FGG Gene Research Articles

Single nucleotide polymorphisms and the risk of venous thrombosis: results from a Danish case‐cohort study

A number of single nucleotide polymorphisms (SNP) have been linked to higher risk of venous thromboembolism (VTE). We investigated the VTE risk associated with SNPs in the GP6 (rs1613662), SERPINC1 (rs2227589), F11 (rs2036914 and rs2289252), FGG (rs2066865), and F12 (rs1801020) genes. In F11, the CC genotype for rs2036914 and the CT and TT genotypes for rs2289252 were associated with a significantly higher VTE risk. A trend toward a thrombogenic effect was observed for the risk alleles of the GP6 and FGG SNPs. Risk estimates were unaffected by adjustments for blood type and F5 rs6025 (Factor V Leiden) mutation.

Combined congenital dysfibrinogenemia and factor VII deficiency from mutations in the FGB and F7 genes

Dysfibrinogenemia and factor VII (FVII) deficiency are rare congenital coagulopathies. In this report, the authors describe a man with both defects confirmed by molecular genetic tests. The patient was a 51-year-old man referred for prolonged prothrombin time (PT) that had been accidentally detected on preoperative screening. He had no history of bleeding tendency even on occasions of surgery. Routine coagulation studies revealed prolonged PT (1.53 INR) and thrombin time (42.2 s), and decreased fibrinogen level (57 mg/dl) and FVII activity (44%). Direct sequencing analyses were performed on FGA, FGB, and FGG genes to confirm dysfibrinogenemia and on the F7 gene to confirm FVII deficiency. As a result, the patient was shown to be heterozygous for a point mutation in exon 8 of the FGB gene (c.1475A > G, p.*492Trpext*12; Fibrinogen Magdeburg II) and for a missense mutation in exon 6 of the F7 gene (c.466G > A, p.Gly156Ser). To our knowledge, this is the first report on a case of combined dysfibrinogenemia and FVII deficiency confirmed by molecular genetic tests.

Fibrinogen Šumperk II: Dysfibrinogenemia in an individual with two coding mutations

Fibrinogen—a 340-kDa glycoprotein—plays a crucial role in blood coagulation, platelet aggregation, wound healing, and other physiological processes. A mutation in fibrinogen may lead to congenital dysfibrinogenemia,a rare disease characterized by the functional deficiency of fibrinogen. About 580 cases of abnormal fibrinogens have been reported worldwide; thereof 335 cases in the fibrinogen Aa chain[1]. To our knowledge, only five cases of abnormal fibrinogens with two mutations [2–6] and one case of two different mutations in the same family [7] have been described earlier. A 52-year-old female was examined for bleeding. Routine hemostasis screening resulted in a diagnosis of dysfibrinogenemia. Functional testing revealed prolonged fibrin polymerization, prolonged lysis of the clot, abnormal fibrin morphology,and fibrinopeptides release. Genetic analysis showed two heterozygous nonsense mutations—previously described mutation AaGly13Glu and a novel mutation Aa Ser314Cys. The mutation Aa Gly13-Glu was found in her brother and niece, but there was no evidence in either of the mutation Aa Ser314Cys. While mutation Aa Gly13Glu is responsible for abnormal fibrinopeptide release and prolonged thrombin time, the novel mutation Aa Ser314Cys seems to affect fibrin morphology and fibrinolysis.

A genetic instrument for Mendelian randomization of fibrinogen

Mendelian randomization studies on fibrinogen commonly use a single genetic variant as an instrument, but this may explain only a small proportion of the total phenotypic variance. We examined the contribution of multiple common single nucleotide polymorphisms (SNPs) and haplotypes in the entire fibrinogen gene cluster to plasma fibrinogen levels in two prospective cohorts, for use as instruments in future Mendelian randomization studies. Genotypes for 20 SNPs were determined in 2,778 middle-age (49-64 years) men from the Second-Northwick-Park-Heart Study (NPHS-II). These were replicated in 3,705 men from the Whitehall-II study (WH-II). Plasma fibrinogen levels were determined six times in NPHS-II and three times in WH-II. The minor alleles of four SNPs from the FGB gene, two from the FGA gene, and one from the FGG gene were associated with higher plasma fibrinogen levels. SNP rs1800790 (-455G>A) commonly used in Mendelian randomization studies was associated with R2=1.22% of the covariate adjusted residual variance in fibrinogen level. A variable selection procedure identified one additional SNP: rs2070011 (FGA) altogether explaining R2=1.45% of the residual variance in fibrinogen level. Using these SNPs no evidence for causality between the fibrinogen levels and coronary heart diseases was found in instrumental variables analysis. In the replication cohort, WH-II, the effects of the two SNPs on fibrinogen levels were consistent with the NPHS-II results. There is statistical evidence for several functional sites in the fibrinogen gene cluster that determine an individual's plasma fibrinogen levels. Thus, a combination of several SNPs will provide a stronger instrument for fibrinogen Mendelian randomization studies.

A novel regulatory element between the human FGA and FGG genes

High circulating fibrinogen levels correlate with cardiovascular disease (CVD) risk. Fibrinogen levels vary between people and also change in response to physiological and environmental stimuli. A modest proportion of the variation in fibrinogen levels can be explained by genotype, inferring that variation in genomic sequences that regulate the fibrinogen genes ( FGA , FGB and FGG ) may affect hepatic fibrinogen production and perhaps CVD risk. We previously identified a conserved liver enhancer in the fibrinogen gene cluster (CNC12), between FGB and FGA . Genome-wide Chromatin immunoprecipitation-sequencing (ChIP-seq) demonstrated that transcription factors which bind fibrinogen gene promoters also interact with CNC12, as well as two potential fibrinogen enhancers (PFE), between FGA and FGG . Here we show that one of the PFE sequences has potent hepatocyte enhancer activity. Using a luciferase reporter gene system, we found that PFE2 enhances minimal promoter- and FGA promoter-driven gene expression in hepatoma cells, regardless of its orientation with respect to the promoters. A region within PFE2 bears a short series of conserved nucleotides which maintain enhancer activity without flanking sequence. We also demonstrate that PFE2 is a liver enhancer in vivo, driving enhanced green fluorescent protein expression in transgenic zebrafish larval livers. Our study shows that combining public domain ChIP-seq data with in vitro and in vivo functional tests can identify novel fibrinogen gene cluster regulatory sequences. Variation in such elements could affect fibrinogen production and influence CVD risk.

Developmental expression and organisation of fibrinogen genes in the zebrafish

The zebrafish is a model organism for studying vertebrate development and many human diseases. Orthologues of the majority of human coagulation factors are present in zebrafish, including fibrinogen. As a first step towards using zebrafish to model human fibrinogen disorders, we cloned the zebrafish fibrinogen cDNAs and made in situ hybridisations and quantitative reverse transcription-polymerase chain reactions (qRT-PCR) to detect zebrafish fibrinogen mRNAs. Prior to liver development or blood flow we detected zebrafish fibrinogen expression in the embryonic yolk syncytial layer and then in the early cells of the developing liver. While human fibrinogen is encoded by a three-gene, 50 kilobase (kb) cluster on chromosome 4 ( FGB-FGA-FGG ), recent genome assemblies showed that the zebrafish fgg gene appears distanced from fga and fgb , which we confirmed by in situ hybridisation. The zebrafish fibrinogen Bβ and γ protein chains are conserved at over 50% of amino acid positions, compared to the human polypeptides. The zebrafish Aα chain is less conserved and its C-terminal region is nearly 200 amino acids shorter than human Aα. We generated transgenic zebrafish which express a green fluorescent protein reporter gene under the control of a 1.6 kb regulatory region from zebrafish fgg . Transgenic embryos showed strong fluorescence in the developing liver, mimicking endogenous fibrinogen expression. This regulatory sequence can now be used for overexpression of transgenes in zebrafish hepatocytes. Our study is a proof-of-concept step towards using zebrafish to model human disease linked to fibrinogen gene mutations.

Phenotype and Genotype of 22 Subjects with Heritable Dysfibrinogenaemia

Abstract 1212▪▪This icon denotes a clinically relevant abstractThe heritable dysfibrinogenaemias (HD) are a heterogenous group of qualitative disorders of fibrinogen in which there is abnormal fibrin clot formation. Affected individuals usually display prolonged thrombin (TCT) and reptilase clotting times (RCT) and reduced plasma fibrinogen activity. The plasma fibrinogen concentration is normal or is reduced less than the fibrinogen activity. HD is associated with pathogenic mutations in FGA, FGB or FGG genes that encode the fibrinogen Aα, Bβ and g chains respectively. However, most clinical descriptions of HD comprise single case reports and the range of phenotype and genotype in the wider population is difficult to estimate. In order to improve understanding of this disorder, we now report a cross-sectional survey of 22 subjects with HD identified at 2 UK regional Haemostasis centres from 2001–11.We recruited index cases from our Haemostasis laboratory referral practice who satisfied all the following criteria- 1) prolonged TCT; 2) prolonged TCT with protamine (TCTP) and/or prolonged RCT; 3) reduced Clauss fibrinogen and 4) normal fibrinogen dry clot weight. Demographic and clinical characteristics were recorded using a standardised case report form. Genetic analysis was performed by Sanger sequencing of FGA exon 2, FGB exon 2 and FGG exon 8 which we identified as mutation hotspots from the fibrinogen mutation database (http://www.geht.org/databaseang/fibrinogen/). Phenotype and genotype was also determined in available first degree family members.We identified 16 index cases and 6 family members with HD (median age 41, range 12–78; 9 males). HD was identified in plasma submitted to our Haemostasis laboratories for the investigation of bleeding in 8/16 (50%) index cases, for stroke in 1/16 (6%) and for ‘routine coagulation screening' in 7/16 (44%). Mild mucocutaneous bleeding or menorrhagia was documented in the clinical records of 13/22 (59%) subjects and thrombotic stroke in 1/22 (5%). 8/22 (36%) subjects were asymptomatic.The prothrombin time (PT) was prolonged in 21/22 (95%) subjects (median 15.3 s; range 11.4–16.7; reference interval (RI) 9.6–11.6) but the activated partial thromboplastin time (aPTT) was prolonged in only 1/22 (5%; median 23.8 s; range 22.8–37.0, RI 24.0–32.0). The median TCT was 28.6 s (range 20.6–45.7; RI 13–19) and TCTP 31.9 s (n=11; range 20.0–35.5; RI 13–19). The median RCT was 37s (n=12; range 19–68; RI 15–19), Clauss fibrinogen 0.49 g/dL (range 0.29–1.3; RI 1.8–3.6) and dry clot weight 2.3 g/dL (range 1.9–4.2; RI 1.8–3.6). Heterozygous missense nucleotide variations were identified in the candidate exons of the fibrinogen genes in all 16/16 (100%) index cases and segregated with the HD phenotype in all available family members. These variations predicted aminoacid substitutions at the fibrinopeptide A cleavage site in the fibrinogen Aa chain in 10/16 (63%) index cases (FGA p.R35H (n=4); p.R35S (n=3); p.R35P (n=2) and p.G36S (n=1); numbered from RefSeq NP_000499.1) or at nearby residues (FGA p.V39D (n=1) and p.F27C (n=1)). FGG variations were identified in 3 index cases that predicted aminoacid substitutions in the fibrinogen g chain region necessary for D:D domain interactions during fibrin monomer assembly (FGG p.R301H (n=1), p.D342G (n=1) and p.A367T (n=1); RefSeq NP_000499.1). One subject harboured a FGB variation that predicted a p.R44C substitution (Refseq NP_005132.2) at the fibrinopeptide B cleavage site in the fibrinogen Bb chain. The FGA p.R35S, p.R35H, FGB p.R44C and FGG p.R301H and p.A367T substitutions have been associated previously with HD.We show that the HD laboratory phenotype is rare and was frequently identified in subjects with mild bleeding. However, HD was also commonly asymptomatic and did not segregate with bleeding symptoms within affected families suggesting that the HD variants identified in this study do not confer significant bleeding risk. The prevalence of mild bleeding in some study subjects may reflect recruitment bias. We also show that HD is strongly associated with nucleotide variations in the FGA, FGB or FGG genes. All the observed nucleotide variations have been previously associated with HD and/or predict aminoacid substitutions in critical regions for normal fibrin polymerization. Defective fibrin polymerization may affect endpoint determination in some automated clotting assays and is likely to account for the consistent finding of prolonged PT in the study subjects. Disclosures:No relevant conflicts of interest to declare.

The fibrinogen gamma 10034C > T polymorphism is not associated with Peripheral Arterial Disease

Conversion of fibrinogen to fibrin plays an essential role in hemostasis and results in stabilization of the fibrin clot. Fibrinogen consists of three pairs of non-identical polypeptide chains, encoded by different genes (fibrinogen alpha [FGA], fibrinogen beta [FGB] and fibrinogen gamma [FGG]). A functional single nucleotide polymorphism (SNP) in the 3' untranslated region of the FGG gene (FGG 10034C > T, rs2066865) has been associated with deep venous thrombosis and myocardial infarction. Aim of the present study was to analyze the role of this polymorphism in peripheral arterial disease (PAD). The study was designed as case-control study including 891 patients with documented PAD and 777 control subjects. FGG genotypes were determined by exonuclease (TaqMan) assays. FGG genotype frequencies were not significantly different between PAD patients (CC: 57.3%, CT: 36.7%, TT: 5.8%) and control subjects (CC: 60.9%, CT: 33.5%, TT 5.6%; p = 0.35). In a multivariate logistic regression analysis including age, sex, smoking, diabetes, arterial hypertension and hypercholesterolemia, the FGG 10034 T variant was not significantly associated with the presence of PAD (Odds ratio 1.07, 95% confidence interval 0.84 - 1.37; p = 0.60). The FGG 10034C > T polymorphism was furthermore not associated with age at onset of PAD. We conclude that the thrombophilic FGG 10034 T gene variant does not contribute to the genetic susceptibility to PAD.

In vitro transcription of compound heterozygous hypofibrinogenemia Matsumoto IX; first identification of FGB IVS6 deletion of 4 nucleotides and FGG IVS3-2A>G causing abnormal RNA splicing

We reported a case of hypofibrinogenemia Matsumoto IX (M IX) caused by a novel compound heterozygous mutation involving an FGB IVS6 deletion of 4 nucleotides (Delta4b) (three T, one G; between FGB IVS6-10 and -16) and FGG IVS3-2A/G, which are both identified for the first time. To examine the transcription of mRNA from the M IX gene, we cloned the wild-type and mutant genes into expression vectors. The vectors were transfected into CHO cells and transiently produced wild-type, Bbeta- or gamma-mRNA in the cells. The mRNAs amplified with RT-PCR were analyzed by agarose gel electrophoresis and nucleotide sequencing. The RT-PCR product from FGB IVS6Delta4b showed aberrant mRNA that included both introns 6 and 7, and that from FGG IVS3-2G showed two aberrant mRNAs, a major one including intron 3 and a minor in which intron 3 was spliced by a cryptic splice site in exon 4. We speculated that the aberrant mRNAs are degraded before translation into proteins, and/or translated variant chains are subjected to quality control and degraded in the cytoplasm. The reduced plasma fibrinogen level of the M IX patient was caused by abnormal RNA splicing of one or both of the FGB and FGG genes.

Identification of a Functional Interferon-Gamma Response Element in the Fibrinogen FGG Gene.

Abstract 3174Poster Board III-114Fibrinogen is the zymogen precursor to the main structural protein in blood coagulation, and is proteolytically activated during coagulation to form fibrin clots. Fibrinogen is an acute phase protein that is produced by the liver, and elevated fibrinogen levels are a known risk factor for cardiovascular disease, including heart attack and stroke. Fibrinogen is synthesized from three separate genes, FGA, FGB, and FGG encoding the Aαa, Bβ, and γ chains, respectively. Several inflammatory cytokines, particularly interleukin-6 (IL-6), are known to up-regulate fibrinogen synthesis, while interleukin-1β, tumor necrosis factor-αa, and transforming growth factor-β are known to antagonize IL-6 stimulation of fibrinogen synthesis. Here we report that interferon-γ (IFN-γ), a cytokine that is highly expressed in atherosclerotic lesions, decreases the production of fibrinogen by two-fold over a 24 hour period in HepG2 hepatocellular carcinoma cells, both at the protein and mRNA level. In addition, IFN-γ antagonizes IL-6 up-regulation of fibrinogen production. Since IFN-γ is known to signal via the IFN-γ receptor through a STAT1-dependent pathway, we investigated the mechanism by which IFN-γ inhibits fibrinogen production. We identify a previously unknown IFN-γ activation sequence (GAS), AGGAGCTTACATAAAGGGACAA, within the promoter of the human γ chain gene FGG. This sequence is homologous to the known GAS consensus sequence TTNCNNNAA. Nuclear extracts from IFN-γ-stimulated HepG2 cells, but not from unstimulated HepG2 cells, form a complex with oligonucleotides containing this GAS sequence, as demonstrated by electrophoretic mobility shift assays. The formation of this complex is blocked by unlabeled competing oligonucleotides and by an antibody to phosphorylated STAT1. The involvement of pSTAT1 in this complex is consistent with the known role of pSTAT1 downstream of IFN-γ receptor signaling. In addition, IFN-γ stimulates STAT1 phosphorylation in a dose-dependent manner in HepG2 cells. Furthermore, using an FGG promoter construct fused to a luciferase reporter gene in transiently transfected HepG2 cells, we show that IFN-γ inhibits luciferase expression in a dose-dependent manner. Together, these data demonstrate that IFN-γ down-regulation of fibrinogen production occurs through a pSTAT1-mediated pathway. Since IFN-γ is known to demonstrate both pro and anti-atherogenic actions, this down-regulation of fibrinogen production may serve an anti-atherogenic function in vivo. DisclosuresNo relevant conflicts of interest to declare.

Fibrinogen Yecheon: Congenital Dysfibrinogenemia with Gamma Methionine-310 to Threonine Substitution

This case study reports a rare fibrinogen variant, γ Met310Thr mutation, for the first time in Korea. The case shows a point mutation from T to C in the 1,007th nucleotide of the FGG gene. This report describes a variant fibrinogen, hereinafter called "fibrinogen Yecheon", using the name after the town where the patient was living at the time of diagnosis. Fibrinogen Yecheon has a de novo heterozygous point mutation of FGG resulting in γ Met310Thr and subsequent extra N-glycosylation at γ Asn308. Extra N-glycosylated fibrinogen is considered a main inhibitor of normal fibrinogen activity.

Variation in fibrinogen FGG and FGA genes and risk of stroke

Haplotypes of the fibrinogen gamma and alpha (FGG and FGA) genes are associated with the structure of the fibrin network and may therefore influence the risk of stroke. We investigated the relationship between common variation in these genes with ischemic and haemorrhagic stroke. The study was based on 6,275 participants of the prospective population-based Rotterdam Study who at baseline (1990-1993) were aged 55 years or over, free from stroke, and had successful assessment of at least one FGG or FGA single nucleotide polymorphisms (SNP). Common haplotypes were estimated using seven tagging SNPs across a 30 kb region containing the FGG and FGA genes. Follow-up for incident stroke was complete until January 1, 2005. Associations between constructed haplotypes and risk of stroke were estimated with an age- and sex-adjusted logistic regression model. We observed 668 strokes, of which 393 were ischemic and 62 haemorrhagic, during a median follow-up time of 10.1 years. FGG + FGA haplotype 3 (H3) was associated with an increased risk of ischemic stroke (odds ratio [OR] 1.36, 95% confidence interval [CI] 1.09-1.69) and the risk estimate for hemorrhagic stroke was 0.71 (95% CI 0.46-1.09) compared to the most frequent H1. The FGG and FGA genes were not associated with stroke or its subtypes when analyzed separately. In conclusion, risk of ischemic stroke was higher in FGG + FGA H3 than in H1. The results suggested that an opposite association may exist for haemorrhagic stroke.

Haplotypes of the fibrinogen gene and cerebral small vessel disease: the Rotterdam scan study

Objective:Fibrinogen levels and fibrinogen clot structure have been implicated in the pathogenesis of vascular disease. We examined fibrinogen levels and variation in fibrinogen genes (fibrinogen γ (FGG), α (FGA) and...

Fibrinogen gene haplotypes in relation to risk of coronary events and coronary and extracoronary atherosclerosis: The Rotterdam Study

Fibrin network structure has been correlated with coronary disease. Fibrinogen gamma and alpha (FGG and FGA) gene haplotypes (chromosome 4q28) may be associated with fibrin network structure, and thereby with rigidity of the fibrin clot and sensitivity of the fibrin clot to the fibrinolytic system. Through these mechanisms they may influence risk of cardiovascular disease. We set out to investigate the relation between combined fibrinogen FGG and FGA gene haplotypes, representing the common variation of the fibrinogen FGG and FGA genes, coronary events and measures of coronary and extracoronary atherosclerosis. The study was embedded in the Rotterdam Study, a prospective population-based study among men and women aged >or=55 years. Common haplotypes were studied using seven tagging SNPs across a 30-kb region with the FGG and FGA genes. Incident coronary events were registered, and carotid intima-media thickness, carotid plaques, ankle-arm index, aortic calcification and coronary calcification were assessed. Seven haplotypes with frequencies >1% covered 97.5% of the genetic variation. In 5,667 participants without history of coronary heart disease (CHD), 733 CHD cases occurred during a median follow-up time of 11.9 years. Fibrinogen gene haplotypes were not associated with coronary events. Fibrinogen gene haplotypes did not show a consistent association with measures of coronary and extracoronary atherosclerosis. In conclusion, fibrinogen FGG and FGA gene haplotypes are not associated with coronary events, coronary atherosclerosis or extracoronary atherosclerosis. Confirmation of these findings by future population-based studies is warranted.

Novel fibrinogen mutation (γ 313 Ser→Asn) associated with hypofibrinogenemia in two unrelated families

Congenital hypofibrinogenemia is a rare disorder caused by a number of different mutations in the fibrinogen genes. The aim of the study was the elucidation of molecular defects in two unrelated families with hypofibrinogenemia. DNA samples from the patients were screened for mutations in the fibrinogen genes by direct sequencing of polymerase chain reaction-amplified gene segments. Isolated plasma fibrinogen was studied by sodium dodecyl sulfate electrophoresis and electrospray ionization mass spectrometry in order to detect variant polypeptides. Fibrin polymerization was analyzed both in plasma and using purified fibrinogen samples. A novel mutation in the FGG gene (G7590A) was found in all patients from the two families with hypofibrinogenemia. This mutation causes the amino acid exchange 313 Ser-->Asn in the gamma chain. When plasma fibrinogen from a heterozygous individual was analyzed for the presence of variant gamma chains by reverse-phase high-performance liquid chromatography and electrospray ionization mass spectrometry, only normal gamma chains could be detected. The molecular defect affecting an evolutionary highly conserved amino acid residue in human fibrinogen interferes with plasma expression of the variant molecules and is causative for the observed hypofibrinogenemic phenotype.

γAla82Gly represents a common fibrinogen γ-chain variant in Caucasians

Screening of 200 blood donors for the presence of polymorphisms in three fibrinogen genes (FGA, FGB, FGG), revealed two individuals with a heterozygous missense mutation (c.323C > G, gammaAla82Gly) in the FGG gene. This mutation has been reported previously to cause mild hypofibrinogenaemia. Analysis of an additional 416 blood donors showed two more heterozygous gammaAla82Gly mutations, resulting in an overall gammaAla82Gly allele frequency of 0.0032. Haplotype analysis demonstrated that the gammaAla82Gly mutation originated from a common founder. From these data we estimated that homozygous individuals for gammaAla82Gly should occur at a frequency of 1: 95 000, suggesting that hypofibrinogenaemia represents a more frequent condition in the population than so far believed.

Expression and analysis of a split premature termination codon in FGG responsible for congenital afibrinogenemia: escape from RNA surveillance mechanisms in transfected cells

Congenital afibrinogenemia, the most severe form of fibrinogen deficiency, is characterized by the complete absence of fibrinogen. The disease is caused by mutations in 1 of the 3 fibrinogen genes FGG, FGA, and FGB, clustered on the long arm of human chromosome 4. The majority of cases are due to null mutations in the FGA gene although one would expect the 3 genes to be equally implicated. However, most patients studied so far are white, and therefore the identification of causative mutations in non-European families is necessary to establish if this finding holds true in all ethnic groups. In this study, we report the identification of a novel nonsense mutation (Arg134Xaa) in the FGG gene responsible for congenital afibrinogenemia in 10 patients from Lebanon. Expression studies in COS-7 cells demonstrated that the Arg134Xaa codon, which is encoded by adjacent exons (TG-intron 4-A) affected neither mRNA splicing nor stability, but led to the production of an unstable, severely truncated fibrinogen gamma chain that is not incorporated into a functional fibrinogen hexamer.

Association of differentially expressed cDNA fragment of FGG with hepatocellular carcinoma

Objective: To identify a cDNA clone from the subtracted library of human hepatocellular carcinoma (HCC). Methods: Suppression subtractive hybridization was used to isolated a panel of genes that are differentially expressed in hepatocellular carcinoma as compared with cirrhotic liver. T/A cloning method was used to construct a subtracted cDNA library. DNA sequencing analysis and Northern blot analysis were also utilized. Results: The cloned cDNA is 787 nucleotides in length and contains an open reading frame of 230 amino acids, which is a cDNA fragment of reported human fibrinogen, gamma polypeptide (FGG). Northern analysis revealed that this gene was overexpressed in two hepatocellular carcinoma cell lines, SMMC-7721 and HepG2. Conclusion: Sequence identity proved the cDNA clone fragment of as FGG gene. Differential expression of the cDNA fragment in HCC suggested that FGG is related to HCC, indicating a new clue for developing a novel diagnostic and prognostic marker.

Molecular analysis of the fibrinogen gene cluster in 16 patients with congenital afibrinogenemia: novel truncating mutations in the FGA and FGG genes.

Congenital afibrinogenemia is an autosomal recessive disorder characterized by the complete absence of detectable fibrinogen. We previously identified the first causative mutations for this disease in a non-consanguineous Swiss family. These were homozygous deletions of approximately 11 kb of the fibrinogen alpha chain gene (FGA). Our subsequent study revealed that the majority of cases were attributable to truncating mutations in FGA, with the most common mutation affecting the donor splice site in FGA intron 4 (IVS4+1 G-->T). Here, we report 13 further unrelated patients with mutations in FGA, confirming the relative importance of this gene compared with FGG and FGB in the molecular aetiology of afibrinogenemia. Three other patients were homozygous for mutations in FGG. Eight novel mutations were identified: five in FGA and three in FGG. Sufficient mutation data is now available to permit an effective strategy for the genetic diagnosis of congenital afibrinogenemia.