Viroids, among them the Australian grapevine viroid (AGVd) from the genus Apscaviroid in the family Pospiviroidae, are the most common and widely distributed infectious agents in grapevine (Vitis spp.). Grapevine was introduced in Thailand in 1956, and since then many varieties have been grown, for table grape as well as wine production. In 2015 and 2016, surveys were conducted to check for the presence of viroids in Thai vineyards. Grapevine leaves were collected from commercial vineyards in the Saraburi and Ratchaburi provinces of Thailand. The cultivars ‘White Malaka’, ‘Flame Seedless’, ‘Loose Perlette’, and ‘Black Opal’ were tested. The collected samples showed virus-like symptoms like yellowing, leaf reduction, or mosaic. Total RNAs were extracted using the Genup Plant RNA kit (BiotechRabbit, Germany). Reverse transcription polymerase chain reaction (PCR) for the detection of the AGVd was performed using the primer combinations AGV-mF GTCCTCAGGAGAGCACCGG and AGVd-mR GAAAACTGGTTGGGACCGCTG (195 bp, Hajizadeh et al. 2012), and TGGGCACCAACTAG(A/T)GGTTC and GGGCCTCCAAACAGGG(G/A)G (position 1 to 20 and 352 to 370, respectively, on reference sequence KY404213) for the full-length genome. The resulting amplified fragments were cloned into the plasmid pJET1.2 and sequenced (GenBank MH521286 to MH521288). BLASTn analysis of the AGVd full-length sequences of the different Thai isolates of AGVd revealed 96 to 100% identity among themselves and 94 to 100% identity with the corresponding AGVd sequences of isolates from other countries including, among others, Australia, the United States, Tunisia, China, Iran, Italy (Gambino et al. 2014; Jiang et al. 2009; Vargas-Asencio et al. 2017), Chile (GenBank KF007274), and India (GenBank KJ019304). The AGVd was found in 11 out of 41 samples from three out of eight locations. Among the four grapevine varieties tested, it was only found in White Malaka. AGVd was always found in conjunction with other viroids (Grapevine yellow speckle viroid 1 and 2, Hop stunt viroid). Northern blot analysis, with 50 μg of total RNAs being separated in a 1% formaldehyde-agarose gel, blotted, and hybridized with the purified PCR-amplified fragment corresponding to the AGVd and labeled with [α-³²P]dCTP (3,000 Ci/mmol, Perkin-Elmer), confirmed these results, the recorded signals being at the expected size for the linear form of the viroid. To our knowledge, this is the first report of the AGVd in Thailand. The variability found between the different Thai isolates, which were collected from different farms, suggests different sources of introduction of the infected grapevine material.