GFP Mouse Research Articles

Abstract P3094: Cell-autonomous Immune Signaling In Human Cardiac Fibroblasts Modulates Fibrosis

Cardiac fibrosis is the pathophysiological hallmark of injury in an adult heart. Immune response in the injury niche modulates fibrosis. However, how cell-autonomous immune signaling in cardiac fibroblasts modulates fibrosis is unknown. In this report, we demonstrate that cardiac fibroblasts express TLR4 receptors, and inhibition of TLR4 signaling inhibits fibrotic changes such as proliferation and myofibroblast conversion in human cardiac fibroblasts. Using FACS, and single-cell data of cardiac fibroblasts from Colagen1 GFP mouse, we demonstrate that TLR4 is the predominant TLR and approximately 90 % of human cardiac fibroblasts express TLR4 receptors. Using EdU labeling, cardiac fibroblasts taking up EdU have reduced from 91.65 ± 3.89% from control conditions to 71.15 % ± 2.05 % (mean ± SEM, n=3, p< 0.05) in TLR4 inhibited condition. Ki67 staining shows a similar reduction from 93.1 ± 2.34 % to 59.3% ± 3.54%. TLR4 inhibition in TGF-β treated human cardiac fibroblasts reduced the expression of Periostin expression by 2.6 ± 0.58 and Sma1 by 1.46-± 0.18(mean ± SEM, n=3)fold. Further, migration of cardiac fibroblasts demonstrated a 76.3± 10.23 % (mean ± SEM, n=3, p< 0.05) reduction in the presence of TLR4 inhibitor. Transcriptome analysis of TLR4-inhibited cardiac fibroblasts shows downregulation of proliferation-related genes and pathways. Ingenuity pathway analysis (IPA) of differentially expressed genes in TLR4-inhibited TGF-β -treated cells compared to TGF-β alone shows a reduced expression of a subset of target genes of TGF-β signaling. Further, compared to healthy controls, single-cell data of heart failure patients show significant elevation of Histone 3 and Histone 4 in the fibroblast cluster along with chromatin readers, Brd4 and Nox4. Inhibition of TLR4 in human cardiac fibroblasts reduced the expression of Histone 3 and Histone 4, with Nox4 modulating the chromatin architecture required for fibroblast activation. Thus our data demonstrate that cardiac fibroblast act as an immune cell having cell-autonomous immune signaling, regulating fibrotic changes. Ongoing experiments in 3D human cardiac organoid injury models will reveal how TLR4 signaling regulates fibrotic activation of human cardiac fibroblasts in a heterogeneous system.

Subiculum fiber degeneration within the fornix white matter tract in 5xFAD mice

AbstractBackgroundAlzheimer’s disease (AD) is a progressive neurodegenerative disease that affects all components of the neurovascular unit. The hallmark pathology of AD, amyloid plaques and tau neurofibrillary tangles, aggregate within gray matter areas and spread across neural networks. Although AD pathology is scarce within white matter brain regions, white matter abnormalities have been observed in AD patients using diffusion tensor imaging (DTI; Sachdev et al 2013) and white matter tracts are putative therapeutic targets for deep brain stimulation (Lam et al 2020). Particularly, the fornix is a white matter tract which connects the hippocampus to brain regions of the classic Papez circuit and Default Mode Network (DMN). A recent whole brain analysis using transgenic 5xFAD/Thy1‐GFP mouse (Zhang et al 2020) found evidence of fornix degeneration and dystrophic axon terminals within the mammillary body (a major SUB target) occurring as early as 2 months of age. However, due to the broad expression of GFP under the Thy1 promotor, it is difficult to determine the origin of axon fibers and further characterize if other SUB pathways are also affected.MethodTo investigate white matter changes in AD and further characterize SUB axon degeneration, we performed triple anterograde tract‐tracing of SUB axon fibers and post‐mortem DTI tractography imaging within the same 8‐9 mo. old 5xFAD mice.ResultDTI imaging revealed a significant decrease in fiber density of the fornix white matter tract in 5xFAD mice. Quantification of tracer‐labeled fluorescent fiber density in the 5xFAD mice vs control mice also revealed significant degeneration of SUB fibers within the fornix white matter as well as downstream SUB targets including mammillary body, retrosplenial cortex, and anterior thalamus. Furthermore, SUB axon terminals in 5xFAD mice appeared dystrophic and terminal field topography was disrupted.ConclusionDTI imaging and anatomical tract tracing approaches reveal white matter degeneration in 5xFAD mice and the fornix/SUB fibers are particularly vulnerable in AD. Diminished SUB input to brain regions of the Papez circuit/DMN likely leads to neural network dysfunction. Whether amyloid pathology, neurovascular dysfunction, or inflammatory response in the 5xFAD mouse contributes to white matter degeneration remains to be determined by future studies.

Iris-derived induced pluripotent stem cells that express GFP in all somatic cells of mice and differentiate into functional retinal neurons

When regenerated tissue is generated from induced pluripotent stem cells (iPSCs), it is necessary to track and identify the transplanted cells. Fluorescently-labeled iPSCs synthesize a fluorescent substance that is easily tracked. However, the expressed protein should not affect the original genome sequence or pluripotency. To solve this problem, we created a cell tool for basic research on iPSCs. Iris tissue-derived cells from GFP fluorescence-expressing mice (GFP-DBA/2 mice) were reprogrammed to generate GFP mouse iris-derived iPSCs (M-iris GFP iPSCs). M-iris GFP iPSCs expressed cell markers characteristic of iPSCs and showed pluripotency in differentiating into the three germ layers. In addition, when expressing GFP, the cells differentiated into functional recoverin- and calbindin-positive cells. Thus, this cell line will facilitate future studies on iPSCs.

NAD(P)H autofluorescence lifetime imaging enables single cell analyses of cellular metabolism of osteoblasts in vitro and in vivo via two-photon microscopy.

Two-photon fluorescence lifetime microscopy (2P-FLIM) is a non-invasive optical technique that can obtain cellular metabolism information based on the intrinsic autofluorescence lifetimes of free and enzyme-bound NAD(P)H, which reflect the metabolic state of single cells within the native microenvironment of the living tissue. NAD(P)H 2P-FLIM was initially performed in bone marrow stromal cell (BMSC) cultures established from Col (I) 2.3GFP or OSX-mCherry mouse models, in which osteoblastic lineage cells were labelled with green or red fluorescence protein, respectively. Measurement of the mean NAD(P)H lifetime, τM, demonstrated that osteoblasts in osteogenic media had a progressively increased τM compared to cells in regular media, suggesting that osteoblasts undergoing mineralization had higher NAD+/NAD(P)H ratio and may utilize more oxidative phosphorylation (OxPhos). In vivo NAD(P)H 2P-FLIM was conducted in conjunction with two-photon phosphorescence lifetime microscopy (2P-PLIM) to evaluate cellular metabolism of GFP+ osteoblasts as well as bone tissue oxygen at different locations of the native cranial bone in Col (I) 2.3GFP mice. Our data showed that osteocytes dwelling within lacunae had higher τM than osteoblasts at the bone edge of suture and marrow space. Measurement of pO2 showed poor correlation of pO2 and τM in native bone. However, when NAD(P)H 2P-FLIM was used to examine osteoblast cellular metabolism at the leading edge of the cranial defects during repair in Col (I) 2.3GFP mouse model, a significantly lower τM was recorded, which was associated with lower pO2 at an early stage of healing, indicating an impact of hypoxia on energy metabolism during bone tissue repair. Taken together, our current study demonstrates the feasibility of using non-invasive optical NAD(P)H 2P-FLIM technique to examine cellular energy metabolism at single cell resolution in living animals. Our data further support that both glycolysis and OxPhos are being used in the osteoblasts, with more mature osteoblasts exhibiting higher ratio of NAD+/NAD(P)H, indicating a potential change of energy mode during differentiation. Further experiments utilizing animals with genetic modification of cellular metabolism could enhance our understanding of energy metabolism in various cell types in living bone microenvironment.

Role of mesonephric contribution to mouse testicular development revisited

The role of the mesonephros in testicular development was re-evaluated by growing embryonic day 11.5 (E11.5) mouse testes devoid of mesonephros for 8–21 days in vivo under the renal capsule of castrated male athymic nude mice. This method provides improved growth conditions relative to previous studies based upon short-term (4–7 days) organ culture. Meticulous controls involved wholemount examination of dissected E11.5 mouse testes as well as serial sections of dissected E11.5 mouse testes which were indeed shown to be devoid of mesonephros. As expected, grafts of E11.5 mouse testes with mesonephros attached formed seminiferous tubules and also contained mesonephric derivatives. Grafts of E11.5 mouse testes without associated mesonephros also formed seminiferous tubules and never contained mesonephric derivatives. The consistent absence of mesonephric derivatives in grafts of E11.5 mouse testes grafted alone is further proof of the complete removal of the mesonephros from the E11.5 mouse testes. The testicular tissues that developed in grafts of E11.5 mouse testes alone contained canalized seminiferous tubules composed of Sox9-positive Sertoli cells as well as GENA-positive germ cells. The seminiferous tubules were surrounded by α-actin-positive myoid cells, and the interstitial space contained 3βHSD-1-positive Leydig cells. Grafts of E11.5 GFP mouse testes into wild-type hosts developed GFP-positive vasculature indicating that E11.5 mouse testes contain vascular precursors. These results indicate that the E11.5 mouse testis contains precursor cells for Sertoli cells, Leydig cells, myoid cells and vasculature whose development and differentiation are independent of cells migrating from the E11.5 mesonephros.

DIPG-53. CHARACTERIZING THE ROLE OF PPM1D MUTATIONS IN THE PATHOGENESIS OF DIFFUSE INTRINSIC PONTINE GLIOMAS (DIPGS)

INTRODUCTIONWe have previously found that up to 15% of all DIPGs harbor mutations in PPM1D, resulting in the expression of an activated and truncated PPM1D (PPM1Dtr). Here we evaluate the mechanisms through which PPM1Dtr enhances glioma formation and identify its associated therapeutic vulnerabilities.METHODSWe have developed multiple in vitro and in vivo models of PPM1D-mutant DIPGs and applied quantitative proteomic and functional genomic approaches to identify pathways altered by PPM1Dtr and associated dependencies.RESULTS PPM1D mutations are clonal events that are anti-correlated to TP53 mutations. We find ectopic expression of PPM1Dtr to be sufficient to enhance glioma formation and to be necessary in PPM1D-mutant DIPG cells. In addition, endogenous truncation of PPM1D is sufficient to enhance glioma formation in the presence of mutant H3F3A and PDGFRA. PPM1Dtr overexpression attenuates g-H2AX formation and suppresses apoptosis and cell-cycle arrest in response to radiation treatment. Deep scale phosphoproteomics analyses reveal DNA-damage and cell cycle pathways to be most significantly associated with PPM1Dtr. Furthermore, preliminary analysis of genome-wide loss-of-function CRISPR/Cas9 screens in isogenic GFP and PPM1Dtr overexpressing mouse neural stem cells reveal differential dependency on DNA-damage response genes in the PPM1Dtr overexpressing cells. Consistent with PPM1D’s role in stabilizing MDM2, PPM1D-mutant DIPG models are sensitive to a panel of MDM2 inhibitors (Nutlin-3a, RG7388, and AMG232).CONCLUSIONOur study shows that PPM1Dtr is both an oncogene and a dependency in PPM1D- mutant DIPG, and there are novel therapeutic vulnerabilities associated with PPM1D that may be exploited.

Direct Reprogramming of Mouse Fibroblasts into Functional Osteoblasts.

Although induced pluripotent stem cells hold promise as a potential source of osteoblasts for skeletal regeneration, the induction of pluripotency followed by directed differentiation into osteoblasts is time consuming and low yield. In contrast, direct lineage reprogramming without an intervening stem/progenitor cell stage would be a more efficient approach to generate osteoblasts. We screened combinations of osteogenic transcription factors and identified four factors, Runx2, Osx, Dlx5, and ATF4, that rapidly and efficiently reprogram mouse fibroblasts derived from 2.3 kb type I collagen promoter-driven green fluorescent protein (Col2.3GFP) transgenic mice into induced osteoblast cells (iOBs). iOBs exhibit osteoblast morphology, form mineralized nodules, and express Col2.3GFP and gene markers of osteoblast differentiation. The global transcriptome profiles validated that iOBs resemble primary osteoblasts. Genomewide DNA methylation analysis demonstrates that within differentially methylated loci, the methylation status of iOBs more closely resembles primary osteoblasts than mouse fibroblasts. We further demonstrate that Col2.3GFP+ iOBs have transcriptome profiles similar to GFP+ cells harvested from Col2.3GFP mouse bone chips. Functionally, Col2.3GFP+ iOBs form mineralized bone structures after subcutaneous implantation in immunodeficient mice and contribute to bone healing in a tibia bone fracture model. These findings provide an approach to derive and study osteoblasts for skeletal regeneration. © 2019 American Society for Bone and Mineral Research.

Abstract 2649: A novel approach to fate-map hypoxic cells during tumor progression uncovers metastatic potency of post-hypoxic cells

Abstract Hypoxia occurs in 90% of solid tumors due to inefficient vasculature and has been demonstrated to promote a more aggressive phenotype, correlating with worse patient prognosis. Current methods to measure hypoxia in human tumors only identify cells that are hypoxic at the time the tissue is collected and do not delineate cells that were transiently exposed to hypoxia but survived and adapted. To overcome this challenge, we generated a Lox-Cre dual-vector oxygen-dependent reporter system. Under hypoxia, Cre expression leads to the cleavage of a DsRed reporter and permanent expression of a GFP reporter. We stably transduced breast cancer cell lines and demonstrated an irreversible reporter-switch that occurs when cells are exposed to 0.5% O2, the typical O2 level in human breast tumors, but does not occur under physiological conditions (8% O2). To explore the utility of our system, we embedded spheroids derived from MDA-MB-231 reporter cells in collagen and cultured them under 20% O2 conditions. A defined hypoxic core (GFP+) was visible after 15 days in culture and it correlated with hypoxic O2 measurements. We then generated orthotopic breast tumors by transplanting MDA-MB-231 reporter cells into the mammary fat pad of mice. Hypoxic cells (GFP+) were localized in the peri-necrotic region of the tumor and co-localized with hypoxyprobe and HIF1α labeling. RNA sequencing of GFP+ compared to DsRed+ tumor cells demonstrated that GFP+ cells were enriched for the hallmark signature of hypoxia. Additionally, we developed a transgenic mouse expressing the hypoxia-driven construct that was bred to a tdTomato-floxed GFP mouse. A female double fluorescent/hypoxia-reporter mouse was then bred to a male FVB/N-Tg(MMTV-PyMT) mouse in order to generate triple-transgenic mice that form breast tumors that spontaneously metastasize. We systematically studied hypoxia in spontaneous breast tumors from the development of ductal hyperplasia to late stage invasive carcinoma. Tumor hypoxia was first detected in early stage ductal carcinoma in situ (DCIS) lesions. Similarly to the spheroid model, mammary organoids derived from triple-transgenic mice tumors cultured under 20% O2 conditions also exhibited a defined hypoxic core after 15 days in culture. Both orthotopic and transgenic mouse models revealed an increased potency of post-hypoxic cells at arriving to distant sites in early stage metastasis. We utilized RNA sequencing to identify potential mechanisms of enhanced metastatic capacity. Ultimately, our system allowed the fate-map of hypoxic cells during tumor progression to metastasis. We show for the first time that 3D in vitro organoids derived from PyMT tumors develop regions of hypoxia under normal tissue culture conditions. In vivo, we show that hypoxic cells are more potent at arriving at distant sites and that they retain a different gene expression that potentially confers a metastatic advantage. Citation Format: Inês Godet, Yu Jung Shin, Julia A. Ju, Soumitra Bhoyar, I Chae Ye, Guannan Wang, Saraswati Sukumar, Daniele M. Gilkes. A novel approach to fate-map hypoxic cells during tumor progression uncovers metastatic potency of post-hypoxic cells [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2019; 2019 Mar 29-Apr 3; Atlanta, GA. Philadelphia (PA): AACR; Cancer Res 2019;79(13 Suppl):Abstract nr 2649.

Mapping the populations of neurotensin neurons in the male mouse brain

Neurotensin (Nts) is a neuropeptide implicated in the regulation of many facets of physiology, including cardiovascular tone, pain processing, ingestive behaviors, locomotor drive, sleep, addiction and social behaviors. Yet, there is incomplete understanding about how the various populations of Nts neurons distributed throughout the brain mediate such physiology. This knowledge gap largely stemmed from the inability to simultaneously identify Nts cell bodies and manipulate them in vivo. One means of overcoming this obstacle is to study NtsCre mice crossed onto a Cre-inducible green fluorescent reporter line (NtsCre;GFP mice), as these mice permit both visualization and in vivo modulation of specific populations of Nts neurons (using Cre-inducible viral and genetic tools) to reveal their function. Here we provide a comprehensive characterization of the distribution and relative densities of the Nts-GFP populations observed throughout the male NtsCre;GFP mouse brain, which will pave the way for future work to define their physiologic roles. We also compared the distribution of Nts-GFP neurons with Nts-In situ Hybridization (Nts-ISH) data from the adult mouse brain. By comparing these data sets we can distinguish Nts-GFP populations that may only transiently express Nts during development but not in the mature brain, and hence which populations may not be amenable to Cre-mediated manipulation in adult NtsCre;GFP mice. This atlas of Nts-GFP neurons will facilitate future studies using the NtsCre;GFP line to describe the physiological functions of individual Nts populations and how modulating them may be useful to treat disease.

Visualization of Motor Axon Navigation and Quantification of Axon Arborization In Mouse Embryos Using Light Sheet Fluorescence Microscopy.

Spinal motor neurons (MNs) extend their axons to communicate with their innervating targets, thereby controlling movement and complex tasks in vertebrates. Thus, it is critical to uncover the molecular mechanisms of how motor axons navigate to, arborize, and innervate their peripheral muscle targets during development and degeneration. Although transgenic Hb9::GFP mouse lines have long served to visualize motor axon trajectories during embryonic development, detailed descriptions of the full spectrum of axon terminal arborization remain incomplete due to the pattern complexity and limitations of current optical microscopy. Here, we describe an improved protocol that combines light sheet fluorescence microscopy (LSFM) and robust image analysis to qualitatively and quantitatively visualize developing motor axons. This system can be easily adopted to cross genetic mutants or MN disease models with Hb9::GFP lines, revealing novel molecular mechanisms that lead to defects in motor axon navigation and arborization.

The Role of Bone Marrow-Derived Cells during Ectopic Bone Formation of Mouse Femoral Muscle in GFP Mouse Bone Marrow Transplantation Model.

Multipotential ability of bone marrow-derived cells has been clarified, and their involvement in repair and maintenance of various tissues has been reported. However, the role of bone marrow-derived cells in osteogenesis remains unknown. In the present study, bone marrow-derived cells during ectopic bone formation of mouse femoral muscle were traced using a GFP bone marrow transplantation model. Bone marrow cells from C57BL/6-Tg (CAG-EGFP) mice were transplanted into C57BL/6 J wild type mice. After transplantation, insoluble bone matrix (IBM) was implanted into mouse muscle. Ectopic bone formation was histologically assessed at postoperative days 7, 14, and 28. Immunohistochemistry for GFP single staining and GFP-osteocalcin double staining was then performed. Bone marrow transplantation successfully replaced hematopoietic cells with GFP-positive donor cells. Immunohistochemical analyses revealed that osteoblasts and osteocytes involved in ectopic bone formation were GFP-negative, whereas osteoclasts and hematopoietic cells involved in bone formation were GFP-positive. These results indicate that bone marrow-derived cells might not differentiate into osteoblasts. Thus, the main role of bone marrow-derived cells in ectopic osteogenesis may not be to induce bone regeneration by differentiation into osteoblasts, but rather to contribute to microenvironment formation for bone formation by differentiating tissue stem cells into osteoblasts.

BMP-SMAD signalling output is highly regionalized in cardiovascular and lymphatic endothelial networks.

BackgroundBone morphogenetic protein (BMP) signalling has emerged as a fundamental pathway in endothelial cell biology and deregulation of this pathway is implicated in several vascular disorders. BMP signalling output in endothelial cells is highly context- and dose-dependent. Phosphorylation of the BMP intracellular effectors, SMAD1/5/9, is routinely used to monitor BMP signalling activity. To better understand the in vivo context-dependency of BMP-SMAD signalling, we investigated differences in BMP-SMAD transcriptional activity in different vascular beds during mouse embryonic and postnatal stages. For this, we used the BRE::gfp BMP signalling reporter mouse in which the BMP response element (BRE) from the ID1-promotor, a SMAD1/5/9 target gene, drives the expression of GFP.ResultsA mosaic pattern of GFP was present in various angiogenic sprouting plexuses and in endocardium of cardiac cushions and trabeculae in the heart. High calibre veins seemed to be more BRE::gfp transcriptionally active than arteries, and ubiquitous activity was present in embryonic lymphatic vasculature. Postnatal lymphatic vessels showed however only discrete micro-domains of transcriptional activity. Dynamic shifts in transcriptional activity were also observed in the endocardium of the developing heart, with a general decrease in activity over time. Surprisingly, proliferative endothelial cells were almost never GFP-positive. Patches of transcriptional activity seemed to correlate with vasculature undergoing hemodynamic alterations.ConclusionThe BRE::gfp mouse allows to investigate selective context-dependent aspects of BMP-SMAD signalling. Our data reveals the highly dynamic nature of BMP-SMAD mediated transcriptional regulation in time and space throughout the vascular tree, supporting that BMP-SMAD signalling can be a source of phenotypic diversity in some, but not all, healthy endothelium. This knowledge can provide insight in vascular bed or organ-specific diseases and phenotypic heterogeneity within an endothelial cell population.Electronic supplementary materialThe online version of this article (doi:10.1186/s12861-016-0133-x) contains supplementary material, which is available to authorized users.

Galectin-9 increases seizure incidence following acute Theiler’s murine encephalomyelitis virus infection of C57BL/6 mice.

The incidence of viral encephalitis is as high as 22/100,000 in children less than 1 year of age. Survivors typically experience neurological sequel, including epilepsy. Infection of C57BL/6 mice with Theiler’s murine encephalomyelitis virus (TMEV) results in the onset of afebrile tonic-clonic seizures beginning at day 3–4 post-infection (p.i.) and is associated with aberrant IL-6 and TNF upregulation as well as apoptosis of CA1 neurons. We previously found that astrocyte galectin-9 (Gal-9) synergized TNF production from microglia following poly(I:C) stimulation. To investigate the role of Gal-9 in the pathogenesis of TMEV-induced seizures we infected control and Lgals9−/− mice and scored each mouse daily for signs of seizures. Following infection, immunohistochemical staining of Lgals9:GFP mouse brains showed a time-dependent increase in hippocampal Gal-9. Gal-9 was maximally expressed prior to the generation of seizures and localized to PECAM1+ endothelial cells, Iba-1+ microglia/macrophages and GFAP+ astrocytes but not NeuN+ neurons. Both RT-qPCR and western blotting techniques confirmed this finding. Furthermore, the incidence, but not severity of seizures was decreased in Lgals9−/− mice compared to controls. Surprisingly, we did not detect significant differences in hippocampal TNF, IL-6 or CCL2 levels, nor blood monocyte and neutrophil populations between genotypes. Together, these data suggests that Gal-9 promotes epileptogenesis during viral encephalitis, but the mechanism remains elusive.

Cell type-specific manipulation with GFP-dependent Cre recombinase.

SummaryThere are many transgenic GFP reporter lines that allow visualization of specific populations of cells. Using such lines for functional studies requires a method that transforms GFP into a molecule that enables genetic manipulation. Here we report the creation of a method that exploits GFP for gene manipulation, Cre Recombinase Dependent on GFP (CRE-DOG), a split component system that uses GFP and its derivatives to directly induce Cre/loxP recombination. Using plasmid electroporation and AAV viral vectors, we delivered CRE-DOG to multiple GFP mouse lines, leading to effective recombination selectively in GFP-labeled cells. Further, CRE-DOG enabled optogenetic control of these neurons. Beyond providing a new set of tools for manipulation of gene expression selectively in GFP+ cells, we demonstrate that GFP can be used to reconstitute the activity of a protein not known to have a modular structure, suggesting that this strategy might be applicable to a wide range of proteins.

Redox regulation of mitophagy in the lung during murine Staphylococcus aureus sepsis

Oxidative mitochondrial damage is closely linked to inflammation and cell death, but low levels of reactive oxygen and nitrogen species serve as signals that involve mitochondrial repair and resolution of inflammation. More specifically, cytoprotection relies on the elimination of damaged mitochondria by selective autophagy (mitophagy) during mitochondrial quality control. This aim of this study was to identify and localize mitophagy in the mouse lung as a potentially upregulatable redox response to Staphylococcus aureus sepsis. Fibrin clots loaded with S. aureus (1×107 CFU) were implanted abdominally into anesthetized C57BL/6 and B6.129X1-Nfe2l2tm1Ywk/J (Nrf2−/−) mice. At the time of implantation, mice were given vancomycin (6mg/kg) and fluid resuscitation. Mouse lungs were harvested at 0, 6, 24, and 48h for bronchoalveolar lavage (BAL), Western blot analysis, and qRT-PCR. To localize mitochondria with autophagy protein LC3, we used lung immunofluorescence staining in LC3–GFP transgenic mice. In C57BL/6 mice, sepsis-induced pulmonary inflammation was detected by significant increases in mRNA for the inflammatory markers IL-1β and TNF-α at 6 and 24h, respectively. BAL cell count and protein also increased. Sepsis suppressed lung Beclin-1 protein, but not mRNA, suggesting activation of canonical autophagy. Notably sepsis also increased the LC3-II autophagosome marker, as well as the lung׳s noncanonical autophagy pathway as evidenced by loss of p62, a redox-regulated scaffolding protein of the autophagosome. In LC3–GFP mouse lungs, immunofluorescence staining showed colocalization of LC3-II to mitochondria, mainly in type 2 epithelium and alveolar macrophages. In contrast, marked accumulation of p62, as well as attenuation of LC3-II in Nrf2-knockout mice supported an overall decrease in autophagic turnover. The downregulation of canonical autophagy during sepsis may contribute to lung inflammation, whereas the switch to noncanonical autophagy selectively removes damaged mitochondria and accompanies tissue repair and cell survival. Furthermore, mitophagy in the alveolar region appears to depend on activation of Nrf2. Thus, efforts to promote mitophagy may be a useful therapeutic adjunct for acute lung injury in sepsis.

Prostate progenitor cells proliferate in response to castration

Androgen-deprivation is a mainstay of therapy for advanced prostate cancer but tumor regression is usually incomplete and temporary because of androgen-independent cells in the tumor. It has been speculated that these tumor cells resemble the stem/progenitor cells of the normal prostate. The purpose of this study was to examine the response of slow-cycling progenitor cells in the adult mouse prostate to castration. Proliferating cells in the E16 urogenital sinus were pulse labeled by BrdU administration or by doxycycline-controlled labeling of the histone-H2B GFP mouse. A small population of labeled epithelial cells in the adult prostate localized at the junction of the prostatic ducts and urethra. Fluorescence-activated cell sorting (FACS) showed that GFP label-retaining cells were enriched for cells co-expressing stem cell markers Sca-1, CD133, CD44 and CD117 (4- marker cells; 60-fold enrichment). FACS showed, additionally, that 4-marker cells were androgen receptor positive. Castration induced proliferation and dispersal of E16 labeled cells into more distal ductal segments. When naïve adult mice were administered BrdU daily for 2weeks after castration, 16% of 4-marker cells exhibited BrdU label in contrast to only 6% of all epithelial cells (P<0.01). In sham-castrated controls less than 4% of 4-marker cells were BrdU labeled (P<0.01). The unexpected and admittedly counter-intuitive finding that castration induced progenitor cell proliferation suggests that androgen deprivation therapy in men with advanced prostate cancer could not only exert pleiotrophic effects on tumor sub-populations but may induce inadvertent expansion of tumor stem cells.

Discriminating multiplexed GFP reporters in primary articular chondrocyte cultures using image cytometry.

Flow cytometry has become a standard tool for defining a heterogeneous cell population based on surface expressed epitopes or GFP reporters that reflect cell types or cellular differentiation. The introduction of image cytometry raised the possibility of adaptation to discriminate GFP reporters used to appreciate cell heterogeneity within the skeletal lineages. The optical filters and LEDs were optimized for the reporters used in transgenic mice expressing various fluorescent proteins. In addition, the need for compensation between eGFP and surrounding reporters due to optical cross-talk was eliminated by selecting the appropriate excitation and emission filters. Bone marrow or articular cartilage cell cultures from GFP and RFP reporter mouse lines were established to demonstrate the equivalency in functionalities of image to flow cytometry analysis. To examine the ability for monitoring primary cell differentiation, articular chondrocyte cell cultures were established from mice that were single or doubly transgenic (Dkk3eGFP and Col2A1GFPcyan), which identify the progression of superficial small articular cell to a mature chondrocyte. The instrument was able to rapidly and accurately discriminate cells that were Dkk3eGFP only, Dkk3eGFP/Col2A1GFPcyan, and Col2A1GFP, which provides a useful tool for studying the impact of culture conditions on lineage expansion and differentiation.

Chromosomal mapping and zygosity check PCR of transgenes in a GFP mouse line (C57BL/6‐Tg(CAG‐EGFP)C14‐Y01‐FM131Osb) determined by genomic walking (1138.13)

Positional effect of transgenes is important for analyses of transgenic animals. In this study, the transgene insertion site in genomes of a GFP mouse line and primers for zygosity check PCR were determined by genomic walking (Exp Anim 53:103‐111, 2004). Adapter‐ligated, enzyme‐restricted genomic libraries were constructed with genomic DNA from hemizygous GFP mice. The sequence flanking the transgene was determined by sequencing amplicons from PCR of the genomic libraries with transgene‐specific and adaptor primers. The insertion site was located by BLAST search in Ensembl genome database (http://www.ensembl.org) using the genome sequence flanking the transgene. Primer sets for zygosity check were designed based on the transgene and flanking genome sequences. The flanking sequence was mapped on chromosome 11. Three primers were designed for zygosity check (1: CACCGCCGGGTCTCTCACTGTCAGTCT, 2: GACGTCAATGGGCGGGGGTCGTT, and 3: TGGGACCTGATCACGGTAAAACGAGGT). Transgenic and wild alleles could be detected in the genome by PCR with primers 1 and 2, and primer 1 and 3, respectively. The information should be useful for genomic research using the GFP line (C57BL/6‐Tg(CAG‐EGFP)C14‐Y01‐FM131Osb).Grant Funding Source: Supported by a grant from the Ministry of Health, Labor and Welfare of Japan.

In vivo stimulation of bone formation by aluminum and oxygen plasma surface-modified magnesium implants

A newly developed magnesium implant is used to stimulate bone formation in vivo. The magnesium implant after undergoing dual aluminum and oxygen plasma implantation is able to suppress rapid corrosion, leaching of magnesium ions, as well as hydrogen gas release from the biodegradable alloy in simulated body fluid (SBF). No released aluminum is detected from the SBF extract and enhanced corrosion resistance properties are confirmed by electrochemical tests. In vitro studies reveal enhanced growth of GFP mouse osteoblasts on the aluminum oxide coated sample, but not on the untreated sample. In addition to that a small amount (50 ppm) of magnesium ions can enhance osteogenic differentiation as reported previously, our present data show a low concentration of hydrogen can give rise to the same effect. To compare the bone volume change between the plasma-treated magnesium implant and untreated control, micro-computed tomography is performed and the plasma-treated implant is found to induce significant new bone formation adjacent to the implant from day 1 until the end of the animal study. On the contrary, bone loss is observed during the first week post-operation from the untreated magnesium sample. Owing to the protection offered by the Al2O3 layer, the plasma-treated implant degrades more slowly and the small amount of released magnesium ions stimulate new bone formation locally as revealed by histological analyses. Scanning electron microscopy discloses that the Al2O3 layer at the bone-implant interface is still present two months after implantation. In addition, no inflammation or tissue necrosis is observed from both treated and untreated implants. These promising results suggest that the plasma-treated magnesium implant can stimulate bone formation in vivo in a minimal invasive way and without causing post-operative complications.

Inducible gene expression in fetal thymic epithelium: A new BAC transgenic model

The thymus is the site of T cell development. Several stromal and hematopoietic cell types are necessary for the proper function of thymic selection and eventually peripheral immunity. Thymic epithelial cells (TECs) are essential for T cell lineage commitment, expansion, and maturation in the thymus. We were interested in developing an in vivo model in which exogenous gene expression could be transiently induced in embryonic TEC (Tet-On system). To this end, we have generated a bacterial artificial chromosome (BAC) transgenic mouse line in which the reverse tetracycline-dependent transactivator (rtTA) is expressed under the control of the Foxn1 promoter, a transcriptional factor indispensable for TEC development. To analyze the expression pattern and efficiency of this novel mouse model, we crossed the Foxn1-rtTA founder with a Tet-Responsive Element (TRE)-LacZ GFP mouse reporter to obtain a double transgenic mouse. In the presence of doxycycline, rtTA can interact with TRE and induce the expression of GFP and LacZ. In this double transgenic mouse, we observed that GFP expression was high, inducible and limited to TEC in fetal thymus. In contrast, in adult thymus, when TEC development and maturation is completed, GFP was barely detectable. Therefore, Foxn1-rtTA represents a new and efficient transgenic mouse model to induce genes of interest specifically in fetal thymic epithelium.