Articles published on Grapevine Pinot gris virus
Authors
Select Authors
Journals
Select Journals
Duration
Select Duration
130 Search results
Sort by Recency
- Research Article
- 10.1094/pdis-09-25-1829-pdn
- Nov 26, 2025
- Plant Disease
- Abdelaal H.A Shehata + 3 more
Grapevine leafroll-associated virus-3 (GLRaV-3) is considered the most predominant cause of grapevine leafroll disease (GLD), one of the most destructive viral diseases affecting grapevines and wine production worldwide (Maree et al. 2013). GLRaV-3 is a positive-sense, single-stranded RNA (+ssRNA) virus in the family Closteroviridae, genus Ampelovirus, species tritis (Martelli et al., 2012; Maree et al., 2013). Grape plants (cultivar ‘Errante Noir’) were planted at the Chilton Research and Extension Center (CREC), Chilton County, Alabama, in the spring of 2024. In November 2024, a plant exhibited symptoms of dark-purplish red veins with cupping of the leaf margins, and in July 2025, symptoms of reddish-brown blotches randomly distributed on the foliage appeared (Supplemental Figure 1: A: I-II). To investigate if a pathogen caused this, a sample was sent to Agdia, Inc. (Elkhart, IN, USA), where tissues were subjected to a pathogen screen, including alfalfa mosaic virus (AMV), arabis mosaic virus (ArMV), grapevine fanleaf virus (GFLV), Phytophthora (Phyt), peach rosette mosaic virus (PRMV), strawberry latent ringspot virus (SLRSV), tomato ringspot virus (ToRSV), tobacco ringspot virus (TRSV), GLRaV-3, grapevine pinot gris virus (GPGV), grapevine red blotch-associated virus (GRBaV), and Xylella fastidiosa (Xf). The sample tested negative for all except for GLRaV-3. To confirm GLRaV-3, RT-PCR was used. Total RNA was extracted from 0.1 g petiole tissue from three subsamples using the RNeasy Plant Mini Kit (Qiagen), producing three separate RNA samples. The cDNA was synthesized using SuperScript IV Reverse Transcriptase (Invitrogen), and Platinum Taq DNA Polymerase (Invitrogen) was used to amplify the heat shock protein (HSP70) and the coat protein (CP) using specific primers (Thompson et al. 2019). PCR products were checked on the TapeStation using the D1000 ScreenTape kit (Agilent), and amplicons corresponding to 600 bp (HSP70) and 280 bp (CP) were detected (Supplemental Figure 1: B). Sanger sequencing was conducted at Azenta Life Sciences in both directions. The manufacturer’s instructions were followed in all used kits. Sequences were analyzed using BLASTn (Altschul et al. 1990) to confirm that all three sequences from each gene match GLRaV-3. Sequences were submitted to GenBank (accessions: PX123059-64), and an isolate name was given (GLRaV-3_Chilton-AL.1.1-3). The closest BLAST hit is GLRav3-8415B (KY073324.1) with 100% (HSP70), 98.24% (CP) nucleotide similarities (Supplemental Table 1). The CP sequences of GLRaV-3_Chilton-AL.1.1-3 were compared to 139 isolates of GLRaV-3 from GenBank (Supplemental Table 1) to construct a maximum likelihood tree using methods described by Shehata et al. (2025), with a modification where IQ-TREE was used to construct the tree with 1000 replicates (Nguyen et al. 2015). This tree indicated that GLRaV-3_Chilton-AL.1.1-3 is within group XII, with two isolates from Canada (Supplemental Figure 1: C). Other grape plants planted along with the infected plant at the Chilton Co. site (n=15) were also tested for GLRaV-3 as described above, and all tested negative. This constitutes the first report of GLRaV-3 in Alabama, highlighting the importance of purchasing clean material to prevent introduction of the disease in vineyards, a crop with a total impact of $1.5 billion in Alabama (Good, T. 2023).
- Research Article
- 10.3389/fpls.2025.1659802
- Sep 25, 2025
- Frontiers in Plant Science
- Nikoletta Jaksa-Czotter + 4 more
Using small RNA high-throughput sequencing (HTS), we previously demonstrated the widespread distribution of grapevine Pinot gris virus (GPGV) in Hungarian vineyards. This trichovirus has been associated with a disease known as grapevine leaf mottling and deformation (GLMD). However, since GPGV has been detected in both symptomatic and asymptomatic plants, its exact role in GLMD disease is not well-characterised. Studies addressing this question suggested that differences in the GPGV susceptibility of the grapevine cultivars and the presence of variants of the virus could affect symptom development. Being able to suppress various steps of the RNA interference-based defence reactions, the viral suppressor of RNAi (VSR), encoded by the ORF3 of GPGV, can also alter the symptom development. In the present study, we compared the VSR activity of the ORF3-encoded coat protein of symptomatic and asymptomatic GPGV variants and found that both possess VSR activity. Testing the VSR activity of the ORF2-encoded movement proteins from the two variants, using a GFP-based transient gene expression assay, we found that the GPGV-MP has weak systemic VSR activity. Moreover, we found that the transient expression of the MP variants induced necrosis in the infiltrated leaves, which was stronger in the case of the symptomatic variant. To functionally characterise the crucial sequence elements of MP responsible for this difference in the necrosis between symptomatic and asymptomatic variants, the necrosis-inducing activity of GPGV-MP encoded by different natural and recombinant variants was tested. Differences in the GPGV-MP necrosis-inducing activity suggested that, besides the previously described C/T polymorphism, different phosphorylation patterns of the GPGV-MP may contribute to symptom development.
- Research Article
1
- 10.3389/fpls.2025.1536862
- Mar 25, 2025
- Frontiers in Plant Science
- Daria Belkina + 7 more
The spread of cultivated grapevine from primary centers of origin is inevitably accompanied by the range expansion of its pathogens, including viruses. A limited number of wild Vitis vinifera L. ssp. sylvestris (Gmelin) Hegi populations have survived in the centers of grapevine domestication and can be used for comprehensive studies. We analyzed 50 grapevines collected in protected areas of the Black Sea region, which belong to the Caucasian domestication center. Based on genotyping of grapevines using simple sequence repeats as DNA markers, we determined the phylogenetic placement of V. vinifera ssp. sylvestris from the Black Sea region compared to cultivated and wild grapevines of the world. Using high-throughput sequencing of total RNA, we obtained the viromes of these grapevines. Ten viruses and one viroid were identified. The most common viruses detected were Vitis cryptic virus, grapevine rupestris stem pitting–associated virus, grapevine Pinot gris virus, and grapevine virus T. Among the economically significant viruses, we identified grapevine leafroll-associated virus 1 and grapevine virus A. A total of 91 complete or nearly complete virus genomes and one viroid genome were assembled, and phylogenetic analysis was performed. Two novel (+) ssRNA viruses were discovered, tentatively named Abrau grapevine-associated virus in the order Hepelivirales and Taurida grapevine-associated virus in the order Picornavirales. It is important to comprehensively consider the phylogeography of both viruses and their plant hosts. This is the first study that simultaneously addresses the population genetics of V. vinifera ssp. sylvestris from the Caucasian domestication center and its viruses.
- Research Article
- 10.1016/j.virol.2024.110360
- Feb 1, 2025
- Virology
- Dipendra Karki + 2 more
Comparative analyses of three grapevine Pinot gris virus cDNA clones reveal insights into the pathological properties of different phylogroups.
- Research Article
- 10.17660/actahortic.2025.1418.19
- Feb 1, 2025
- Acta Horticulturae
- I.C Guţă + 2 more
Using the analytical hierarchy process to select the most appropriate method for grapevine Pinot gris virus and grapevine fleck virus elimination
- Research Article
- 10.1002/ndr2.70014
- Jan 1, 2025
- New Disease Reports
- B Sánchez‐Moncada + 1 more
Occurrence of grapevine Pinot gris virus in commercial table grapes in Peru
- Research Article
- 10.1094/php-06-24-0061-rs
- Nov 13, 2024
- Plant Health Progress
- Kerri A Neugebauer + 5 more
Viral diseases are widespread in vineyards throughout the world. Vineyard viruses are mostly disseminated via vegetative propagation, although insect and nematode vectors can also be involved in the spread. Michigan faces challenges with grapevine viruses due to the following: (i) multiple Vitis sp. ( V. vinifera, V. labrusca, and Vitis interspecific hybrids) being cultivated within the state, (ii) vineyards that vary in age, and (iii) plant material being sourced from a variety of locations throughout the United States. Determining the distribution of grapevine viruses in Michigan is the first step in developing mitigation strategies. In this study, we utilized real-time reverse transcription polymerase chain reaction (RT-PCR) to test for a variety of grapevine viruses that are known to occur in other regions. Vineyards were sampled for grapevine leaf tissue ( n = 429) across the northwest, southwest, mid, and southeast regions of the lower peninsula of Michigan and were screened for a panel of viruses. Across all samples, grapevine rupestris stem pitting-associated virus (GRSPaV) was the most abundant. Other viruses found in relatively high abundance included grapevine leafroll-associated virus 3 (GLRaV3), grapevine fleck virus (GFkV), and tobacco ringspot virus (TRSV). Interestingly, this study identified grapevine red blotch virus (GRBV) and grapevine Pinot gris virus (GPGV) for the first time within the state. This survey gives researchers and growers an awareness of the distribution of viruses in Michigan vineyards that can aid management recommendations and encourage the use of virus-tested material from reputable sources when planting new vineyards.
- Research Article
- 10.3390/agronomy14112594
- Nov 4, 2024
- Agronomy
- Xiaolong Deng + 8 more
Grapevine berry inner necrosis virus (GINV) and grapevine Pinot gris virus (GPGV) are prevalent viral diseases affecting viticulture, posing significant threats in grape-producing regions of China. Previous studies have emphasized the harmful effects of grape viruses on the grape industry all over the world. However, few reports have focused specifically on GINV. In wild grapevines, GINV infection frequently leads to grapevine fanleaf degeneration disease (GFDD). GINV often co-occurs with other grape viruses, exacerbating its harmful effects on the grapevine industry in China. In this study, we collected grapevine samples from Taizhou city, Jiangsu Province, where GINV infection was confirmed. Based on the GINV coat protein (CP) gene, we developed a high-throughput and high-sensitivity direct antigen-coated ELISA and Dot blot assay for field diagnosis of GINV CP in grape samples. The CP gene was cloned from GINV-infected grape samples, and the GINV CP was expressed using the pET30(a) vector. Specific polyclonal antiserum CPGINV was generated by immunizing rabbits with the purified protein, and its sensitivity was determined to be satisfactory. Leveraging the high accuracy and sensitivity of the CPGINV antiserum, we developed a rapid, precise, and scalable diagnostic method for GINV in the grapevine industry. The established ELISA and Dot blot assays successfully detected GINV-infected grapevine samples. The occurrence of GINV is relatively common in China, which poses a risk of transmission and threatens the healthy development of the grape industry. Therefore, this study prepared CPGINV antiserum and established an efficient, rapid, sensitive, accurate, and high-throughput diagnostic method, providing a foundational approach for the prevention and control of vitis viral diseases.
- Research Article
- 10.1007/s10341-024-01193-7
- Sep 27, 2024
- Applied Fruit Science
- Başak Ulaşlı + 3 more
Molecular Characterization of Colomerus vitis (Pgst.) (Trombidiformes: Eriophyidae) and Its Potential Role as a Vector of Grapevine Pinot Gris Virus (GPGV) in Turkish Vineyards
- Research Article
3
- 10.1094/pbiomes-06-24-0066-r
- Sep 25, 2024
- Phytobiomes Journal
- Emanuel Gaši + 6 more
Arbuscular mycorrhizal fungi (AMF) have been shown to improve plant host tolerance to biotic stresses. However, AMF-mediated protection against virus diseases has been highly variable and poorly investigated in perennial crops. In this study, we investigated the influence of AMF on virus concentration and distribution in grapevine coinfected with three common viruses, grapevine rupestris stem-pitting associated virus (GRSPaV) solely or in coinfection with grapevine leafroll-associated virus 3 (GLRaV-3) and grapevine Pinot Gris virus (GPGV). Two different types of AMF inocula were used: (i) Rhizophagus irregularis and (ii) R. irregularis, Funneliformis mosseae, and F. caledonium (Mix). Sampling for quantitative RT-PCR was performed three times in a 1-year period in four distinct grapevine tissues for the assessment of GRSPaV concentration in AMF-inoculated grapevine. AMF influence on GRSPaV was the most significant in the first sampling, 2 months postinoculation, with the virus accumulating predominantly in the roots. Simultaneously, GRSPaV concentration in young grapevine leaves was low, possibly due to modified source–sink dynamics. Quantification of GLRaV-3 and GPGV was performed in coinfected grapevine in the third sampling. After a year, both viruses exhibited accumulation in the roots of mycorrhizal plants. However, GLRaV-3 displayed accentuated accumulation and GPGV decrease in foliage, indicating a differential effect on the virus in coinfected grapevine. Regarding AMF symbiosis, generally, the Mix inoculum induced more pronounced virus concentration changes than R. irregularis alone. In summary, this study shows differences in the virus load of AMF-inoculated and AMF-free grapevine and adds nuance to the complex multitrophic interactions that are shaping grapevine health. [Formula: see text] The author(s) have dedicated the work to the public domain under the Creative Commons CC0 “No Rights Reserved” license by waiving all of his or her rights to the work worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law, 2025.
- Research Article
- 10.36253/phyto-15465
- Sep 16, 2024
- Phytopathologia Mediterranea
- Sanja ŽIvković + 4 more
Sixty-five samples of grapevine from commercial vineyards in the Rasina district of Serbia were tested for the presence of grapevine Pinot gris virus (GPGV), using the reverse transcription-polymerase chain reaction. Fourteen samples of the grapevine varieties ‘Red Globe’, ‘Victoria’ and ‘Preobraženje’ were infected with GPGV. All the infected plants showed symptoms of leaf chlorotic mottling, puckering, and deformation, stunting, and reduced yields. The coding regions of the movement and coat protein (MP/CP) and a region of the RNA-dependent RNA polymerase (RdRP) domains of eight virus isolates were sequenced. Phylogenetic analyses of these genomic regions showed high nucleotide similarity among the Serbian GPGV isolates. This study is the first to describe genetic diversity of GPGV isolates in Serbia.
- Research Article
- 10.1007/s42161-024-01737-6
- Aug 13, 2024
- Journal of Plant Pathology
- Qingyun Yuan + 5 more
Complete genome sequencing and infectious cDNA clone construction of a Chinese isolate of grapevine Pinot gris virus (GPGV)
- Research Article
1
- 10.1186/s12985-024-02453-4
- Aug 6, 2024
- Virology Journal
- Noemi Messmer + 5 more
BackgroundGrapevine Pinot gris virus (GPGV) infects grapevines worldwide and causes symptoms such as chlorotic mottling and deformations on leaves, stunted shoots and short panicles, or none of these symptoms if it appears as latent infection. So far, the consequences of GPGV infections for winegrowers are difficult to assess since important information such as plant performance at different GPGV infection levels and symptom expression are not fully clarified.MethodsIn order to investigate the course of GPGV spread, annual visual evaluations and ELISA tests were conducted over 3–4 consecutive years in four GPGV-infected vineyards in southern Germany: GEM, HEC, NIM, and REI. The program PATCHY was used to analyze spatial disease patterns. Sanger sequencing was used to determine virus isolates in vines at different GPGV infection levels, to test their respective influence on symptom expression. Yield and GrapeScan (FTIR) analyses were conducted to test the impact of different GPGV infection levels and isolates on fruit quantity and quality.ResultsGPGV infections significantly increased in all four vineyards (GEM 22–32%, HEC 50–99%, NIM 83–90%, REI 56–76%) with significant spreading patterns across and along rows. Specific symptom progression patterns were not observed. According to our results, the virus isolate has an influence on whether symptoms develop during a GPGV infection. While yield analyses revealed that yield losses only occur in symptomatic vines and range from 13 to 96% depending on the severity of symptoms, latent infections have no impact on grape production. No relevant effects of GPGV infections on must quality were observed.ConclusionsSecondary spread of GPGV was observed in all vineyards monitored, indicating vector-borne transmission that is likely to be accelerated by human viticultural management. GPGV should be further monitored to prevent the accumulation of detrimental symptomatic isolates. The results of this study can be used to assess the risk of GPGV to viticulture and should be considered when developing management strategies against the virus.
- Research Article
- 10.1094/pdis-11-23-2452-pdn
- Aug 1, 2024
- Plant disease
- Shawkat Ali + 4 more
Grapevine enamovirus 1 (GEV1) belongs to the genus Enamovirus, in the family Solemoviridae. It has been reported from several countries infecting grapevines including Brazil (Silva et al. 2017), China (Ren et al. 2021) and France (Hily et al. 2022). To assess the prevalence and diversity of economically important grapevine viruses in nine Canadian vineyards, total RNA and double-stranded RNA (dsRNA) (Fall et al. 2020) were extracted from 30 and 100 composite samples respectively, with each consisting of five vines of the same cultivars. The cultivars included in this study are Frontenac noir (n=34), Vidal (n=32), Marquette (n=33), Riesling (n=31), and Pinot noir (n=31). The total RNA and dsRNA samples were subsequently multiplexed and diagnosed by high-throughput sequencing (HTS) on NovaSeq (600 S4 PE100) and MiSeq (2 × 250 cycle PE) respectively. From NovaSeq and MiSeq sequencing, an average of 410,000 to 1.3 million reads/sample were obtained, respectively, with mapped viral reads representing 10.92% to 12.48% of the total reads. After sequence quality was verified using Trimmomatic v.0.40 (Bolger et al. 2014), the clean sequences were screened against all possible viruses in the databases using the Virtool (Rott et al. 2017) and VirFind virus detection pipelines (Ho and Tzanetakis 2014). GEV1 was detected in clean sequences from two, three, and two leaf samples of cultivars 'Marquette' 'Riesling' and 'Frontenac noir' respectively. Six of the seven HTS-assembled GEV1 genomes were partial, ranging from 4,523 to 6,000 nucleotide (nt) with genome coverage varying from 71% to 89%. Only one 6,314 nt long assembled contig (Accession No. OR021829), represented a nearly complete genome, being only 53 and 3 nt shorter than Sd-CG (MT536978) at 5' and 3' untranslated regions (UTR), respectively. Isolate 3- Riesling-CAN (OR021829) shares 90.56 to 94.19% nt identities with several GEV1isolates at 96-99% of query coverage. Phylogenetically, OR021829 is closer to GEV1 isolates from France and China (Figure S1). To validate the HTS results, the developed primer pair SetF and Set1R (Silva et al., 2017) was used for RT-PCR detection. The amplicons from all seven HTS-positive samples were sequenced using Sanger sequencing, confirming the presence of GEV-1 in three studied grape cultivars in Canadian vineyards. Symptoms associated with the specific GEV1-infected vines could not be explained as composite samples were used. Each of the combined samples HTS library also tested positive for at least one of the known grape virus/viroids, namely grapevine leafroll associated-virus -3, grapevine pinot gris virus, grapevine rupestris stem pitting-associated virus, Marafivirus syrahense grapevine Syrah virus-1 and hop stunt viroid. To our knowledge, this is the first report of GEV1 being detected in grapevines in Canada, or in any North American vineyard. GEV1 is a relatively new virus, and its biology remains largely unknown. Based on this sequence new GEV1 primers can be developed to know the genetic variability among GEV-1 and improve the detection of this virus in vineyards.
- Research Article
- 10.36253/phyto-14492
- Jul 17, 2024
- Phytopathologia Mediterranea
- Réka SáRay + 6 more
Grapevine Pinot gris virus (GPGV) is a recently identified trichovirus infecting grapevines. Despite wide distribution, there is limited available information on epidemiology, transmission, and associated symptoms of grapevine leaf mottling and deformation. Occurrence and genetic diversity of GPGV variants were surveyed in an organically cultivated Hungarian vineyard that was planted between 1996 and 2014. Sequence analysis demonstrated the widespread presence and high variability of GPGV, and according to phylogenetic analyses, the Hungarian virus isolates were classified into three groups. Most of the identified variants clustered with the representative asymptomatic isolates, but all isolates from one grapevine cultivar grouped with representative isolates of clade B. Furthermore, one isolate clustered with representative isolates of clade C, and the identified clade C variant had previously undescribed polymorphisms.
- Research Article
- 10.1094/pdis-04-23-0765-pdn
- Feb 20, 2024
- Plant Disease
- X D Fan + 4 more
Grapevine asteroid mosaic-associated virus (GAMaV), a member of the genus Marafivirus of the family Tymoviridae, was first described to infect grapevines in California (Abou Ghanem-Sabanadzovic et al. 2003). Since then, GAMaV has been reported from Greece, Japan, Canada, Uruguay, France, Hungary, Italy, Spain, Switzerland and Russia, and also in some free-living grapevines in North America (Kyriakopoulou, 1991; Morán et al., 2021; Reynard et al., 2022; Shvets et al., 2022; Thompson et al., 2021). GAMaV may be associated with grapevine asteroid mosaic disease (Martelli 2014). In August 2022, a grapevine cv. Cabernet Sauvignon exhibiting chlorotic mottling was collected in Ningxia, China. Total RNAs were extracted using RNAprep Pure Plant Plus Kit (DP441, TIANGEN BIOTECH, Beijing), and the ribosomal RNA were removed by the Epicentre Ribo-Zero rRNA Removal Kit (Epicentre, Madison, WI, USA). The ribosomal RNA-depleted RNAs were then used to construct a cDNA library using a TruSeq RNA Sample Prep Kit (Illumina, San Diego, CA, USA), which was sequenced on an Illumina NovaSeq 6000 platform (Biomarker Biology Technology), resulting in 39,297,567 paired-end clean reads (150 nt × 2). Reads mapping to the grapevine genome (GenBank accession no PN40024) were removed using hisat2 2.1.0 software. The 15,003,158 unmapped reads were de novo assembled into 70,512 contigs using the rnaviralSPAdes method in the SPAdes v3.15.3 software with default parameters and analyzed through BLASTn and BLASTx analysis. Five viruses and two viroids were identified: GAMaV (5 contigs), grapevine Pinot gris virus (3 contigs), grapevine berry inner necrosis virus (3 contigs) , grapevine rupestris stem pitting-associated virus (4 contigs), grapevine red globe virus (2 contigs), grapevine yellow speckle 1 viroid (4 contigs) and hop stunt viroid (3 contigs). The five contigs of GAMaV were 352 nt~2, 224 nt in length, which were assembled from 3, 308 reads and shared 85.56%~91.81% nt identity with the genome of the GAMaV isolate GV30 (KX354202) with 93.3% coverage. To further confirm the infection of GAMaV, we designed two pairs of primers, GAMaV-mel1a/1b (5'-CACCTCGCCCCCTACCTTGAC-3'/5'-AAGAGGACGCCTTTGCGGGAG-3') and GAMaV-cp1a/1b (5'-CTAGCGACGACCGCACTGATC-3'/5'-GTCGGTGTACGAGATTTGGTC-3'), which were used to amplify the 329-bp and 440-bp fragments in the helicase (Hel) domain and coat protein (CP) gene of GAMaV genome in RT-PCR, respectively. The amplified PCR products were cloned and sequenced and the two sequences (OQ676951 and OQ676958) showed 91.2% and 93.4% nt identity with the isolate GV30, respectively. Furthermore, 429 grapevine samples of 71 cultivars were collected from 21 provinces and tested by RT-PCR using the above primer pairs. The results showed that 1.4% (6/429) of the samples tested positive, including one 'Autumn seedless' grapevine (Liaoning province), two 'Dawuhezi' (Liaoning), one 'Cabernet Gernischt' (Liaoning) and two 'Cabernet Sauvignon' (Tianjing and Shandong respectively). The partial sequences of the Hel domain (OQ676952-57) and CP gene (OQ676959-61) obtained from the positive samples by sequencing showed 89.1% to 84.5% and 93.6% to 93.9% nt identity with the isolate GV30, respectively. Because these GAMaV-positive grapevines did not show distinct symptoms, GAMaV pathogenicity remains challenging to confirm. This is the first report of GAMaV in grapevines in China, extending the information on its geographical distribution.
- Research Article
1
- 10.1094/pdis-09-23-1751-pdn
- Jan 1, 2024
- Plant Disease
- T Candresse + 4 more
Vitis cryptic virus (VCV), a deltapartitivirus identified in Japan in Vitis coignetiae (Nabeshima and Abe, 2021), is known from only two other countries. It was detected in China (Fan et al., 2022) and in Russia, including in a V. labrusca and the Saperavi Severnyi interspecific hybrid (Shvets et al., 2022). There is no information on VCV pathogenicity but deltapartitiviruses are generally not pathogenic. Fan et al. (2022) reported VCV graft transmission and chlorotic mottling symptoms developing on a graft-inoculated vine, in spite of the fact that cryptic viruses are not known to move cell-to-cell or be graft-transmissible. In fall 2022, a few plants of the Prior interspecific hybrid (https://www.vivc.de) showed unusual red blotch and leaf curl in Bordeaux (France), prompting the HTS analysis of two plants using total leaf RNA. Following host genome substraction, the ribodepleted RNASeq data was assembled de novo using CLC Genomics Workbench (Candresse et al., 2018) and contigs annotated by BlastX against the GenBank database. Rupestris stem pitting virus, grapevine pinot gris virus, hop stunt viroid and grapevine yellow speckle viroid 1 were identified. In addition, mycoviral contigs were identified, together with contigs for Rhopalosiphum padi virus and a divergent isolate of barley aphid RNA virus 10 (the later only in one plant), and the two genomic RNAs of VCV. The VCV RNA1 contigs were 1570 and 1574 nucleotides (nt) long, respectively, and 100% identical, showing 97.1% nt identity to a Japanese isolate (LC746759). They integrated 6480 and 4613 reads (0.2 and 0.4% of total substracted reads) for a coverage of 611 and 433x, respectively. The VCV RNA2 contigs were also 100% identical and shared 95.5% identity with a Japanese isolate (LC746761). They were 1518-1519 nt long, integrated 11338 and 9999 reads (0.4 and 0.9% of reads) for a coverage of 1109 and 972x, respectively. The Prior VCV RNAs were deposited in GenBank (OR474475-76). Specific RNA2 primers 5' TTACAGGTTTGATTGGAATCATG 3' and 5' ATAGTAGGTCCAATCACTAATC 3' (Tm 56°C) were used to confirm VCV presence in the original plants as well as in three other asymptomatic Prior vines. Amplicons 100% identical to the contigs were obtained from 4 of 5 plants. Two plants of Bronner, one of Prior parents, also tested positive. The rootstock (Fercal) of a VCV-infected Prior and two plants of another hybrid, Artaban, (sampled in the same plot as Prior) tested negative. BlastN datamining identified VCV reads in RNASeq data from a range of wild grapevines including V. acerifolia (SRX2885763), V. quinquangularis (SRX1496837), V. romanetii (SRR3938616), V. cinerea (SRR10135144), V. davidii (SRR3255926), V. amurensis (SRX13387918) and V. vinifera subsp. sylvestris (HAOE01029819, HAOE01001237). Although not experimentally verified, detection in wild Vitis, including V. amurensis, a Saperavi Severnyi, Bronner and Prior progenitor, suggests VCV might have been introduced in these hybrids through crosses aiming to develop powdery and downy mildew resistant varieties. To the best of our knowledge, this is the first report of VCV infection in grapevine in France. The symptoms that prompted this research have not recurred in 2023 and are not linked to VCV because the virus was also identified in symptomless Prior plants. The risk of introducing VCV in European grapevine through breeding efforts appears limited, but VCV may be present in fungal disease-resistant cultivars in a range of countries.
- Research Article
7
- 10.3390/v15122429
- Dec 14, 2023
- Viruses
- Daria Belkina + 4 more
In this study, an analysis of the virome of 51 grapevines from the Don ampelographic collection named after Ya. I. Potapenko (Russia) was performed using high-throughput sequencing of total RNA. A total of 20 previously described grapevine viruses and 4 viroids were identified. The most detected were grapevine rupestris stem pitting-associated virus (98%), hop stunt viroid (98%), grapevine Pinot gris virus (96%), grapevine yellow speckle viroid 1 (94%), and grapevine fleck virus (GFkV, 80%). Among the economically significant viruses, the most present were grapevine leafroll-associated virus 3 (37%), grapevine virus A (24%), and grapevine leafroll-associated virus 1 (16%). For the first time in Russia, a grapevine-associated tymo-like virus (78%) was detected. After a bioinformatics analysis, 123 complete or nearly complete viral genomes and 64 complete viroid genomes were assembled. An analysis of the phylogenetic relationships with reported global isolates was performed. We discovered and characterized the genomes of five novel grapevine viruses: bipartite dsRNA grapevine alphapartitivirus (genus Alphapartitivirus, family Partitiviridae), bipartite (+) ssRNA grapevine secovirus (genus Fabavirus, family Secoviridae) and three (+) ssRNA grapevine umbra-like viruses 2, -3, -4 (which phylogenetically occupy an intermediate position between representatives of the genus Umbravirus and umbravirus-like associated RNAs).
- Research Article
2
- 10.1111/ppa.13824
- Nov 13, 2023
- Plant Pathology
- Karima Ben Mansour + 5 more
Abstract Grapevine Pinot gris virus (GPGV) isolates were obtained from German vineyards to investigate their diversity. Phylogenetic and dating analyses of these and GPGV genes and genomes available in GenBank showed that the virus probably diverged from grapevine berry inner necrosis virus (GINV) in wild and cultivated Vitis species, notably Vitis coignetiae, growing in North‐east Asia around 3500 years ago. GPGV probably infected the Eurasian grape (Vitis vinifera subsp. vinifera) when those cultivars were first taken to China during the Han Dynasty (226 BCE–220 CE). GPGV then spread to Europe around 1800 CE, probably via the dissemination of infected plants, and from there, eventually spread worldwide. German isolates were only found in all parts of the post‐1800 CE phylogeny. The German isolates were genetically more diverse, for both MP and CP genes, than those of other European populations, suggesting that the initial stages of the GPGV invasion of Europe were in Germany, not Italy. We discuss the likely North‐east Asian origin of both GPGV and GINV, and the possible coincidences of phylogenetic date estimates with changes to European and world viticulture practices.
- Research Article
1
- 10.33462/jotaf.1124089
- Sep 26, 2023
- Tekirdağ Ziraat Fakültesi Dergisi
- Burak Güvenateş + 1 more
Grapevine (Vitis spp.) is one of the major fruit crop with high socioeconomic importance for Turkey. In vineyards, many harmful organism, especially virus infections, weaken the plant and lead to decreases in yield and quality, so it takes the lead in quarantine and certification. This study was carried out to determine some viral agents that cause yield loss in vines produced in Tokat, where viticulture is very important. Samples were collected from young leaves and one-year-old shoots of grapevines showing virus symptoms from some vineyard areas in Tokat Center and its districts. Collected 189 grapevine samples were subjected to the RT-PCR test, which is a molecular method using virus-specific primers, to detect the presence of Grapevine pinot gris virus (GPGV), Grapevine virus A (GVA), Strawberry latent ringspot virus (SLRSV). Out of a total of 189 plant samples, 80 (42.32%) of GVA, 3 (1.58%) of GPGV were detected and SLRSV (0%) was not detected. More than one virus was found in 2 (1.05%) of 189 tested samples. It was determined that the most common virus was GVA, the least detected virus was GPGV in plant samples collected from Tokat Center and its districts. Bidirectional sequence analysis of RT-PCR products of GVA-infected isolates were performed and phylogenetic analyzes were done by comparing them with reference isolates after they were aligned with the MEGAX computer program. Based on phylogenetic analysis studies, GVA showed differential branching with isolates registered in GenBank and isolates obtained in the study. GVA-infected isolates showed similarity with reference isolates at rates of 92-94%. In this study, molecular analysis of Turkish GVA isolates was performed. This molecular information is important as it will shed light on future studies.