Glycophorin B Research Articles

Characterization of GYP(B-A-B) hybrid glycophorins among Thai blood donors with Mia-positive phenotypes.

GYPA and GYPB genes encode the antigens of the MNS blood group system carried on glycophorin A (GPA) and glycophorin B (GPB), or on a hybrid molecule of GPA and GPB. GP hybrid variants are created through unequal crossing over and gene conversion, typically from the parent genes GYPA and GYPB. In the present study, we characterized the GYP(B-A-B) hybrid variants among Thai blood donors with Mia-positive phenotypes using PCR-based coupled to DNA sequencing techniques. Altogether, 1,020 samples from Thai blood donors were tested with anti-Mia by conventional tube technique (CTT). Polymerase chain reaction with sequence-specific primer (PCR-SSP) was initially used to differentiate normal GYPB, GYP*Vw and groups of GYP*Hut, GYP*Mur, GYP*Hop, GYP*Bun and GYP*HF alleles. Subsequently, GYP(B-A-B) hybrid variants were investigated using DNA sequencing. Among 1,020 blood donors, 127 (12.45%) were Mi(a+) phenotypes. The comparison Mia typing results between CTT and PCR-SSP were concordant. All Mi(a+) samples were positive with only group of GYP*Hut, GYP*Mur, GYP*Hop, GYP*Bun and GYP*HF alleles by PCR-SSP. Regarding the sequencing results, 115/1,020 (11.27%) donors carried the GYP*Mur, of which 111/1,020 (10.88%) were GYP*Mur/GYPB heterozygotes and the other 4/1,020 (0.39%) donors were GYP*Mur/GYP*Mur homozygotes. The remaining 12 donors included different GYP*Bun-like alleles; 11 of them (1.08%) were GYP*Thai/GYPB heterozygotes, and one (0.10%) was GYP*Thai II/GYPB heterozygotes. With 5.83% (119/2,040) of the total hybrid alleles, GYP*Mur was the predominant allele. The GYP*HF, GYP*Bun, GYP*Hop and GYP*Kip alleles were not observed in this study. Regarding the hybrid GP variants, a consensus of observed prevalent GYP*Mur and GYP*Bun-like alleles, respectively, was identified in the Thai population. The introduction of our strategy has allowed us to identify the zygosity for GYP hybrid variants, particularly GYP(B-A-B) hybrid genes, when antisera are unavailable and lacking adequate phenotypic features to determine GP variants.

Differential enzymatic deglycosylation reveals attachment of red cell B antigen onto the carbohydrate moiety of glycophorin A and glycophorin B.

Early studies indicate that red cell A and B antigens are attached primarily onto band 3 and GLUT1 on the erythrocyte membrane and little onto glycophorin A (GPA) and glycophorin B (GPB). But as GPA and band 3 form stable protein complexes and GPA is much more heavily glycosylated than band 3, this study re-examined the association between ABO antigens and GPA/GPB. Band 3/GPA-associated protein complexes were first immunoprecipitated, followed by differential enzymatic deglycosylation that removed sialic acids, N-glycans and O-glycans. Serological anti-A (BIRMA 1) and anti-B IgM (GAMA 110) could be used for western blot (WB); however, only the anti-B IgM showed significant reactivity for the immunoprecipitates isolated by anti-band 3. The expression of the B antigen in un-deglycosylated and differentially deglycosylated band 3 immunoprecipitates was thus compared. Besides attachment to band 3, red cell B antigen expressed substantially on GPA monomer and homodimer, GPA*GPB heterodimer, and GPB monomer and dimer via attachments through the N- and O-glycans. Immunoprecipitation (IP), as a means of protein separation and concentration, was used in combination with a WB to differentiate glycosylation on different proteins and oligomers. This study implemented differential enzymatic deglycosylation during IP of the band 3 complexes. This combined approach allowed separate identification of the B antigen on GPA/GPB monomer and dimer and GPA*GPB heterodimer, and band 3 on the WB and verified non-trivial expression of the B antigen on GPA and GPB on the erythrocyte surface.

Racial Disparity in Antibody Against High Prevalence Antigen; Anti-U

Abstract Introduction/Objective Anti-U is an IgG antibody directed against the U antigen, which usually forms after exposure to U antigen via blood transfusion and/or pregnancy. U antigen is located on glycophorin B (GYPB) as part of the MNS blood group system. Approximately 2% of the African American population lacks this antigen, making them prone to developing anti-U. Anti-U can cause hemolytic disease of fetus and newborn (HDFN) and hemolytic transfusion reactions (HTR). Methods/Case Report A 60-year-old African American male underwent aortic valve surgery. The patient was A Pos with a negative antibody screen. During surgery, the patient was transfused with 3 random units of packed red blood cells (PRBCs). The postoperative course was uncomplicated, and the patient was discharged home. 6 months later, the patient was admitted for another procedure and was expected to require blood products. Thus, a type and screen test was ordered, revealing pan reactivity on screening cells. This prompted further investigation. Antibody detection was performed with the solid-phase technique followed by the tube method with Polyethylene glycol (PEG) as an enhancement medium. PEG technique is the next choice of method if the solid phase requires extended antibody work up, which was the case in our patient. PEG tube method successfully identified Anti-U, and the patient's phenotype was confirmed to be U negative. Results (if a Case Study enter NA) N/A. Conclusion It is imperative to stress the importance of racial disparity while investigating antibodies against high prevalence. In our case, our suspicion was high for Anti-U, given that patient was of African American descent. Tube methods with PEG and Solid Phase techniques are usually used for antibody identification. It is recommended that patients with rare antibodies carry an Antibody ID card indicating the rare antibody they have to prevent further exposure.

A novel GYP(B-A-B) hybrid in a blood donor identified by a phenotyping discrepancy with different anti-s reagents.

MNS is a complex blood group system whose antigens are carried on glycophorin A (GPA), glycophorin B (GPB) and hybrid glycophorin molecules. These hybrid proteins are the results of gene recombination events at the GYPA/GYPB loci. One of the larger groups of hybrid proteins in this system are the GP(B-A-B) hybrid proteins, which often arise through gene recombination events in and around exon 3/intron 3 of GYPA, and pseudoexon 3 of GYPB.1 Different low-prevalence antigens are expressed on the hybrids depending on the point of crossover, and the presence of such a hybrid is often detected by aberrant expression of S and/or s antigens.2 We present the investigation of samples from a blood donor who had been genotyped on the HEA BeadChip array (Immucor, GA) as GYPB*03/03 but whose RBCs phenotyped S+ s+ . Extended phenotyping for S/s was performed by routine serological techniques with commercially available polyclonal and monoclonal reagent sera (See Figure 1A for manufacturers). Confirmatory allele-specific PCR (PCR-ASP) for the S/s polymorphism was performed as described previously on genomic DNA isolated from peripheral blood.3 GYPB exons 2–6 were specifically amplified using the primer pair GYP2-F and GYPB6-R (5′TATTGTACAGATGAGAAAACCAAGGCAC3′ and 5′GTGAGGCAGGAGAACAGGGAATTAG3′). The amplicon was purified and sequenced using the following internal GYPB-exon specific primers: exon 2: GPBX2S 5′CTATTTTATACAGAAATTGTGAG3′, GPBX2AS 5′CTAGAATTCCTCTGTAGTAAG3′; pseudoexon 3: GPBX3S 5′GGAGAATTTGTCTTTCATGATAC3′, GPB1963R 5′CAACATATGCTCTTCTGTTTTAAG3′; exon 4: GYPB42F 5′ATTTCTCATCCATGAATACG3′, GYPB43R 5′GCTTGGCCTCCCAAAATTATA3′; exon 5: GPB4/5 5′CTGTCTTATTTTTCTATTGCTATG3′, GPBIVS5 5′CTGTTTCTCTTTTGAGTTTAACTG3′ (Eurofins Genomics, Ebersberg, Germany). GYPB exon 1 was not sequenced since the peptide sequence encoded is cleaved from the mature protein. Note that exon numbering includes pseudoexon 3 for comparison with previously described hybrids.2 Phenotyping for Mit antigen was performed using anti-Mit from our rare sera collection. Extended phenotyping confirmed the RBCs as S+ (results not shown); however, s typing was inconclusive since 4/8 anti-s reagents were nonreactive (Figure 1A). Strikingly, clone P3BER reacted 4+ with the donor RBCs while clone P3YAN3 was nonreactive. The RBCs were only weakly positive with 3 polyclonal anti-s. The result of PCR-ASP genotyping was GYPB*03/*04, consistent with an S+ s+ phenotype, and which contradicted the results of the original HEA BeadChip analysis. DNA sequence analysis revealed a novel hybrid sequence (Genbank number OP263737) that was shown to be an 104-bp insertion of GYPA into GYPB exon 4 with the downstream breakpoint in intron 4 (NC_000004.12(NM_002100.4):c.155_175 +83delins[NM_002099.6:c.251_271 + 83]; Figure 1B), such that GPB amino acid sequence 52VHRFTVP58 is replaced by the GPA sequence AHHFSEP (NP_002091.4:p.52_58delins[NP_002090.4:p.84_90]; Figure 1C). The insertion of GYPA-specific nucleotides explains the failure of the HEA BeadChip assay to predict the s antigen encoded by this allele. Further, it is not unusual for hybrid proteins to carry low-prevalence antigens. Review of the inserted GPA sequence suggested that the RBCs might be Mit + since a change of p.Arg54His underlies this low-prevalence GPB antigen.2 The donor's RBCs typed Mit+ with a single example of the antibody. We report a novel and unusual GYP(B-A-B) allele (provisionally named GYP*507) in which gene recombination has occurred within GYPB exon 4. While Thr48 defining the s antigen is still present, Arg54, which is thought to be important for s expression, is substituted by His54 and thus the epitope recognized by anti-s, clone P3YAN3 can be mapped to this region of GPB. The hybrid protein carries the Mit antigen. In contrast, the monoclonal anti-s P3BER has been shown previously to require Thr44 for reactivity, since this is absent from GP.Mur and GP.Bun hybrid proteins,4 and shows that these two monoclonal anti-s recognize different epitopes on GPB. The serological results showed that the expression of s antigen in this new hybrid is both qualitatively and quantitatively perturbed.2 We thank Judith Aeschlimann for providing the GYP2-F and GYPB6-R primer sequences. This work has been supported by the ALF program from the Swedish government and regional county councils (grant no. ALFSKANE-446521 to M.L.O.) to university healthcare in Region Skåne and at Lund University. The authors have disclosed no conflicts of interest.

A Balance between Transmembrane-Mediated ER/Golgi Retention and Forward Trafficking Signals in Glycophorin-Anion Exchanger-1 Interaction.

Anion exchanger-1 (AE1) is the main erythroid Cl-/HCO3- transporter that supports CO2 transport. Glycophorin A (GPA), a component of the AE1 complexes, facilitates AE1 expression and anion transport, but Glycophorin B (GPB) does not. Here, we dissected the structural components of GPA/GPB involved in glycophorin-AE1 trafficking by comparing them with three GPB variants-GPBhead (lacking the transmembrane domain [TMD]), GPBtail (mainly the TMD), and GP.Mur (glycophorin B-A-B hybrid). GPB-derived GP.Mur bears an O-glycopeptide that encompasses the R18 epitope, which is present in GPA but not GPB. By flow cytometry, AE1 expression in the control erythrocytes increased with the GPA-R18 expression; GYP.Mur+/+ erythrocytes bearing both GP.Mur and GPA expressed more R18 epitopes and more AE1 proteins. In contrast, heterologously expressed GPBtail and GPB were predominantly localized in the Golgi apparatus of HEK-293 cells, whereas GBhead was diffuse throughout the cytosol, suggesting that glycophorin transmembrane encoded an ER/Golgi retention signal. AE1 coexpression could reduce the ER/Golgi retention of GPB, but not of GPBtail or GPBhead. Thus, there are forward-trafficking and transmembrane-driven ER/Golgi retention signals encoded in the glycophorin sequences. How the balance between these opposite trafficking signals could affect glycophorin sorting into AE1 complexes and influence erythroid anion transport remains to be explored.

Glycophorins and the MNS blood group system: a narrative review

: The MNS blood group system, International Society of Blood Transfusion (ISBT) 002, is second after the ABO system. GYPA and GYPB genes encode MNS blood group antigens carried on glycophorin A (GPA), glycophorin B (GPB), or on variant glycophorins. A third gene, GYPE, produce glycophorin E (GPE) but is not expressed. MNS antigens arise from several genetic mechanisms. Single nucleotide variants (SNVs) contribute to the diversity of the MNS system. A new antigen SUMI (MNS50), p.Thr31Pro on GPA has been described in the Japanese population. Unequal crossing-over and gene conversion are the mechanisms forming hybrid glycophorins, usually from parent genes GYPA and GYPB. GYPE also contributes to gene recombination previously only described with GYPA. Recently, however, GYPE was shown to recombine with GYPB to form a GYP(B-E-B) hybrid. A GYP(B-E-B) hybrid allele encodes a mature GP(E-B) molecule expressing a trypsin-resistant M antigen but no S/s. Another novel glycophorin GP.MOT has been described carrying Mia, Mur, MUT, and KIPP antigens. GP.MOT is encoded by a GYP(B-A) hybrid allele. Newly reported cases of haemolytic transfusion reaction (HTR) or haemolytic disease of the fetus and newborn (HDFN) due to antibodies to MNS antigens is a constant reminder of the clinical significance of the MNS system. In one HDFN case, anti-U and anti-D were detected in an Indian D–, S–s–U– mother. The S–s–U– phenotype is rare in Asians and Caucasians but it is more commonly found in the African populations. Several types of novel GYPB deletion alleles that drive the S–s–U– phenotype have been recently described. Two large GYPB deletion alleles, over 100 kb, were identified as the predominant alleles in the African population. The use of advanced DNA sequencing techniques and bioinformatic analysis has helped uncover these large gene-deletion variants. Molecular typing platforms used for MNS genotyping are also discussed in this review. In conclusion, this review considers currently recognised MNS antigens and variants, new hybrid alleles and GYPB gene deletion alleles as well as clinical case studies. These new discoveries contribute to our understanding of the complexity of the MNS system to guide decision-making in genetic analysis and transfusion medicine.

Frequencies of glycophorin variants and alloantibodies against Hil and MINY antigens in Japanese.

Antigens of the MNS blood group system are expressed on the red blood cell (RBC) membrane on glycophorin A (GPA) and glycophorin B (GPB) or on hybrid molecules of GPA and GPB. This study investigated the distribution of glycophorin variants and alloantibodies against Hil and MINY among Japanese individuals. Mi(a+) or Hil+ RBCs were screened using an automated blood grouping machine (PK7300) with monoclonal anti-Mia or polyclonal anti-Hil. Glycophorin variants were defined by serology with monoclonal antibodies against Mia , Vw, MUT and Mur, and polyclonal antibodies against Hil, MINY and Hop + Nob (KIPP). The glycophorin variants were further confirmed by immunoblotting and Sanger sequencing. Alloanti-Hil and alloanti-MINY in the plasma were screened using GP.Hil RBCs in an antiglobulin test. The specificity of anti-Hil or anti-MINY was assessed using GP.Hil (Hil+MINY+) and GP.JL (Hil-MINY+) RBCs. The GP.HF, GP.Mur, GP.Hut, GP.Vw, GP.Kip and GP.Bun frequencies in 1005594 individuals were 0·0357%, 0·0256%, 0·0181%, 0·0017%, 0·0009% and 0·0007%, respectively. GP.Hil was found in as four of the 13546 individuals (0·0295%). Of 137370 donors, 10 had anti-Hil (0·0073%) and three had anti-MINY (0·0022%). Glycophorin variants were relatively rare in Japanese individuals, with the major variants being GP.HF (0·0357%), GP.Hil (0·0295%) and GP.Mur (0·0256%). Only one example of anti-MINY was previously reported, but we found three more in this study.

Molecular genetic analysis of Mia -positive hybrid glycophorins revealed two novel alleles of GP.Vw and multiple variant transcripts of GYPB existing in both the homozygous GP.Mur and wild-type GPB individuals.

The hybrid glycophorins of MNS blood group system express a series of low incidence antigens including Mia , which are commonly found in Southeast Asian populations. In this study, the molecular basis of Mia -positive hybrid glycophorins was firstly clarified in the Chinese Southern Han population. RNA transcripts of GYPB gene in the homozygous GP.Mur individuals were also analyzed. DNAs were extracted from the whole blood samples of 111 Mia -positive donors. Then, high-resolution melting (HRM) analysis for GYP(B-A-B) was used to analyze the genotypes. Sequencing of GYPB pseudoexon 3 was conducted in the samples with variant melting curves. TA-cloning and subsequent sequencing of GYPA exons 2-4 were performed in the Mia -positive samples with normal GYPB/GYPB genotype by HRM. The transcript analysis of GYPB was conducted in homozygous GP.Mur and wild-type glycophorin B (GPB) individuals using RNA extracted from the cultured erythroblast. The heterozygous GYP*Mur/GYPB (n= 101), homozygous GYP*Mur/GYP*Mur (n= 7) including one novel GYP*Mur allele with an extra GYPA/GYPE specific nucleotide substitution (c.229+110A>T), heterozygous GYP*Bun/GYPB (n= 1) and GYP*Vw/GYPA (n= 2) with two novel GYP*Vw alleles were identified. RNA transcript analysis revealed multiple transcripts of GYPB existing in both homozygous GP.Mur and normal GPB individuals. The results showed the genetic diversity of hybrid glycophorins in the Chinese population. Besides, the successful analysis of GYPB transcripts indicates that the cultured erythroblast is a good source for RNA transcript analysis for the protein only expressed on the red blood cells.

Stronger Association between Hemoglobin and Blood Pressure in People Bearing GP.Mur Blood Type

GP.Mur, commonly known as Miltenberger subtype III, is a clinically-important red blood cell (RBC) phenotype unique among Southeast Asians (SEA). On the GP.Mur+ erythrocyte membrane, glycophorin B-A-B hybrid protein is expressed, instead of glycophorin B (GPB). Different from GPB that does not have any known function, GP.Mur hybrid protein promotes expression of anion exchanger-1 (AE1) on the RBC membrane and support AE1-relevant physiological functions in GP.Mur+ carriers. In our previous human studies, we unexpectedly uncovered that GP.Mur+ carriers have slightly higher blood pressure (BP) than GP.Mur-negative people. Since AE1 has been implicated a role in modulation of NO bioavailability and hemoglobin (Hb) is a major NO scavenger, we hypothesized that the slightly but significantly higher BP in GP.Mur carriers might be related to Hb-mediated NO processing. Methods With the approval of hospital Institutional Review Board, healthy, non-smoker subjects aged between 20 and 55 were recruited at Taitung MacKay Memorial Hospital (TT-MMH). Besides general physical assessment, recruited subjects were tested for CBC and RBC phenotypes, including GP.Mur. Results 345 male and 515 female non-smoker adults were recruited from Taitung County, Taiwan, and 22.1% of them bear GP.Mur blood type. For male and female cohorts, GP.Mur erythrocyte expression was significantly associated with slightly higher systolic BP (SBP) (122.2±12.9 mmHg [non-GP.Mur male] versus 127.8±14.4 mmHg [GP.Mur male]; 115.0±13.0 mmHg [non-GP.Mur female] versus 118.0±13.4 mmHg [GP.Mur female]). Hb levels were not affected by GP.Mur. Hb is known to be positively associated with SBP. We indeed found a Pearson correlation of 0.164 between Hb (g/dL) and SBP (mmHg) in non-GP.Mur male subjects (*p~0.007). However, Hb-SBP associations were not observed in our female cohorts with or without GP.Mur. Intriguingly, the Pearson correlation between Hb and SBP from the GP.Mur male group was doubled, compared to that from the GP.Mur-negative male group (Pearson correlation: 0.299 [GP.Mur male] versus 0.164 [non-GP.Mur male]). Conclusion From the differences in Hb-SBP correlations in male, the effects of NO-scavenging by Hb were likely more substantial in the presence of GP.Mur and/or higher AE1 expression. We did not observe any positive associations in our SEA female subjects, presumably due to menstrual cycle and that SEA women were generally more anemic.

Multiple GYPB gene deletions associated with the U- phenotype in those of African ancestry.

The MNS blood group system is defined by three homologous genes: GYPA, GYPB, and GYPE. GYPB encodes for glycophorin B (GPB) carrying S/s and the "universal" antigen U. RBCs of approximately 1% of individuals of African ancestry are U- due to absence of GPB. The U- phenotype has long been attributed to a deletion encompassing GYPB exons 2 to 5 and GYPE exon 1 (GYPB*01N). Samples from two U-individuals underwent Illumina short read whole genome sequencing (WGS) and Nanopore long read WGS. In addition, two existing WGS datasets, MedSeq (n = 110) and 1000 Genomes (1000G, n = 2535), were analyzed for GYPB deletions. Deletions were confirmed by Sanger sequencing. Twenty known U- donor samples were tested by a PCR assay to determine the specific deletion alleles present in African Americans. Two large GYPB deletions in U- samples of African ancestry were identified: a 110 kb deletion extending left of GYPB (DEL_B_LEFT) and a 103 kb deletion extending right (DEL_B_RIGHT). DEL_B_LEFT and DEL_B_RIGHT were the most common GYPB deletions in the 1000 Genomes Project 669 African genomes (allele frequencies 0.04 and 0.02). Seven additional deletions involving GYPB were seen in African, Admixed American, and South Asian samples. No samples analyzed had GYPB*01N. The U- phenotype in those of African ancestry is primarily associated with two different complete deletions of GYPB (with intact GYPE). Seven additional less common GYPB deletion backgrounds were found. GYPB*01N, long assumed to be the allele commonly encoding U- phenotypes, appears to be rare.

Molecular Detection of Glycophorins A and B Variant Phenotypes and their Clinical Relevance.

Crossover or conversion between the homologous regions of glycophorin A (GYPA) and glycophorin B (GYPB) gives rise to several different hybrid glycophorin genes encoding a number of different glycophorin variant phenotypes which bear low prevalence antigens in the MNS blood group system. GP.Mur is the main glycophorin variant phenotype which causes hemolytic transfusion reaction (HTR) and hemolytic disease of the fetus and newborn (HDFN) in East and Southeast Asians. The detection of glycophorin variant phenotypes using serological methods is limited to phenotyping reagents that are not commercially available. Moreover, the red blood cells used for antibody identification are usually of the GP.Mur phenotype. The current Polymerase Chain Reaction (PCR)-based methods and loop-mediated isothermal amplification (LAMP) are available alternatives to phenotyping that allow for the specific detection of glycophorin variant phenotypes. This review highlights the molecular detection method for glycophorins A and B variant phenotypes and their clinical relevance.

Clinical approach after identification of a rare anti-Ena in a prenatal sample

The antigens associated with the MNS blood group system (ISBT 002) are located on glycophorin A (GPA) and glycophorin B (GPB). The most frequently encountered antibodies to antigens in this system by a transfusion medicine service are those directed against M, N, S, and s. Individuals lacking GPA typically have red blood cells that lack M, N, and Ena, whereas those lacking both GPA and GPB lack M, N, and Ena as well as S, s, and U. Such individuals may develop a rare antibody, anti-Ena, directed against determinants on GPA. This antibody is capable of causing hemolytic transfusion reactions and hemolytic disease of the fetus and newborn. This case report describes a pregnant woman found to have anti-Ena. Molecular testing supported an Mk phenotype that was found in several members of her immediate family.

Genetic Evidence for Erythrocyte Receptor Glycophorin B Expression Levels Defining a Dominant Plasmodium falciparum Invasion Pathway into Human Erythrocytes.

ABSTRACTPlasmodium falciparum, the parasite that causes the deadliest form of malaria, has evolved multiple proteins known as invasion ligands that bind to specific erythrocyte receptors to facilitate invasion of human erythrocytes. The EBA-175/glycophorin A (GPA) and Rh5/basigin ligand-receptor interactions, referred to as invasion pathways, have been the subject of intense study. In this study, we focused on the less-characterized sialic acid-containing receptors glycophorin B (GPB) and glycophorin C (GPC). Through bioinformatic analysis, we identified extensive variation in glycophorin B (GYPB) transcript levels in individuals from Benin, suggesting selection from malaria pressure. To elucidate the importance of the GPB and GPC receptors relative to the well-described EBA-175/GPA invasion pathway, we used an ex vivo erythrocyte culture system to decrease expression of GPA, GPB, or GPC via lentiviral short hairpin RNA transduction of erythroid progenitor cells, with global surface proteomic profiling. We assessed the efficiency of parasite invasion into knockdown cells using a panel of wild-type P. falciparum laboratory strains and invasion ligand knockout lines, as well as P. falciparum Senegalese clinical isolates and a short-term-culture-adapted strain. For this, we optimized an invasion assay suitable for use with small numbers of erythrocytes. We found that all laboratory strains and the majority of field strains tested were dependent on GPB expression level for invasion. The collective data suggest that the GPA and GPB receptors are of greater importance than the GPC receptor, supporting a hierarchy of erythrocyte receptor usage in P. falciparum.

The MNS glycophorin variant GP.Mur affects differential erythroid expression of Rh/RhAG transcripts.

The band 3 macrocomplex (also known as the ankyrin-associated complex) on the red cell membrane comprises two interacting subcomplexes: a band 3/glycophorin A subcomplex, and a Rh/RhAG subcomplex. Glycophorin B (GPB) is a component of the Rh/RhAG subcomplex that is also structurally associated with glycophorin A (GPA). Expression of glycophorin B-A-B hybrid GP.Mur enhances band 3 expression and is associated with lower levels of Rh-associated glycoprotein (RhAG) and Rh polypeptides. The goal of this study was to determine whether GP.Mur influenced erythroid Rh/RhAG expression at the transcript level. GP.Mur was serologically determined in healthy participants from Taitung County, Taiwan. RNA was extracted from the reticulocyte-enriched fraction of peripheral blood, followed by reverse transcription and quantitative PCR for RhAG, RhD and RhCcEe. Quantification by real-time PCR revealed significantly fewer RhAG and RhCcEe transcripts in the reticulocytes from subjects with homozygous GYP*Mur. Independent from GYP.Mur, both RhAG and RhD transcript levels were threefold or higher than that of RhCcEe. Also, in GYP.Mur and the control samples alike, direct quantitative associations were observed between the transcript levels of RhAG and RhD, but not between that of RhAG and RhCcEe. Erythroid RhD and RhCcEe were differentially expressed at the transcript levels, which could be related to their different degrees of interaction or sensitivity to RhAG. Further, the reduction or absence of glycophorin B in GYP.Mur erythroid cells affected transcript expressions of RhAG and RhCcEe. Thus, GPB and GP.Mur differentially influenced Rh/RhAG expressions prior to protein translation.

Dissecting alternative splicing in the formation of Miltenberger glycophorin subtype III (GYP.Mur).

Miltenberger subtype III (Mi.III, GP.Mur) is one of the most important red cell phenotypes in the fields of transfusion in South-East Asia. GP.Mur is believed to evolve from homologous gene recombination events between glycophorin A (GYPA) and glycophorin B (GYPB). GYP.Mur differs from GYPB in only seven nucleotides dispersed near the region of 3' exon 3 of GYP.Mur. The goal of this study was to dissect how these nucleotide variants affected splicing of exon 3. We first designed two minigene constructs: one containing GYP.Mur from exon 2 to exon 4 and the other containing GYPB in the same region. To test how these nucleotide variations between GYP.Mur and GYPB affected the splicing, a repertoire of the GYP.Mur-like minigene constructs with different point mutations were created. These minigene variants were evaluated for their abilities to induce splicing of exon 3 using a heterologous expression system. (1) GYP.Mur minigene expressed exons 2, 3 and 4, whereas GYPB minigene expressed only exon 2 and exon 4. (2) The single nucleotide alteration at the position of the 5' splice site of glycophorin intron 3 reversed the splicing decision. (3) The nucleotide variations between GYP.Mur and GYPB other than that at the 5' splice site showed very little or no effect on splicing of exon 3. Splicing of the glycophorin B-A-B hybrids (GYP.Mur and GYP.BUN) and unsplicing of GYPB follow the GU-AG rule strictly.

Hemolytic disease of the fetus and newborn owing to anti-U, successfully treated with repeated intrauterine transfusions

Abstract Hemolytic disease of the fetus and newborn (HDFN) owing to anti-U has rarely been reported. U is part of the MNS system. M and N glycoproteins are located on glycophorin A (GPA); S and s antigens are on glycophorin B (GPB). Individuals who lack GPB are S– and s– and also lack U. The U– phenotype occurs almost exclusively in the African population and has a very low frequency (0.25%). Anti-U is of immunoglobulin G class and can cause hemolytic transfusion reaction and HDFN. In this report we present the use of a noninvasive method to detect anemia in the fetus and the subsequent use of intrauterine transfusion (IUT) with blood of a very rare phenotype. For the first time, we used deglycerolized and 3-week-old red blood cell units for IUT without signs of adverse reactions and with the expected effect on the hemoglobin value. We conclude that this transfusion strategy could be applied safely. Immunohematology 2013;29:51– 54.

Anti-U alloimmunisation in a pregnant woman from Niger.

“U” was the name that Wiener et al.1 gave in 1953 to recall the almost universal distribution of a new antigen that they described. The antigen was identified through the serum of an Afro-American patient who had a fatal transfusion reaction: the serum reacted with the red blood cells of 977 of 989 Afro-American patients and all 1,000 Caucasian-American patients tested. The U antigen belongs to the MNS blood group system, the only, together with the Rh system, to be synthesised starting from two very closely linked loci, GYPA and GYPB, which, together with a third locus, GYPE, form a gene cluster on chromosome 4 (4q28→q31)2–3. The U antigen, together with the S and s antigens, is expressed on glycophorin B (GPB), a red blood cell membrane glycoprotein, coded for by the GYPB locus4–6. The amino acid residues from 33 to 39 are essential for the expression of the U antigen. Its antigenicity is not, however, entirely due to this molecular sequence7. The U antigen is a public antigen, occurring almost universally in Caucasian populations8. In populations belonging to ethnic groups originating from Sub-Saharan Africa, there is a S-s−U− phenotype, found with a frequency that varies from 1% among Afro-Americans up to 35% among the Pygmies of Congo9; the spread of this phenotype among these populations is related to the fact that it hampers the entrance of malaria plasmodia into red blood cells. This phenotype is caused by the lack of glycophorin B. U− subjects are always also S- and s−. In contrast, the lack of S and s antigens is not always associated with an absence of the U antigen from the red blood cell membrane. According to some research, about 51% of S-s− subjects are U+10. In these cases, however, the U antigen is variously altered by rearrangements of the amino acid sequence in the residues from 33 to 39: this is indicated by the notation U+var which stands for a variant of the U antigen. The notation U+var does, therefore, represent a heterogeneous group of molecules from the points of view of both amino acid sequence and antigens, but a group united by the fact of having some epitopes specific to the U molecule from which each variant is derived11. Subjects with the S-s−U+var phenotype produce anti-U antibodies that react with all U+ and with a variable proportion of other U+var, depending on the epitopes expressed on the variant molecule. S-s−U− subjects, on the other hand, produce antibodies that react with all U+ and U+var red blood cells and should, more correctly, be called anti-U/GPB12. While the S-s−U− phenotype is a consequence of a deletion of GYPB, the molecular basis of the S-s−U+var phenotype is a GYPB-like, hybrid gene. Anti-U is the cause of haemolytic disease of the foetus and newborn, as well as of haemolytic transfusion reactions13. This is a rare immunohaematological problem: 24 cases of anti-U immunisation have been reported in the literature, all of which occurred in pregnant women from ethnic groups originating from Sub-Saharan Africa14–27. The severity of the haemolytic disease varies from asymptomatic to fatal, with intrauterine death. Anti-U immunisation causes important diagnostic and transfusional problems, related both to its rarity and to the specific immunohaematological problem of non-Caucasian ethnic groups, a new problem for Italy. Here we report a case of immunisation against the U antigen, which came to our attention at the Service of Immunohaematology and Transfusion Medicine, Careggi (Italy) in 2009.

Distribution of MN blood group types in local populations in Philippines

The classification of MN system of human blood type is based on the presence of either glycophorin A (GPA) or glycophorin B (GPB) in the erythrocyte membrane, leading to the expression of the M or N antigen for GPA and only the N antigen for GPB (Kudo and Fukuda 1994). The MN system has been known to indicate specific kinds of immune responsiveness as well as serve as viable genetic markers for particular health conditions and diseases (Delanghe et al. 1995). The mode of inheritance of the agglutinogens M and N is through a single set of allelomorphic alleles wherein the M and N alleles are codominant to each other. This allows the heterozygote MN to have a distinguishable phenotype from the homozygous MM and NN (Mourant et al. 1976). The codominant nature of the M and N alleles makes it convenient to test whether a population exhibits Hardy– Weinberg equilibrium (HWE) at the MN blood group locus. MN blood groups have shown to exhibit differences in allele frequency in different populations, but are typically in HWE (Furuhata et al. 1954; Morton and Chung 1959; Lee 1965; Breguet et al. 1986). Thus, genetic drift is a likely reason for the differences in the frequencies of the M and N alleles between human populations. Despite the significance of the MN blood groups in the fields of genetics and health, only two prior published data sets on the MN blood group in Philippines are available; one study was restricted to Manila (Fraser et al. 1964), while the other compared the frequency distribution ofM and N alleles between a population based in Manila and another in a rural town of Northern Luzon (Guzman et al. 2009). Through surveying of the MN blood types, the present study aimed to (i) produce the first comprehensive pool of data on the distribution of the MN blood groups in Philippines; (ii) determine the frequencies of theM and N alleles in various populations from the major Philippine island groups of Luzon, Visayas, Mindanao and Palawan; and (iii) test whether or not these populations are at HWE.

Anti‐U‐like as an alloantibody in S−s−U− and S−s−U+var black people

S, s, and U antigens belong to the MNS system. They are carried by glycophorin B (GPB), encoded by GYPB. Black people with the low-prevalence S-s- phenotype, either U- or U+(var), can make a clinically significant anti-U. Anti-U-like, a cold immunoglobulin G autoantibody quite commonly observed in S-s+U+ black persons, was previously described to be nonreactive with ficin-, α-chymotrypsin-, and pronase-treated red blood cells (RBCs); nonreactive or weakly reactive with papain-treated RBCs; and reactive with trypsin-treated RBCs. Here we describe, in S-s- people from different molecular backgrounds, an alloantibody to a high-prevalence GPB antigen, which presents the same pattern of reactivity with proteases as autoanti-U-like. Four S-s- patients with an alloantibody to a high-prevalence GPB antigen were investigated by serologic and molecular methods. An alloantibody was observed in two S-s-U-/Del GYPB, one S-s-U+(var)/GYPB(P2), and one S-s-U+(var)/GYPB(NY) patients. As this alloantibody showed the same pattern of reactivity with proteases as autoanti-U-like, we decided to name it "anti-U-like." Anti-U-like made by the two S-s-U- patients was reactive with the S-s-U+(var) RBCs of the two other patients. S-s-U-/Del GYPB, S-s-U+(var)/GYPB(P2), and S-s-U+(var)/GYPB(NY) patients can make an alloanti-U-like. Anti-U-like made by S-s-U- people appears reactive with GYPB(P2) and GYPB(NY) RBCs, which both express a weak and partial U-like reactivity. We recommend transfusing S-s-U- RBCs in S-s-U- patients showing alloanti-U-like. Our study contributes to a better understanding of alloimmunization to GPB in black people and confirms importance of genotyping in S-s- patients, especially those with sickle cell disease to be frequently transfused.

Expression of the Rh/RhAG complex is reduced in Mi.III erythrocytes

Miltenberger blood group antigen subtype III (Mi.III) is characterized by expression of a glycophorin B-A-B hybrid (Gp.Mur) on the erythrocyte surface. The two alleles of glycophorin B are substituted with the B-A-B hybrid alleles in homozygous Mi.III (Mi.III(+/+)), and thus, Mi.III(+/+) erythrocytes lack glycophorin B (GPB) and express Gp.Mur only. Because GPB is a major component of the Rh complex on RBCs, in this study, we explored how the absence of GPB might affect Rh expression in Mi.III RBCs. (1) Mi.III+ RBCs were serologically identified and further differentiated their homozygosity or heterozygosity by immunoblot or direct sequencing. (2) RhD and RhCcEe mRNA was cloned, and their sequences analysed. (3) The expression levels of Rh antigen, Rh-associated glycoprotein (RhAG) and the U antigen in MI.III vs. non-Mi.III RBCs were assessed by flow cytometry and Western blot. Compared with the non-Mi.III samples, the surface expression of the Rh antigen was reduced to 76·4% in Mi.III(+/+) RBCs and 93·6% in Mi.III(+/-). RhAG expression was also significantly reduced in Mi.III(+/+), but not in Mi.III(+/-). The U antigen expression in Mi.III(+/-) was only 14·9% relative to the control RBCs, while GPB was half the level of the controls. The mRNA sequences of Rh polypeptides from Mi.III+ samples were identical to the NCBI reference sequences. Substitution of GPB with Gp.Mur significantly reduced the expression of Rh antigen and RhAG on the Mi.III(+/+) erythrocyte membrane. The Mi.III phenotype is predicted to induce considerable structural variations within the band 3/Rh-associated macrocomplexes.