This study evaluated the potential of a beta-defensin-3 mimetic peptide (BDMP), a synthetic cell-penetrating peptide with antimicrobial and immunomodulatory properties, as an adjunctive therapeutic approach for periodontitis. BDMP was formulated in a hydroxyethyl cellulose (HEC) gel and assessed for binding affinity, release kinetics, and ability to penetrate cells and gingival tissues. Anti-inflammatory and osteoclast-related signaling pathways were examined invitro using RAW264.7 macrophages stimulated with lipopolysaccharide (LPS). Effects on osteogenic recovery were evaluated in periodontal ligament stem cells (PDLSCs) under inflammatory conditions. Antimicrobial activity against multispecies biofilms was analyzed by confocal microscopy. In a ligature-induced experimental periodontitis model in beagle dogs, BDMP gel was compared with a subgingival instrumentation (SI)-only (standard-of-care) control, and minocycline gel was included as an active adjunctive comparator. Clinical parameters, inflammatory markers, microbial load, radiographs, micro-CT images, and histology were evaluated. In vitro, BDMP reduced histone deacetylase 5 (HDAC5) phosphorylation and attenuated downstream NF-κB-associated inflammatory signaling without altering upstream kinase activity. BDMP decreased osteoclast differentiation, reduced inflammatory cytokine transcription, and partially restored osteogenic capacity in LPS-stimulated PDLSCs. BDMP also demonstrated broad-spectrum antimicrobial activity and disrupted mature multispecies biofilms. Invivo, BDMP resulted in greater reductions in gingival inflammation, bleeding, IL-1β levels, and oral spirochetes over 12 weeks compared with the SI-only control. Radiographic images provided qualitative support for reduced bone loss, which was corroborated by micro-CT and histology, indicating attenuation of alveolar bone resorption. When compared with the combination of SI and minocycline arm, BDMP showed comparable or greater improvements in several inflammatory and microbiological parameters. BDMP exhibited sustained antimicrobial and anti-inflammatory activity and attenuated bone loss in a beagle periodontitis model when used alongside standard SI therapy. These findings support BDMP as a promising adjunctive therapeutic candidate for managing periodontal inflammation and biofilm-associated disease, although further studies are needed to confirm long-term safety and to define its mechanistic contributions to periodontal tissue preservation.

Targeting mitochondrial fission to ameliorate apoptosis of gingival fibroblasts: novel perspectives on inflammatory gingival recession prevention.

Oral lichen planus (OLP) patients with erythematous or erosive gingival lesions frequently fail topical therapy. The aim of this study was to determine the efficacy of minocycline and doxycycline for inflammatory and refractory gingival OLP. In this retrospective analysis, the data of 254 patients with biopsy-confirmed OLP who displayed inflammatory gingival lesions and failed treatment with topical agents were analyzed. Patients treated between 2015 and 2023 with a 2-month course of either doxycycline 100 mg twice daily or minocycline 100 mg twice daily, concomitantly with topical agents, were included. After 2 months of treatment with doxycycline or minocycline, 60.6% patients improved with a marked reduction in erythema (95% CI 54.6%-66.6%). More specifically, in patients with mild gingival inflammation at baseline, 80.3% improved (95% CI 71.3%-89.2%) compared to 29.4% of patients with desquamative gingivitis at baseline (95% CI 16.9%-41.9%). Acute flare-ups after discontinuing therapy, which developed in approximately 25% of patients, responded to additional courses of antibiotics for 1to 2 months. Mild adverse effects were noted in 10 patients, which all resolved rapidly when the drug was discontinued. This study demonstrates that both doxycycline and minocycline are highly effective agents for inflammatory gingival OLP lesions that are difficult to palliate. As these patients often fail to respond to topical agents and require more aggressive systemic drugs that are immunosuppressive with significant adverse effects, second-generation tetracyclines should be considered first-line systemic agents for inflammatory gingival OLP lesions.

Injectable Schiff base-engineered hydrogel for spatiotemporal liraglutide delivery orchestrates diabetic periodontitis regression via multimodal microenvironment reprogramming.

Matrix Metalloproteinase 8 (MMP-8) and Interleukin 6 (IL-6) are two important genes that mediate inflammation and play a role in inflammatory cases. This study aims to design two specific primer candidates for testing gene expression using the qRT-PCR method in Rattus norvegicus experiencing inflammation and gingivitis. Primer design was performed using Geneious Prime software and BLAST primers to determine primer quality through PCR product size, primer length, melting temperature (Tm), and %GC, as well as to ensure that the resulting primers only bind to the Rattus norvegicus genome target. The results showed that the size of the MMP-8 forward product CGGGGTATTGGAGGAGATGC; reverse CAGGGTTGTCTGAAGGTCCATA was 241 bp with a primer length of 20-22 nucleotides, %GC between 50-60%, and Tm not more than 60°C, and the size of the IL-6 product forward AGAGACTTCCAGCCAGTTGC; reverse TGCCATTGCACAACTCTTTTC is 199 bp with a primer length of 20-21 nucleotides, %GC between 42.86-55% and Tm not more than 60°C. BLAST primer results indicate that both primer pairs are specific and suitable as candidate primers for qRT-PCR testing in studies of inflammation-related gene expression and gingival inflammation.

Netherton syndrome (NS) is a rare genodermatosis with autosomal recessive inheritance caused by mutations in the serine peptidase inhibitor Kazal type 5 (SPINK5) gene, characterized by the triad of ichthyosiform erythroderma, hair shaft abnormality, and atopic diathesis. A 5-year-old Saudi boy diagnosed with NS is reported. He presented with many food allergies, mild lymphopenia, trichorrhexis invaginata, eczema-like lesions, elevated immunoglobulin E (IgE), and exfoliative erythroderma at birth. Several carious teeth and widespread non-plaque-induced gingival inflammation were among the intraoral findings. Following preoperative multidisciplinary clearance, full dental rehabilitation under general anesthesia was carried out. Prophylactics, composite restorations, stainless steel crowns, and extractions of non-restorable teeth were included as part of the treatment. The patient's recovery from the procedure went smoothly, and both oral comfort and function improved. In conclusion, this case highlights the critical role of multidisciplinary collaboration in the safe delivery of dental rehabilitation under general anesthesia for patients with NS.

Generalized periodontitis (GP) is recognized as a significant risk factor for the development of coronary artery disease (CAD). Chronic infectious foci within the periodontal tissues contribute to systemic inflammation, accelerate atherogenesis, and promote the progression of atherosclerotic vascular lesions. Conversely, circulatory disorders characteristic of CAD impair tissue perfusion and oxygenation in the periodontium, leading to hypoxia and reduced regenerative capacity. Given the bidirectional aggravating relationship between GP and CAD, it is essential to investigate the clinical features of GP in the context of cardiac pathology and to account for local risk factors associated with periodontal disease. Such an approach is crucial for developing effective strategies to improve periodontal health in patients with CAD. Aim. To perform a comprehensive index-based assessment of periodontal tissue condition and individual oral hygiene in patients with CAD, followed by analysis of their clinical significance. Materials and Methods. Dental examinations were conducted in 114 patients with GP and CAD (main group). The comparison group included 35 patients with GP without CAD. Periodontal tissue status was evaluated using the following indices: PMA (Papillary-Marginal-Alveolar Index, M. Massler, modified by S. Parma, 1960) and the Gingival Bleeding Index (PBI, Mühlemann & Saxer, 1977). Treatment needs were determined using the PSR screening test (Periodontal Screening and Recording, AAP and ADA, 1992). Oral hygiene status was assessed using the OHI-S (Oral Hygiene Index-Simplified, J.C. Green & J.R. Vermillion, 1964). Results. Patients with GP and CAD demonstrated significantly higher PMA, PBI, and PSR scores compared with those with GP alone. The mean PMA value in the GP + CAD group was 63.27 ± 1.92%, indicating severe inflammation. In the comparison group, the PMA index reflected a moderate degree of gingival inflammation (43.32 ± 2.18%), which was significantly lower (p < 0.001). The mean PBI score in patients with GP and CAD was 2.06 ± 0.08, significantly higher than in patients with GP without CAD (1.20 ± 0.08; p<0.001). A more pronounced degree of periodontal tissue damage was also evident in the PSR index, which reached 3.30 ± 0.06 in the main group versus 3.01 ± 0.09 in the comparison group (p < 0.01). No significant differences in oral hygiene status (OHI-S) were observed between groups (p > 0.05). However, most CAD patients demonstrated “unsatisfactory” (27.19 ± 4.17%) or “poor” (53.50 ± 14.67%) oral hygiene. In the GP+CAD group, no significant gender differences were found in PMA and PSR scores (p > 0.05). However, gingival bleeding measured by PBI was higher in men than in women (p < 0.05), while individual oral hygiene was significantly better in women (p < 0.01). Conclusion. The findings indicate that, against the background of poor oral hygiene, inflammatory changes in periodontal tissues are particularly pronounced in patients with GP when accompanied by atherosclerotic processes such as CAD.

To determine whether low-level laser therapy (LLLT), alone or with chlorhexidine (CLX; CLX + LLLT), improves clinical indices of gingival inflammation, gingival temperature, and systemic cytokines compared with CLX alone in cats with early-stage periodontal disease (American Veterinary Dental College stage 1 to 2). Cats diagnosed with American Veterinary Dental College stage 1 to 2 periodontal disease were randomized to 3 groups (CLX, LLLT, and CLX + LLLT; n = 7/group) after full-mouth scaling. Treatments were CLX spray, intraoral 905-nm gallium arsenide LLLT, or both for 7 days. Primary outcomes included probing pocket depth, gingival index, plaque index, and gingival surface temperature. Plasma tumor necrosis factor-α, interleukin (IL)-1β, and IL-6 were secondary outcomes. Thermography and blood sampling were also performed on days 0 and 8. Mean probing pocket depth decreased by 0.27 mm in CLX, 1.24 mm in LLLT, and 1.20 mm in CLX + LLLT. Gingival index and plaque index declined in all groups, with larger reductions in LLLT-treated cats. Gingival temperature decreased in LLLT (-3.1 °C) and CLX + LLLT (-4.3 °C). Tumor necrosis factor-α decreased in CLX + LLLT (-7.4 ng/L). Interleukin-6 decreased only in CLX + LLLT, and IL-1β changes were negligible. LLLT, particularly with CLX, produced greater improvements in gingival inflammatory indices, gingival temperature, and inflammatory markers than CLX alone. LLLT appears to be a safe and effective adjunct for the short-term management of gingival inflammation in cats with early-stage periodontal disease following professional dental cleaning.

To evaluate the efficacy of professional mechanical plaque removal (PMPR) for treating naturally occurring dental biofilm-induced gingivitis (i) compared to no treatment or oral hygiene instructions (OHI) (FQ1), (ii) when performed through different modalities (FQ2) or (iii) when combined with professionally administered local adjuncts (FQ3). A structured literature search was conducted for randomised or non-randomised controlled trials (RCTs and CTs) assessing gingival inflammation at patient level within 2-6 weeks after treatment in adults with gingivitis. Heterogeneous evidence shows with low certainty that PMPR has no efficacy in patients continuing with ineffective self-performed oral hygiene regimens but enhances OHI outcomes (FQ1; three RCTs, one CT). Split-mouth RCTs consistently indicated with very low certainty that ultrasonic scaling (US) plus air polishing is as effective but less time consuming than US plus polishing with rubber cup and prophylaxis paste. Furthermore, diode laser shows no adjunctive benefit (FQ2; five RCTs). Although some professionally administered local adjuncts have shown positive outcomes in patients receiving PMPR, their broader clinical application is limited due to unresolved clinical issues and uncertain cost effectiveness (FQ3; two RCTs). OHI should be the first-line treatment for dental biofilm-induced gingivitis. Combination of PMPR and OHI provides an adjunctive benefit over OHI alone. Air polishing may be combined with US to reduce the time for PMPR administration.

Non-antibiotic lipid complex-in-thermogel strikes twice: multimodal photosensitive antibacterial meets immunomodulation-boosted healing for periodontitis treatment

Human papillomavirus (HPV) is implicated in oncogenesis and inflammatory processes, yet its role in periodontitis remains poorly defined. We conducted a retrospective cohort study using the US Collaborative Network of the TriNetX platform. Adults (≥18 years) with at least two healthcare encounters were selected. The HPV-positive group, identified via ICD-10 codes from 2005 to 2018, was 1:1 propensity score-matched with HPV-negative controls after excluding individuals with prior periodontitis, cancer, or insufficient follow-up. New-onset periodontitis was defined using ICD-10 criteria, and hazard ratio estimates were derived using Cox proportional hazards models. Sensitivity analyses were performed with varying wash-out periods (12-36 months) and follow-up durations (5-15 years), while stratified analyses assessed differences by age, sex, race, and key comorbidities. After matching (n=272,332 per group), the baseline characteristics were balanced. HPV-positive patients had significantly higher periodontitis risk, with a hazard ratio (HR)=3.00 (95% CI: 2.67-3.37). Sensitivity analyses showed consistent findings. Age-stratified HRs were 3.74 (95% CI: 3.28-4.26) for 18-64 years old and 1.79 (95% CI: 1.13-2.84) for ≥65 years old. In racial stratification, White and Asian HPV patients presented significant risk of periodontitis. HPV infection is associated with a markedly increased risk of periodontitis. These findings support enhanced periodontal screening for HPV-positive patients and warrant further investigation into the viral mechanisms driving chronic oral inflammation. Human papillomavirus (HPV) is well known for its link to certain cancers, but scientists are now investigating whether it might also play a role in gum disease. In this study, researchers analyzed health records from a large U.S. database to find out if people diagnosed with HPV were more likely to later develop periodontitis. They compared more than 270,000 adults with HPV with a similar group without the virus, making sure that both groups were alike in terms of age, health conditions, and other factors. The results showed that people with HPV had about three times the risk of developing periodontitis. This connection remained strong even when the researchers looked at different age groups, timeframes, and health backgrounds. Younger adults and those who were White or Asian showed particularly high risks. These findings suggest that HPV may play a role in long-term gum inflammation and damage. Although the study does not prove cause and effect, it highlights the need for more research and suggests that people with HPV might benefit from regular dental checkups to catch and manage gum disease early.

Background: The growing body of evidence linking dietary factors to oral and periodontal health is characterized by substantial heterogeneity in study design, dietary assessment methods, and reported outcomes, warranting a comprehensive narrative synthesis. Diet is a key determinant of oral and periodontal health, influencing inflammation, oxidative stress, salivary composition, and the oral microbiome. Objectives: This narrative review aims to synthesize current clinical, epidemiological, and mechanistic evidence on how dietary patterns and specific nutrients affect oral and periodontal health, focusing on inflammatory pathways, microbiome modulation, nutrient-dependent tissue mechanisms, and clinical outcomes. Methods: A structured narrative search was conducted in PubMed, Scopus, Web of Science, and Google Scholar (2000-2025). Studies examining diet, nutrients, the oral microbiome, caries, gingival inflammation, or periodontal disease were screened through a multistep process, resulting in 98 included articles. Results: High-sugar and ultra-processed diets trigger inflammation and oral dysbiosis, increasing caries and periodontal susceptibility. In contrast, nutrient-rich and anti-inflammatory diets improve immune regulation, support microbial balance, and are associated with better periodontal parameters. Conclusions: Dietary habits significantly shape oral and periodontal outcomes through interconnected metabolic, microbial, and immunological pathways. Integrating targeted nutritional counseling into dental care may strengthen prevention strategies and improve long-term oral health.

A bstract Aim: Partial dentures, whether fixed or removable, play a crucial role in restoring oral function and aesthetics in patients with partial edentulism. However, inadequate hygiene practices around these prostheses may lead to periodontal complications This study aimed to evaluate periodontal health status, oral hygiene practices, and awareness among fixed and removable partial denture wearers in Al-Ahsa, Saudi Arabia. Materials and Methods: A cross-sectional clinical study was conducted among 298 adult patients attending the dental clinics of King Faisal University. Clinical assessments included the plaque index, gingival index, and calculus surface index. Participants also completed a structured questionnaire assessing demographics, hygiene behaviors, prosthesis type, and awareness. Statistical analyses were performed using univariate and multivariable logistic regression to determine associations between hygiene practices and periodontal indices. Results: Among 298 participants, a high prevalence of suboptimal periodontal health was observed, with only 24.8%, 27.2%, and 36.2% scoring zero (healthy) on the plaque, gingival, and calculus indices, respectively. Multivariable analysis revealed that regular prosthesis cleaning was a significant protective factor against high plaque (adjusted odds ratio [AOR] = 0.51, P value = 0.032) and gingival indices (AOR = 0.54, P value = 0.024). Conversely, removable partial dentures were a significant independent risk factor for a high calculus index (AOR = 2.08, P value = 0.030) compared to fixed prostheses. Furthermore, a significant knowledge-practice gap was identified; while 71.5% believed prostheses need special care, 44.0% admitted to not cleaning theirs regularly. Conclusion: This study concludes that regular prosthesis cleaning and frequent tooth brushing are strongly associated with reduced risks of plaque accumulation and gingival inflammation. In contrast, the use of a removable partial denture is independently associated with a significantly higher risk of calculus formation. These findings highlight that while behavioral interventions are crucial for managing soft tissue health, the prosthesis type itself is a key determinant of hard deposit accumulation.

Regulation of endoplasmic reticulum stress and ferroptosis by rutin in a rat model of periodontitis.

Bomidin prevents inflammatory responses in macrophages by inhibiting toll-like receptor 4/nuclear factor-κB activation and blocking metabolic reprogramming to alleviate periodontal inflammation.

Periodontal disease (PD) is a chronic inflammatory process of infectious etiology that affects the periodontal tissues. PD is caused by the subgingival biofilm, which, in dysbiosis, leads to an uncontrolled response of the immunological system in the periodontal tissues. To further understand the mechanisms involved in PD and how it is linked to other diseases, several animal models have been developed. These models allow researchers to study the different aspects of PD in a controlled setting, such as its pathogenesis and treatment options. Oral inoculation of periodontal bacteria, such as Aggregatibacter actinomycetemcomitans or Porphyromonas gingivalis, is one of the most commonly used models for studying PD. In these methods, the bacteria are inoculated directly into the oral cavity, allowing for rapid colonization and development of the disease. Another widely used mouse model for PD involves the application of a silk ligature around the second molar, the ligature triggers oral micro-organisms accumulation inducing an inflammatory response in the surrounding tissues, leading to gingival inflammation and pocket formation. The application of mouse models of PD has several advantages, such as relatively low cost, fast results, and the possibility of performing more accurate studies. In this chapter, we will describe bacteria- and ligature-induced periodontal disease models in detailed steps.

Objectives: This study aimed to compare the efficacy of Nigella sativa (N. sativa) mouthwash and chlorhexidine (CHX) in the management of gingivitis. Methods: This triple-blind, parallel-group randomized controlled trial (Iranian Registry of Clinical Trials, IRCT20221212056786N2) was conducted at the Department of Periodontology, School of Dentistry, Shahid Sadoughi University of Medical Sciences, Yazd, Iran. Thirty-six patients aged 20-40 years with gingivitis were randomized in a 1:1 ratio using simple randomization to receive either 20% N. sativa mouthwash or 0.2% CHX mouthwash twice daily for 14 days. Participants, outcome assessors, and statisticians were blinded. Clinical parameters, including plaque index (PI, primary outcome), bleeding index (BI), and staining index (SI), were recorded at baseline and after 14 days. Data were analyzed using analysis of covariance, with statistical significance set at p < 0.05. Results: All 36 participants completed the study. Both N. sativa and CHX mouthwashes significantly reduced PI (mean difference: N. sativa, 33.44 ± 0.72; CHX, 32.72 ± 1.37; p < 0.001 for both) and BI (mean difference: N. sativa, 19.44 ± 0.80; CHX, 19.98 ± 0.81; p < 0.001 for both) after 14 days compared with baseline. Between-group differences were not significant for PI (mean difference: -0.72; 95% confidence interval [CI]: -1.94 to 0.50; p = 0.057) or BI (mean difference: -0.54; 95% CI: -1.10 to 0.02; p = 0.053). A statistically significant but clinically trivial increase in SI was observed in the N. sativa group (mean change: 0.78 ± 1.06; p = 0.006), but not in the CHX group (mean change: 0.44 ± 1.29; p = 0.163). No adverse events, such as taste alteration or mucosal irritation, were reported based on participant self-reports. Conclusions: N. sativa mouthwash showed similar efficacy to CHX in reducing plaque and gingival inflammation over 14 days, suggesting it may be a viable alternative for short-term gingivitis management. However, its potential for slight tooth staining warrants caution, and further studies are needed to assess long-term effects.

Ziziphus nummularia (Burm. f.) Wight &amp; Arn. (Rhamnaceae), commonly known as “Jharberi” in India and “Bairi” or “Karkanrha” in Pakistan, is a thorny shrub reaching 1–2 meters in height and widely distributed across India, Pakistan, and Iran. The leaves and fruits of this species have long been used in traditional medicine to manage mental disorders, frequent colds, influenza, diarrhoea, dysentery, colic, indigestion, and gum inflammation, and serve as a general tonic. Phytochemical investigations have revealed the presence of numerous bioactive constituents, including flavonoids, alkaloids, glycosides, saponins, tannins, sterols, pectins, triterpenic acids, polysaccharides, fatty acids, and peptide alkaloids such as ziziphin derivatives. These compounds are known to exhibit a wide range of pharmacological activities, including antitumor, anthelmintic, antibacterial, analgesic, and anti-inflammatory effects. In the present study, Fourier Transform Infrared (FT-IR) spectroscopy was employed to characterize the functional groups present in the leaf and fruit extracts of Z. nummularia. The spectral analysis revealed distinctive absorption peaks corresponding to hydroxyl, carbonyl, and aromatic ring vibrations, confirming the presence of phenolic and flavonoid compounds. These functional groups are primarily responsible for the antioxidant and therapeutic properties of the plant

Background and Objectives: The notable changes in circulating hormones during pregnancy are known to detrimentally affect the oral cavity detrimentally, leading to the manifestation of conditions like gingival overgrowth and inflammatory periodontal disease. This investigation specifically evaluated the state of gingival health among expectant mothers receiving care at the Erbil City Maternity Hospital and analyzed their reported dental care routines. Methods: The cross-sectional data collection took place over three months, from November 2024 through January 2025, enrolling 90 pregnant women across all trimesters. Data collection included clinical oral examinations and a structured questionnaire addressing oral hygiene habits, supplement intake, and gingival health. The Plaque Index (PI), Gingival Index (GI), Bleeding on Probing (BOP), and Gingival Overgrowth (GOG) were utilized to evaluate oral health. Statistical analyses comprised one-way ANOVA and descriptive statistics. Results: Plaque accumulation remained stable across trimesters (PI: p=0.934), whereas gingival inflammation increased significantly as pregnancy advanced (GI: p=0.040). Bleeding on probing (BOP) was present in over half of participants, with higher prevalence in the second and third trimesters (BOP: p=0.144). Gingival overgrowth (GOG) increased gradually, though not to a statistically significant degree (GOG: p=0.129). Oral hygiene practices were generally inadequate: 86.6% reported daily brushing, but only 31.1% used dental floss, and 40% used a tongue scraper. Supplement use was prevalent, with 75.5% of women regularly taking folic acid and vitamins. Conclusion: There is a high prevalence of gingival inflammation and periodontal diseases among pregnant women, with severity escalating as pregnancy progresses. Enhanced oral hygiene practices and increased awareness of oral care during pregnancy are necessary to prevent oral health complications. Regular dental checkups should be promoted to support the health of both mother and fetus. Keywords: Pregnancy, Gingival Inflammation, Gingival Overgrowth, Plaque Index, Bleeding on Probing, Dental Hygiene Practices

Background and Objectives: Periodontal health may be influenced by the hormonal and immunological shifts that occur during pregnancy and lactation. This study aimed to assess and compare the periodontal status and salivary concentrations of matrix metalloproteinase 8 (MMP-8) and tumor necrosis factor-alpha (TNF- alpha) among pregnant, post-partum lactating, and non-pregnant/non-lactating (control) women. Methods: A case-control study was performed on 90 systemically healthy women, with an average age ranging from 25-35 years, equally divided into pregnant, postpartum lactating, and control groups. Clinical periodontal parameters, including bleeding on probing (BOP), gingival index (GI), probing pocket depth (PPD), and plaque index (PI), were examined, and salivary levels of MMP-8 and TNF-α were assessed via enzyme-linked immunosorbent assay (ELISA). Results: The mean level of GI, BOP, PPD, MMP-8, and TNF- alpha were significantly elevated in pregnant women, followed by lactating and control groups, with significant differences between each two groups and among the three groups (P &lt; 0.001), except for non-significant differences between lactating and control groups regarding MMP-8 (P =1.000). All the correlations between clinical and inflammatory biomarkers were weak and non-significant (rho &lt; 0.4), whereas a significant negative correlation was found between GI and MMP-8 in the pregnant group (rho = -0.544, p = 0.002). Conclusion: Pregnancy is associated with increased gingival inflammation and biochemical inflammatory markers, indicating a heightened risk for periodontal disease. Lactating women displayed intermediate changes, emphasizing the need for periodontal monitoring and preventive care throughout the peripartum period. Keywords: Pregnancy, Periodontal Diseases, Matrix Metalloproteinase 8, Tumor Necrosis Factor-alpha