Functional Analysis Of Promoter Research Articles

PSI-7 Creation of gene-edited pigs for functional analysis of growth hormone receptor promoters in swine

Abstract Growth hormone (GH; somatotropin) has a central role in animal growth, reproduction, and lactation. The biological actions of GH are dependent on the GH receptor (GHR) that is found in important target tissues such as liver, muscle, adipose tissue, and bone. It is widely accepted that GH is the primary hormone controlling animal growth and that its actions are mediated by the GHR. In humans, laboratory species, and farm animals there are two promoter complexes that control GHR expression. The first promoter complex (P1) controls the liver-specific inducible expression of the GHR1A mRNA. The second promoter complex (P2) controls the non-tissue specific constitutive expression of GHR1B mRNA. Despite the central role that GH and the GHR have in animal growth, the independent function of each promoter complex has not yet been tested in any species. The objective was to perform a germ-line deletion of each GHR promoter complex to test their function in a porcine model. The CRISPR/Cas9 system was used to delete the P1 and P2 promoter complexes in porcine fetal fibroblasts and cloned to create two independent lines for each promoter deletion. Adult animals that were heterozygous (het) for the GHRP1 and GHRP2 deletions were mated to create litters of +/+ (wildtype, WT), +/- (het), and -/- (knockout, KO) pigs for the respective promoters. An RTPCR of liver and muscle confirmed that deletion of GHRP1 and GHRP2 effectively knocked out GHR1A and GHR1B mRNA. Piglets were weighed at birth and approximately monthly until 2 (GHRP1) or 5 (GHRP2) mo of age. Piglets from the GHRP1 line were +/+ (n = 3), +/- (n = 10), and -/- (n = 2) across two litters. Birthweights (1.5 ± 0.1, 1.4 ± 0.1, and 1.5 ± 0.2 kg, respectively) and body weight (BW) at 2 mo of age (32.7 ± 2.9, 27.0 ± 1.6, and 27.0 ± 3.5 kg, respectively) were similar (P > 0.10) for GHRP1 piglets. Piglets from the GHRP2 line were +/+ (n = 2), +/- (n = 6), and -/- (n = 9) across two litters. Birthweights were similar (1.4 ± 0.3, 1.3 ± 0.1, and 1.0 ± 0.1 kg, respectively) but GHRP2-/- pigs weighed less (P < 0.01) at weaning compared with GHRP2+/+ or GHRP2+/- piglets (6.4 ± 0.8, 6.5 ± 0.4, and 4.5 ± 0.4 kg, respectively). Monthly BW for the GHRP2-/- piglets were less (P < 0.001) when compared with GHRP2+/+ or GHRP2+/- piglets. At 5 mo of age, the GHRP2-/- piglets were approximately 50% of the BW of GHRP2+/+ or GHRP2+/- (89.6 ± 6.7, 89.6 ± 3.9, and 43.1 ± 3.2 kg, respectively). In conclusion, the deletion of GHRP2 (and GHR1B mRNA) had a profound effect on pig growth. The GHRP1 deletion (GHR1A mRNA) did not affect growth with the caveat that the GHRP1 litters had not reached maturity. This work was supported by USDA NIFA 2019-67015-29484.

Functional analysis of root-preferential oil palm metallothionein promoter in tobacco.

Root-specific or preferential promoters are essential to genetically modify plants with beneficial root traits. We have characterised the promoter from an oil palm metallothionein gene (EgMT) and performed a serial 5' deletion analysis to identify the region(s) essential for transgenes expression in roots. Stable functional characterisation of tobacco transgenic lines using the T1 generation showed that a deletion construct, designated as RSP-2D (1107bp), directed strong GUS expression at all stages of root development, particularly in mature roots. Other constructs, RSP-2A (2481bp) and RSP-2C (1639bp), drove GUS expression in roots with an intensity lower than RSP-2D. The promoter activity was also detectable in seed pods and immature seeds, albeit at lower levels than CaMV35S. The promoter activity may also be induced by wounding as intact GUS staining was observed at the flower- and leaf-cutting sites of T1 samples carrying either RSP-2C or RSP-2D constructs. The promoter sequence contains cis-acting elements that may act as negative regulators and be responsible for root specificity. The results further indicated that the 5' UTR and ATATT sequences are essential for strong promoter activity. This study highlights the potential of RSP-2D promoter as a tool for modifying root traits through genetic engineering.

Molecular Cloning and Functional Analysis of ScHAK10 Gene Promoter from Sugarcane (Saccharum officinarum L.)

Molecular Cloning and Functional Analysis of ScHAK10 Gene Promoter from Sugarcane (Saccharum officinarum L.)

Revisiting ameloblastin; addressing the EMT-ECM axis above and beyond oral biology.

Ameloblastin (AMBN) is best characterized for its role in dental enamel formation, regulating cell differentiation and mineralization, and cell matrix adhesion. However, AMBN has also been detected in mesenchymal stem cells in addition to bone, blood, and adipose tissue. Using immunofluorescence in a pilot scheme, we identified that AMBN is expressed in different parts of the gastrointestinal (GI) tract. AMBN mRNA and protein detection in several tissues along the length of the GI tract suggests a role for AMBN in the structure and tissue integrity of the extracellular matrix (ECM). Intracellular AMBN expression in subsets of cells indicates a potential alternative role in signaling processes. Of note, our previous functional AMBN promoter analyses had shown that it contains epithelial-mesenchymal transition (EMT) regulatory elements. ΑΜΒΝ is herein presented as a paradigm shift of the possible associations and the spatiotemporal regulation of the ECM regulating the EMT and vice versa, using the example of AMBN expression beyond oral biology.

Functional analysis of selenok, selenot and selenop promoters and their regulation by selenium in yellow catfish Pelteobagrus fulvidraco

The selenok, selenot and selenop are three key selenoproteins involved in stress response. Our study, using the yellow catfish Pelteobagrus fulvidraco as the experimental animal, obtained the 1993-bp, 2000-bp and 1959-bp sequences of selenok, selenot and selenop promoters, respectively, and predicted the binding sites of several transcriptional factors on their promoters, such as Forkhead box O 4 (FoxO4), activating transcription factor 4 (ATF4), Kruppel-like factor 4 (KLF4) and nuclear factor erythroid 2-related factor 2 (NRF2). Selenium (Se) increased the activities of the selenok, selenot and selenop promoters. FoxO4 and Nrf2 can directly bind with selenok promoter and controlled selenok promoter activities positively; KLF4 and Nrf2 can directly bind with selenot promoter and controlled selenot promoter activities positively; FoxO4 and ATF4 can directly bind to selenop promoter and regulated selenop promoter activities positively. Se promoted FoxO4 and Nrf2 binding to selenok promoter, KLF4 and Nrf2 binding to selenot promoter, and FoxO4 and ATF4 binding to selenop promoter. Thus, we provide the first evidence for FoxO4 and Nrf2 bindnig elements in selenok promoter, KLF4 and Nrf2 binding elements in selenot promoter, and FoxO4 and ATF4 binding elements in selenop promoter, and offer novel insight into regulatory mechanism of these selenoproteins induced by Se.

Efficient PEG-mediated transformation of oil palm mesophyll protoplasts and its application in functional analysis of oil palm promoters

Efficient PEG-mediated transformation of oil palm mesophyll protoplasts and its application in functional analysis of oil palm promoters

Serotype conversion gene rfbT is directly regulated by histone-like nucleoid structuring protein (H-NS) in V. cholerae O1.

Vibrio cholerae serogroup O1 (V. cholerae O1) is closely associated with cholera epidemics and has two main immunologically distinguishable serotypes, Ogawa and Inaba. Isolates serotype as Ogawa if the O-antigen polysaccharide (O-PS) is methylated or as Inaba if the O-PS is not methylated. This methylation is mediated by a methyltransferase encoded by the rfbT gene, and the mutation and low expression of rfbT results in serotype switch from Ogawa to Inaba. Previously, we have shown that cAMP receptor protein (CRP) activates rfbT. In this study, we demonstrated that histone-like nucleoid structuring protein (H-NS) is directly involved in the transcriptional repression of rfbT. This finding is supported by the analyses of rfbT mRNA level, rfbT-lux reporter fusions, electrophoretic mobility shift assay (EMSA), and DNase I footprinting assay. The rfbT mRNA abundances were significantly increased by deleting hns rather than fis which also preferentially associates with AT-rich sequences. A single-copy chromosomal complement of hns partly restored the down-regulation of rfbT. Analysis of rfbT-lux reporter fusions validated the transcriptional repression of hns. Subsequent EMSA and DNase I footprinting assay confirmed the direct binding of H-NS to rfbT promoter and mapped the exact binding site which was further verified by site-directed mutagenesis and promoter functional analysis. Furthermore, we found that in hns deletion mutant, CRP is no longer required for transcriptionally activating rfbT, suggesting that CRP functions as a dedicated transcription factor to relieve H-NS repression at rfbT. Together, this study expanded our understanding of the genetic regulatory mechanism of serotype conversion by global regulators in V. cholerae O1.

Transcriptional Regulation of zma-MIR528a by Action of Nitrate and Auxin in Maize.

In recent years, miR528, a monocot-specific miRNA, has been assigned multifaceted roles during development and stress response in several plant species. However, the transcription regulation and the molecular mechanisms controlling MIR528 expression in maize are still poorly explored. Here we analyzed the zma-MIR528a promoter region and found conserved transcription factor binding sites related to diverse signaling pathways, including the nitrate (TGA1/4) and auxin (AuxRE) response networks. Accumulation of both pre-miR528a and mature miR528 was up-regulated by exogenous nitrate and auxin treatments during imbibition, germination, and maize seedling establishment. Functional promoter analyses demonstrated that TGA1/4 and AuxRE sites are required for transcriptional induction by both stimuli. Overall, our findings of the nitrogen- and auxin-induced zma-MIR528a expression through cis-regulatory elements in its promoter contribute to the knowledge of miR528 regulome.

A 35-bp Conserved Region Is Crucial for Insl3 Promoter Activity in Mouse MA-10 Leydig Cells

The peptide hormone insulin-like 3 (INSL3) is produced almost exclusively by Leydig cells of the male gonad. INSL3 has several functions such as fetal testis descent and bone metabolism in adults. Insl3 gene expression in Leydig cells is not hormonally regulated but rather is constitutively expressed. The regulatory region of the Insl3 gene has been described in various species; moreover, functional studies have revealed that the Insl3 promoter is regulated by various transcription factors that include the nuclear receptors AR, NUR77, COUP-TFII, LRH1, and SF1, as well as the Krüppel-like factor KLF6. However, these transcription factors are also found in several tissues that do not express Insl3, indicating that other, yet unidentified factors, must be involved to drive Insl3 expression specifically in Leydig cells. Through a fine functional promoter analysis, we have identified a 35-bp region that is responsible for conferring 70% of the activity of the mouse Insl3 promoter in Leydig cells. All tri- and dinucleotide mutations introduced dramatically reduced Insl3 promoter activity, indicating that the entire 35-bp sequence is required. Nuclear proteins from MA-10 Leydig cells bound specifically to the 35-bp region. The 35-bp sequence contains GC- and GA-rich motifs as well as potential binding elements for members of the CREB, C/EBP, AP1, AP2, and NF-κB families. The Insl3 promoter was indeed activated 2-fold by NF-κB p50 but not by other transcription factors tested. These results help to further define the regulation of Insl3 gene transcription in Leydig cells.

Genomic distribution and context dependent functionality of novel WRKY transcription factor binding sites

BackgroundThe WT-boxes NGACTTTN are novel microbe-associated molecular pattern (MAMP)-responsive cis-regulatory sequences. Many of them are uncommon WRKY transcription factor (TF) binding sites.ResultsTo understand their functional relevance, a genomic distribution analysis of the 16 possible WT-boxes and a functional analysis of a WT-box rich promoter was done. The genomic distribution analysis shows an enrichment of specific WT-boxes within 500 bp upstream of all Arabidopsis thaliana genes. Those that harbour a T 5′ to the core sequence GACTTT can also be part of the classic WRKY binding site the W-box TTGACT/C. The MAMP-responsive gene ATEP3, a class IV chitinase, harbours seven WT-boxes within its 1000 bp upstream region. In the context of synthetic promoters, the four proximal WT-boxes confer MAMP responsivity while the three WT-boxes further upstream have no effect. Rendering the nucleotides adjacent and in the vicinity of the WT-box core sequence reveals their functional importance for gene expression. A 158 bp long ATEP3 minimal promoter harbouring the two WT-boxes CGACTTTT, confers WT-box-dependent basal and MAMP-responsive reporter gene expression. The ATEP3 gene is a proposed target of WRKY50 and WRKY70. WRKY50 negatively regulates MAMP responsivity of the two WT-boxes CGACTTTT, while WRKY70 activates gene expression in a WT-box dependent manner. Both WRKY factors bind directly to the WT-box CGACTTTT.ConclusionIn summary, WT-boxes are enriched in promoter regions and comprise novel and uncommon WRKY binding sites required for basal and MAMP-induced gene expression. WT-boxes not being part of a W-box may be a missing link for WRKY target gene prediction when these genes do not harbour a W-box.

Functional analysis of soybean cyst nematode-inducible synthetic promoters and their regulation by biotic and abiotic stimuli in transgenic soybean (Glycine max).

We previously identified cis-regulatory motifs in the soybean (Glycine max) genome during interaction between soybean and soybean cyst nematode (SCN), Heterodera glycines. The regulatory motifs were used to develop synthetic promoters, and their inducibility in response to SCN infection was shown in transgenic soybean hairy roots. Here, we studied the functionality of two SCN-inducible synthetic promoters; 4 × M1.1 (TAAAATAAAGTTCTTTAATT) and 4 × M2.3 (ATATAATTAAGT) each fused to the −46 CaMV35S core sequence in transgenic soybean. Histochemical GUS analyses of transgenic soybean plants containing the individual synthetic promoter::GUS construct revealed that under unstressed condition, no GUS activity is present in leaves and roots. While upon nematode infection, the synthetic promoters direct GUS expression to roots predominantly in the nematode feeding structures induced by the SCN and by the root-knot nematode (RKN), Meloidogyne incognita. There were no differences in GUS activity in leaves between nematode-infected and non-infected plants. Furthermore, we examined the specificity of the synthetic promoters in response to various biotic (insect: fall armyworm, Spodoptera frugiperda; and bacteria: Pseudomonas syringe pv. glycinea, P. syringe pv. tomato, and P. marginalis) stresses. Additionally, we examined the specificity to various abiotic (dehydration, salt, cold, wounding) as well as to the signal molecules salicylic acid (SA), methyl jasmonate (MeJA), and abscisic acid (ABA) in the transgenic plants. Our wide-range analyses provide insights into the potential applications of synthetic promoter engineering for conditional expression of transgenes leading to transgenic crop development for resistance improvement in plant.

The functional verification and analysis of Fugu promoter of cardiac gene tnni1a in zebrafish.

Troponin I type 1b (Tnni1b) is thought to be a novel isoform that is expressed only in the zebrafish heart. Knocking down of tnni1b can lead to cardiac defects in zebrafish. Although both the zebrafish tnni1b and human troponin I1 (TNNI1) genes are thought to be closely associated with fatal cardiac development, the regulatory molecular mechanisms of these genes are poorly understood. Analyzing the functionally conserved sequence, especially in the noncoding regulatory region involved in gene expression, clarified these mechanisms. In this study, we isolated a 3kb fragment upstream of Fugu tnni1a that can regulate green fluorescence protein (GFP) expression in a heart-specific manner, similar to the pattern of zebrafish homologue expression. Three evolutionarily conserved regions (ECRs) in the 5'-flanking sequence of Fugu tnni1a were identified by sequence alignment. Deletion analysis led to the identification of ECR2 as a core sequence that affects the heart-specific expression function of the Fugu tnni1a promoter. Interestingly, both the Fugu tnni1a promoter and ECR2 sequence were functionally conserved in zebrafish, although they shared no sequence similarity. Together, the findings of our study provided further evidence for the important role of tnni1a homologous in cardiac development and demonstrated that two functionally conserved sequences in the zebrafish and Fugu genomes may be ECRs, despite their lack of similarity.

Structural and Functional Analysis of SHP Promoter and Its Transcriptional Response to FXR in Zn-Induced Changes to Lipid Metabolism.

Zinc alleviates hepatic lipid deposition, but the transcriptional regulatory mechanisms are still unclear. In this study, we characterized the promoter of an SHP (short heterodimer partner) in a teleost Pelteobagrus fulvidraco. The binding sites of an FXR (farnesoid X receptor) were predicted by the SHP promoter, indicating that the FXR mediated its transcriptional activity. The site mutagenesis and the EMSA (electrophoretic mobility shift assay) found that the −375/−384 bp FXR site on the SHP promoter was the functional binding locus responsible for the Zn-induced transcriptional activation. A further study of yellow catfish hepatocytes suggested that the activation of the FXR/SHP is responsible for the effect of Zn on the decreasing lipid content. Thus, this study provides direct evidence of the interaction between the FXR and SHP promoter in fish, and accordingly elucidates the potential transcriptional mechanism by which Zn reduces hepatic lipid accumulation.

The Transcription Factor Roc1 Is a Key Regulator of Cellulose Degradation in the Wood-Decaying Mushroom Schizophyllum commune.

ABSTRACTWood-decaying fungi of the class Agaricomycetes (phylum Basidiomycota) are saprotrophs that break down lignocellulose and play an important role in nutrient recycling. They secrete a wide range of extracellular plant cell wall degrading enzymes that break down cellulose, hemicellulose, and lignin, the main building blocks of plant biomass. Although the production of these enzymes is regulated mainly at the transcriptional level, no activating regulators have been identified in any wood-decaying fungus in the class Agaricomycetes. We studied the regulation of cellulase expression in the wood-decaying fungus Schizophyllum commune. Comparative genomics and transcriptomics on two wild isolates revealed a Zn2Cys6-type transcription factor gene (roc1) that was highly upregulated during growth on cellulose, compared to glucose. It is only conserved in the class Agaricomycetes. A roc1 knockout strain showed an inability to grow on medium with cellulose as sole carbon source, and growth on cellobiose and xylan (other components of wood) was inhibited. Growth on non-wood-related carbon sources was not inhibited. Cellulase gene expression and enzyme activity were reduced in the Δroc1 strain. ChIP-Seq identified 1474 binding sites of the Roc1 transcription factor. Promoters of genes involved in lignocellulose degradation were enriched with these binding sites, especially those of LPMO (lytic polysaccharide monooxygenase) CAZymes, indicating that Roc1 directly regulates these genes. A conserved motif was identified as the binding site of Roc1, which was confirmed by a functional promoter analysis. Together, Roc1 is a key regulator of cellulose degradation and the first identified in wood-decaying fungi in the phylum Basidiomycota.

Cloning and Functional Analysis of the Soybean GmRIQ2 Promoter

The RIQ gene can optimize the structure of light-harvesting complex II by regulating the degree of granum stacking, and ultimately participates in plant light stress responses. The GmRIQ2 gene contributes to plant photoprotection and may be involved in negative regulation of yield. To understand the regulatory mechanisms of GmRIQ2 expression, we isolated the GmRIQ2 promoter (PGmRIQ2) from the KenFeng 16 soybean genome. Sequence analysis showed that several cis-acting elements were involved in hormone responsiveness, seed-specific regulation, anaerobic induction and light responsiveness. PGmRIQ2 was expressed in soybean roots. GUS activity was detected in Arabidopsis thaliana rosette leaves, stems and roots, indicating that PGmRIQ2 tended to drive expression in rosette leaf vascular tissue and had spatiotemporal expression characteristics at the early growth stage. Three promoter deletion fragments of 450 bp, 284 bp and 194 bp were obtained by 5′ deletion. These three fragments all drove GUS gene expression in Arabidopsis thaliana rosette leaves, stems and roots. GUS gene expression decreased with deletion fragment truncation. In addition, the PGmRIQ2 auxin (IAA), abscisic acid (ABA) and methyl jasmonate (MeJA) response elements were located at base pairs −1661~−450, −450~−284 and −284~−194, respectively, and the promoter was induced by IAA, ABA, MeJA and light.

The variation in promoter sequences of the Akt3 gene between cow and buffalo revealed different responses against mastitis

BackgroundSerine/threonine kinase 3 (AKT3) is a protein-coding gene that is associated with several cattle immune diseases including different tumors and cancers. The objective of this study was to investigate the differences in structures and functions of AKT3 of cow and buffalo cattle. MethodsThe sequence differences of gene-coding sequence (CDS) and core promoter region of AKT3 in cow and buffalo were analyzed by using bioinformatics tools and PCR sequencing. Also, the functional analysis of promoter regulating gene expression by RT-PCR was performed using 500 Holstein cows and buffalos. And, evaluation of AKT3 inflammatory response to the lipopolysaccharide (LPS)-induced mastitis was performed between both species. ResultsThe results revealed the variation in 6 exons out of 13 exons of the two species of CDS. Also, 4 different regions in 3-kb promoters of the AKT3 gene were significantly different between cow and buffalo species, in which cow’s AKT3 promoter sequence region was started from − 371 to − 1247, while in buffalo, the sequence was started from − 371 to − 969 of the promoter crucial region. Thus, the promoter was overexpressed in cows compared to buffaloes. As a result, significant differences (P < 0.05) between the two species in the AKT3 gene expression level related to the LPS stimulation in their mammary epithelial cell line. ConclusionsThis study emphasized the great importance of the structural differences of AKT3 between the animal species on their different responses against immune diseases like mastitis.

The durum wheat NAC transcription factor TtNAC2A enhances drought stress tolerance in Arabidopsis

Plant specific NAC transcription factors play diverse roles in plant development and stress responses. However, their biological roles in crop plants such as wheat remain poorly described. Here, we report the isolation and functional characterization of novel durum wheat TtNAC2A gene which acts as a transcription activator in yeast. Expression profiling analyses revealed that TtNAC2A gene is expressed in several wheat tissues and at different stages of seed development. Moreover, TtNAC2A was up-regulated in leaves and roots after exposure to salt, PEG and exogenous abscisic acid treatments, and this up-regulation was confirmed by functional promoter analysis in Arabidopsis. Furthermore, transgenic Arabidopsis plants overexpressing TtNAC2A showed enhanced drought tolerance and hypersensitivity to ABA. This phentotype was accompanied by a greater water retention capacity, attenuated oxidative stress, lower electrolyte leakage and higher proline contents, compared to wild type plants. The TtNAC2A-mediated drought tolerance also corroborated with an activation of a subset of stress-responsive genes, including AtRD22, AtRD29A and AtRD29B. Thus, TtNAC2A functions as a positive regulator of drought stress tolerance and constitutes an attractive candidate for stress breading in wheat crops.

Transcriptome-wide identification of squalene epoxidase genes from Glycyrrhiza glabra L.: expression analysis and heterologous expression of GgSQE1 suggest important role in terpenoid biosynthesis.

Squalene epoxidase (SQE) is a crucial regulatory enzyme for the biosynthesis of several important classes of compounds including sterols and triterpenoids. The present paper identified and characterised five SQE genes (GgSQE1 to GgSQE5) from Glycyrrhiza glabra through transcriptome data mining and homology-based cloning, for the first time. The phylogenetic analysis implied their functional divergence. The ORF corresponding to one of the five SQEs, namely, GgSQE1, was cloned and studied for its function in a heterologous system, following transient and stable expressions. The transient expression followed by GgSQE1 encoding protein purification suggested approximately 58.0-kDa protein following the predicted molecular mass of the deduced protein. The gene expression profiling based on qRT-PCR indicated its highest expression (6.4-folds) in the 10-month-old roots. Furthermore, ABA (12.4-folds) and GA3 (2.47) treatments upregulated the expression of GgSQE1 in the shoots after 10 and 12 hours, respectively, which was also reflected in glycyrrhizin accumulation. The inductive effects of ABA and GA3 over GgSQE1 expression were also confirmed through functional analysis of GgSQE1 promoters using GUS fusion construct. Stable constitutive expression of GgSQE1 in Nicotiana tabacum modulated the sterol contents. The study could pave the way for understanding the metabolic flux regulation concerning biosynthesis of related sterols and triterpenoids.Supplementary InformationThe online version contains supplementary material available at 10.1007/s00709-021-01616-2.

Development of a Virus-Based Reporter System for Functional Analysis of Plant rRNA Gene Promoter.

Reporter gene-based expression systems have been intensively used in plants for monitoring the activity of gene promoters. However, rRNA transcripts are unable to efficiently express a reporter gene due to a lack of a 5' cap. Because of this obstacle, plant rRNA gene promoters are less well characterized to this day. We developed a virus-based reporter system to characterize the Nicotiana benthamiana rRNA (NbrRNA) gene promoter. The system utilizes the cap-independent translation strategy of viral genomic mRNA and uses the virus-expressed green fluorescent protein (GFP) as an indicator of the rRNA gene promoter activity in virus-infected plants. Based on the reporter system, some characteristics of the N. benthamiana rRNA gene promoter were revealed. The results showed that the strength of the NbrRNA gene promoter was lower than that of the cauliflower mosaic virus (CaMV) 35S promoter, a well-characterized polymerase II promoter. The sequences between −77 and +42 are sufficient for the NbrRNA gene promoter-mediated transcription and the NbrRNA gene promoter may lack the functional upstream control element (UCE). Interestingly, NbrRNA gene promoter activity was increased when the 35S enhancer was introduced. An intron-excision mediated assay revealed that the NbrRNA gene promoter can be inefficiently used by RNA polymerase II in N. benthamiana cells. This virus-based reporter system is easier to operate and more convenient when compared with the previously Pol I promoter assays. And it offers a promising solution to analyzing the functional architecture of plant rRNA gene promoter.

Functional analysis of Medicago-derived pathogen-induced gene promoters for usage in transgenic alfalfa

Three gene promoters from the model legume species Medicago truncatula and Medicago sativa (alfalfa) pathogenesis-related (PR) proteins (MtPR5, MtPR10, and MsPR10) were isolated and investigated using in silico and in situ approaches. For the functional analysis of these promoters, plant transformation vectors linking promoter sequences with the β-glucuronidase (GUS) reporter gene were constructed and utilized to generate transgenic alfalfa. Histochemical GUS staining established that the PR5 and both PR10 promoters were functional in alfalfa and induce GUS expression primarily in the root tissue. When transgenic alfalfa leaves were inoculated with a diverse set of alfalfa pathogens, either Phoma medicaginis, Colletotrichum trifolii, or Pseudomonas syringae pv. syringae, the promoters were responsive to induction by both bacterial and fungal pathogens. Gene expression analysis also indicated that all three PR promoters were pathogen-induced and upregulate transgene expression. Additionally, several putative transcription regulator elements (REs) responsible for the observed pathogen-induced promoter activity were predicted in each of the promoter sequences. These characterized Medicago PR promoters may be a unique and valuable tool for pathogen-induced transgenic expression of antimicrobial proteins or other genes enhancing disease resistance in alfalfa.