymorphisms in fragments for 5’ UTR of GH (286-bp) and part of coding sequence (CDS) of IGF-I (462-bp), MC4R (512-bp), and DGAT1 (390-bp) genes. Results revealed that there were single nucleotide polymorphisms (SNPs) in the investigated genes between the enrolled camels except for IGF-I gene that elicited a monomorphic pattern. The identified SNPs allocated camels into different groups according to which animal harbored the explored SNPs. Using multiple linear regression analysis (MLR), identified SNPs had a significant effect on body weight and weight gain at different age stages. Determination coefficients (R2) value indicated that variability in the phenotypic measurements of growth performance might be correlated with the identified SNPs in growth related genes. The area under the ROC curves was higher in the case of DGAT (0.793-1.0), followed by GH (0.736-0.866) and then MCR (0.410-0.545). DGAT anticipates body weight and weight gain traits better than GH and MCR. As a pilot study, single nucleotide polymorphisms in the investigated genes could be used as proxy predictors and genetic markers that permit a marker assisted selection for growth traits in dromedary camels.

Genetic polymorphism of the growth hormone (GH5) gene in small ruminants

Genetic polymorphism of the growth hormone (GH5) gene in small ruminants

Genetic variability in GH and IGFBP-3 genes and their association with growth performance in Egyptian sheep

The polymorphisms in Insulin-like Growth Factor Binding Protein-3 (IGFBP-3) and Growth Hormone (GH) have an effect on mammalian growth control, development and reproduction activity. This investigation aimed to study the polymorphism in IGFBP-3 and GH genes, and detect their association with body weights and growth performance of several sheep breeds (Ovis aries) namely; Rahmani, Barki, Rahmani x Barki cross, Awassi/Awassi x Suffolk cross and Ossimi. Digestion of 654 bp for IGFBP-3/HaeIII yielded only one restriction pattern of 8 fragments in all studied breeds revealing the absence of polymorphism and this agrees with gene sequencing. While, sequencing analysis of the amplified fragment of GH gene revealed polymorphism in nucleotide sequencing. 4 SNPs out of 11 (C1776G, T1772A, G1769C and C1765A) in Rahmani, while 1 SNPs out of 2 (A1544G) in Barki, whilst 3 SNPs out of 4 (A1678G, A1558G and A1544G) in Rahmani x Barki cross, whereas 2 SNPs out of 4 (C1765A and G1550A) in Awassi /Awassi x Suffolk cross and 3 SNPs out of 8 (T1772A, G1769C and G1756C) in Ossimi were very important. The amino acid sequence for GH gene of Rahmani was different from those of other breeds in 4 amino acids, while, each of Rahmani x Barki cross and Ossimi amino acid sequences were different in 3 amino acids. The current results suggest that body weights and growth performance of tested sheep breeds at different stages of growth are statistically affected by GH gene which could be considered as a candidate gene for growth in breeding programs.

Sequence analysis of exon 1 and intron 1 of growth hormone gene in six chicken genotypes raised in tropical environment

Alpha % Growth hormone gene % Nigerian indigenous chicken % SNPs KR nema Chicken growth hormone (cGH) is a polypeptide hormone secreted by the pituitary gland which is responsible for several functions such as tissue growth and reproduction in chickens. This study was conducted to characterize six chicken genotypes using exon 1 and intron 1 regions of cGH gene sequences. One hundred and thirty-four (134) chickens comprising Normal feather (19), Naked neck (21), Frizzle feather (8), Arbor Acre (24), FUNAAB Alpha-1 (dihybrid) (31), and FUNAAlpha-2 (trihybrid) (31) were used for the study. Blood samples were collected from the birds into EDTA bottles for DNA extraction. The exon 1 and intron 1 regions of cGH were amplified using published primers. The product of the polymerase chain reaction was subjected to Sanger sequencing. DnaSP5 software was used to determine the diversity indices and MEGA6 software was used to determine the phylogenetic relationships among the six chicken genotypes and other chicken sequences. Fifteen (15) SNPs were identified in intron 1 and none in exon 1 of the cGH gene in all the six genotypes, and nine (9) of the SNPs occurred as transitions while others were transversions. The allele frequency ranged from 0.30 to 0.95 while the highest heterozygosity (0.66) was observed in mutation 410A&gt;C in Naked neck genotype and lowest heterozygosity observed in Arbor Acre at SNP 330C&gt;T. Polymorphic Information Content (PIC) was at the maximum in SNP 410A&gt;C in Naked neck genotype with a value of 0.92. The exon 1 phylogeny tree revealed two clades where all the genotypes diverged. Intron 1 revealed two clades where Frizzle feather clustered with FUNAAB Alpha-1, Naked neck and FUNAAlpha-2 clustered together at one of the sub-clades in the second clade. Network analysis revealed Normal feather chicken as the major ancestor of all the genotypes. The study concluded that intron 1 of cGH is polymorphic in all the six chicken genotypes investigated, and this can be used as candidate gene for selection in growth-related traits.

CgGH insertion functional domain analysis in transgenic G1 and G2 and G3 mutiara catfish (Clarias gariepinus) broodstock

Catfish is one of the most important freshwater fish farming commodities in Indonesia. Higher catfish production can be achieved by cultivating transgenic catfish carrying the growth hormone (GH) gene of African catfish (Clarias gariepinus GH, CgGH). This research focuses on analysis of the presence of the CgGH gene in transgenic G1, G2, and G3 mutiara catfish broodstock, as an indication of stable CgGH inheritance. CgGH gene was isolated using the RNeasy mini kit and RT-PCR. RT-PCR revealed amplicons measuring approximately 600 bp in transgenic G0, G1, G2, and G3 mutiara catfish. The CgGH consensus sequence similarities ranged from 93.76% to 97.06%, with four functional domain sites (somatotropin-1, somatotropin-2, four α-helix, N-glycosylation, four cysteine residues) of fish GH proteins. The functional domains of fish GH proteins are conserved in G1, G2, and G3 and indicate stable exogenous GH inheritance to produce transgenic catfish strains in each generation.