East African Isolates Research Articles

Population genomic analyses suggest recent dispersal events of the pathogen Cercospora zeina into East and Southern African maize cropping systems.

A serious factor hampering global maize production is gray leaf spot disease. Cercospora zeina is one of the causative pathogens, but population genomics analysis of C. zeina is lacking. We conducted whole-genome Illumina sequencing of a representative set of 30 C. zeina isolates from Kenya and Uganda (East Africa) and Zambia, Zimbabwe, and South Africa (Southern Africa). Selection of the diverse set was based on microsatellite data from a larger collection of the pathogen. Pangenome analysis of the C. zeina isolates was done by (1) de novo assembly of the reads with SPAdes, (2) annotation with BRAKER, and (3) protein clustering with OrthoFinder. A published long-read assembly of C. zeina (CMW25467) from Zambia was included and annotated using the same pipeline. This analysis revealed 790 non-shared accessory and 10,677 shared core orthogroups (genes) between the 31 isolates. Accessory gene content was largely shared between isolates from all countries, with a few genes unique to populations from Southern Africa (32) or East Africa (6). There was a significantly higher proportion of effector genes in the accessory secretome (44%) compared to the core secretome (24%). PCA, ADMIXTURE, and phylogenetic analysis using a neighbor-net network indicated a population structure with a geographical subdivision between the East African isolates and the Southern African isolates, although gene flow was also evident. The small pangenome and partial population differentiation indicated recent dispersal of C. zeina into Africa, possibly from 2 regional founder populations, followed by recurrent gene flow owing to widespread maize production across sub-Saharan Africa.

First report of maize yellow mosaic virus causing maize reddening in Henan,China.

A novel polerovirus maize yellow mosaic virus (MaYMV) has been discovered in Asia (Chen et al. 2016; Lim et al. 2018; Sun et al. 2019; Wang et al. 2016), East Africa (Guadie et al. 2018; Massawe et al. 2018) and South America (Gonçalves et al. 2017). MaMYV was first reported to infect maize (Zea mays L.) showing yellow mosaic symptoms on the leaves in Yunnan, Guizhou, and yellowing and dwarfing symptoms on the leaves in Anhui provinces of China in 2016 (Chen et al. 2016; Wang et al. 2016). An East African isolate of MaYMV has recently been shown to induce leaf reddening in several maize genotypes (Stewart et al. 2020). To our knowledge the leaf reddening symptoms in maize was not reported in China and MaYMV was not reported in Henan province, China. A survey of viral diseases on maize was carried out during the autumn of 2021 in Zhengzhou (Henan province), China. During the survey, the leaves showing reddening symptoms were observed on maize plants in all four fields investigated. Symptomatic leaves of 12 plants from four fields of Xingyang county, Zhengzhou (n=12) were collected and mixed for metatranscriptomics sequencing, and total RNA was extracted and subjected to an rRNA removal procedure using a Ribo-zero Magnetic kit according to the manufacturer's instructions (Epicentre, an Illumina® company). cDNA libraries were constructed using a TruSeq™ RNA sample prep kit (Illumina). Barcoded libraries were paired-end sequenced on an Illumina HiSeq X ten platform at Shanghai Biotechnology Co., Ltd. (Shanghai, China) according to the manufacturer's instructions (www.illumina.com). In total 67607392 clean reads were de novo assembled using CLC Genomics Workbench (version:6.0.4). 105796 contigs were obtained. The assembled contigs were queried by homology search tools (BLASTn and BLASTx) against public database(GenBank). One 5,457 nucleotide (nt) long contig with the most reads of 558826 was obtained and blast analysis showed it shared 99.3% nt sequence identity (99% coverage) with MaYMV Yunnan4 isolate (KU291100).. According to the sequencing data no other plant viruses except MaYMV were present in the sequencing data. To confirm the presence of this virus, twelve leaf samples showing reddening symptoms were detected by RT-PCR using specific primer pairs for CP full length open reading frame (F: ATGAATACGGGAGGTAGAAA, R: CTATTTCGGGTTTTGAACAT). Amplicons with expected size of 594 bp were gained in seven samples and three of them were cloned into pMD18T vector and sequenced. The three isolates (OM417795, OM417796, and OM417797) shared 99.16% to 99.83% nt sequence identity with MaYMV-Yunnan3 isolate (KU291100). Further P0 sequence analysis of the three samples (OM417798, OM417799, and OM417800) with primer pairs F: ATGGGGGGAGTGCCTAAAGC/R: TCATAACTGATGGAATTCCC showed they shared 99.5% to 99.62% nt sequence identity with MaYMV-Yunnan3 isolate.To our knowledge, this is the first report of the occurrence of MaYMV infecting maize in Henan, China. Besides, our finding firstly discovered reddening symptoms caused by MaYMV on maize in China which is different from the previous symptoms observed in the other three provinces of China possibly due to the different maize varieties grown in different areas. According to our investigation, maize showing reddening symptoms was common in the fields. Henan province is the main corn production area in China. Corn leaf aphid (Rhopalosiphum maidis), the insect vector of MaYMV, is an important pest of corn in Henan province, thereby the occurrence of MaYMV might cause potential threat to maize production in China.

Molecular Analysis of East African Lumpy Skin Disease Viruses Reveals a Mixed Isolate with Features of Both Vaccine and Field Isolates.

Lumpy skin disease (LSD), an economically significant disease in cattle caused by lumpy skin disease virus (LSDV), is endemic to nearly all of Africa. Since 2012, LSDV has emerged as a significant epizootic pathogen given its rapid spread into new geographical locations outside Africa, including the Middle East, Eastern Europe, and Asia. To assess the genetic diversity of LSDVs in East Africa, we sequenced and analyzed the RPO30 and GPCR genes of LSDV in twenty-two archive samples collected in Ethiopia, Kenya, and Sudan before the appearance of LSD in the Middle East and its incursion into Europe. We compared them to publicly available sequences of LSDVs from the same region and those collected elsewhere. The results showed that the East African field isolates in this study were remarkably similar to each other and to previously sequenced field isolates of LSDV for the RPO30 and GPCR genes. The only exception was LSDV Embu/B338/2011, a field virus collected in Kenya, which displayed mixed features between the LSDV Neethling vaccine and field isolates. LSDV Embu/B338/2011 had the same 12-nucleotide insertion found in LSDV Neethling and KS-1 vaccines. Further analysis of the partial EEV glycoprotein, B22R, RNA helicase, virion core protein, NTPase, and N1R/p28-like protein genes showed that LSDV Embu/B338/2011 differs from previously described LSDV variants carrying the 12-nucleotide insertion in the GPCR gene. These findings highlight the importance of the constant monitoring of genetic variation among LSDV isolates.

Surveillance and Genetic Characterization of Virulent Newcastle Disease Virus Subgenotype V.3 in Indigenous Chickens from Backyard Poultry Farms and Live Bird Markets in Kenya.

Kenyan poultry consists of ~80% free-range indigenous chickens kept in small flocks (~30 birds) on backyard poultry farms (BPFs) and they are traded via live bird markets (LBMs). Newcastle disease virus (NDV) was detected in samples collected from chickens, wild farm birds, and other domestic poultry species during a 2017–2018 survey conducted at 66 BPFs and 21 LBMs in nine Kenyan counties. NDV nucleic acids were detected by rRT-PCR L-test in 39.5% (641/1621) of 1621 analyzed samples, of which 9.67% (62/641) were NDV-positive by both the L-test and a fusion-test designed to identify the virulent virus, with a majority being at LBMs (64.5%; 40/62) compared to BPFs (25.5%; 22/62). Virus isolation and next-generation sequencing (NGS) on a subset of samples resulted in 32 complete NDV genome sequences with 95.8–100% nucleotide identities amongst themselves and 95.7-98.2% identity with other east African isolates from 2010-2016. These isolates were classified as a new sub-genotype, V.3, and shared 86.5–88.9% and 88.5–91.8% nucleotide identities with subgenotypes V.1 and V.2 viruses, respectively. The putative fusion protein cleavage site (113R-Q-K-R↓F 117) in all 32 isolates, and a 1.86 ICPI score of an isolate from a BPF chicken that had clinical signs consistent with Newcastle disease, confirmed the high virulence of the NDVs. Compared to genotypes V and VI viruses, the attachment (HN) protein of 18 of the 32 vNDVs had amino acid substitutions in the antigenic sites. A time-scaled phylogeographic analysis suggests a west-to-east dispersal of the NDVs via the live chicken trade, but the virus origins remain unconfirmed due to scarcity of continuous and systematic surveillance data. This study reveals the widespread prevalence of vNDVs in Kenyan backyard poultry, the central role of LBMs in the dispersal and possibly generation of new virus variants, and the need for robust molecular epidemiological surveillance in poultry and non-poultry avian species.

First report of cDNA clone-launched infection of maize plants with the polerovirus maize yellow mosaic virus (MaYMV)

An East African isolate of the maize-associated polerovirus, maize yellow mosaic virus (MaYMV) was previously shown to cause leaf reddening on singly infected maize plants (Zea mays). Here we describe the construction of a full-length infectious clone of an East African isolate and, for the first time, show infectivity of clone-derived transcripts in the primary host, maize, through vascular puncture inoculation (VPI), as well as in the dicotyledonous research model plant species, Nicotiana benthamiana, through agrobacterium inoculation. Characteristic leaf reddening symptoms were observed in a subset of maize plants inoculated with clone-derived transcripts, and infection was confirmed by RT-PCR and Northern blot analyses. In N. benthamiana plants, infections were entirely asymptomatic even at high virus titers, as was also reported for the cloned Chinese isolate. In this study, however, we demonstrated that N. benthamiana can serve as a clone launching platform for maize infection, as VPI of sap of infected N. benthamiana plants into maize kernels resulted in infection and the typical red leaf symptoms. We further demonstrated that the cloned East African isolate virus was aphid transmissible to maize, with experimental transmission rates up to 97 %, comparable to that shown previously for the native virus. Interestingly, our data additionally showed a definitive correlation of leaf reddening symptoms with increased expression of chalcone synthase, thus suggesting upregulation of the flavonoid biosynthesis pathway as the molecular basis for symptom induction in maize. As the first report of experimental infection of maize with transcripts from a cloned polerovirus, this work constitutes a breakthrough for studies on molecular maize-polerovirus-aphid interactions.

SNP-based genotyping and whole-genome sequencing reveal previously unknown genetic diversity in Xanthomonas vasicola pv. musacearum, causal agent of banana xanthomonas wilt, in its presumed Ethiopian origin.

For decades, Xanthomonas vasicola pv. musacearum (Xvm) has been an economically important bacterial pathogen on enset in Ethiopia. Since 2001, Xvm has also been responsible for significant losses to banana crops in several East and Central African countries, with devastating consequences for smallholder farmers. Understanding the genetic diversity within Xvm populations is essential for the smart design of transnationally reasoned, durable, and effective management practices. Previous studies have revealed limited genetic diversity in Xvm, with East African isolates from banana each falling into one of two closely related clades previously designated as sublineages SL 1 and SL 2, the former of which had also been detected on banana and enset in Ethiopia. Given the presumed origin of Xvm in Ethiopia, we hypothesized that both clades might be found in that country, along with additional genotypes not seen in Central and East African bananas. Genotyping of 97 isolates and whole‐genome sequencing of 15 isolates revealed not only the presence of SL 2 in Ethiopia, but additional diversity beyond SL 1 and SL 2 in four new clades. Moreover, SL 2 was detected in the Democratic Republic of Congo, where previously SL 1 was the only clade reported. These results demonstrate a greater range of genetic diversity among Xvm isolates than previously reported, especially in Ethiopia, and further support the hypothesis that the East/Central Africa xanthomonas wilt epidemic has been caused by a restricted set of genotypes drawn from a highly diverse pathogen pool in Ethiopia.

Variant analysis of the sporozoite surface antigen gene reveals that asymptomatic cattle from wildlife-livestock interface areas in northern Tanzania harbour buffalo-derived T. parva

Buffalo-derived Theileria parva can ‘break through’ the immunity induced by the infection and treatment vaccination method (ITM) in cattle. However, no such ‘breakthroughs’ have been reported in northern Tanzania where there has been long and widespread ITM use in pastoralist cattle, and the Cape buffalo (Syncerus caffer) is also present. We studied the exposure of vaccinated and unvaccinated cattle in northern Tanzania to buffalo-derived T. parva using p67 gene polymorphisms and compared this to its distribution in vaccinated cattle exposed to buffalo-derived T. parva in central Kenya, where vaccine ‘breakthroughs’ have been reported. Additionally, we analysed the CD8+ T cell target antigen Tp2 for positive selection. Our results showed that 10% of the p67 sequences from Tanzanian cattle (n = 39) had a buffalo type p67 (allele 4), an allele that is rare among East African isolates studied so far. The percentage of buffalo-derived p67 alleles observed in Kenyan cattle comprised 19% of the parasites (n = 36), with two different p67 alleles (2 and 3) of presumptive buffalo origin. The Tp2 protein was generally conserved with only three Tp2 variants from Tanzania (n = 33) and five from Kenya (n = 40). Two Tanzanian Tp2 variants and two Kenyan Tp2 variants were identical to variants present in the trivalent Muguga vaccine. Tp2 evolutionary analysis did not show evidence for positive selection within previously mapped epitope coding sites. The p67 data indicates that some ITM-vaccinated cattle are protected against disease induced by a buffalo-derived T. parva challenge in northern Tanzania and suggests that the parasite genotype may represent one factor explaining this.

Identification of Peste des Petits Ruminants Transmission Hotspots in the Karamoja Subregion of Uganda for Targeting of Eradication Interventions.

This paper describes an assessment of the patterns of peste des petits ruminants virus circulation in the Karamoja subregion of Uganda conducted to identify the communities that maintain the virus and inform the development of a targeted vaccination strategy. Participatory epidemiological methods were used to develop an operational hypothesis for the patterns of PPR in Karamoja that was subsequently validated through outbreak investigation and genomics. The participatory epidemiological assessment included risk mapping with livestock owners, community animal health workers and veterinarians and indicated there were two critical foci of virus transmission on the Uganda-Kenya border. One was located in two adjacent subcounties of Kotido and Kaabong Districts in northern Karamoja and the other in Loroo subcounty of Amudat District in southern Karamoja. Participants reported that these were locations where outbreaks were usually first observed in Karamoja and subsequently spread to other areas. Following the participatory assessment, surveillance activities were implemented across the Karamoja subregion in 2018. Three outbreak were detected, investigated and sampled. Two outbreaks were located in the northern and one on the southern focus of transmission. No Outbreaks were diagnosed in Karamoja outside of these foci during 2018. Genomics indicated different clusters of viruses were associated with the northern and southern foci that were more closely related to other East African isolates than to each other. This indicates these are two separate systems of virus circulation which should be explicitly addressed in eradication as separate cross-border systems that require integrated cross-border interventions.

Mycobacterium tuberculosis lineage 1 genetic diversity in Pará, Brazil, suggests common ancestry with east-African isolates potentially linked to historical slave trade

Lineage 1 (L1) is one of seven Mycobacterium tuberculosis complex (MTBC) lineages. The objective of this study was to improve the complex taxonomy of L1 using phylogenetic SNPs, and to look for the origin of the main L1 sublineage prevalent in Para, Brazil. We developed a high-throughput SNPs-typing assay based on 12-L1-specific SNPs. This assay allowed us to experimentally retrieve SNP patterns on nine of these twelve SNPs in 277 isolates previously tentatively assigned to L1 spoligotyping-based sublineages. Three collections were used: Pará-Brazil (71); RIVM, the Netherlands (102), Madagascar (104). One-hundred more results were generated in Silico using the PolyTB database. Based on the final SNPs combination, the samples were classified into 11 clusters (C1-C11). Most isolates within a SNP-based cluster shared a mutual spoligotyping-defined lineage. However, L1/EAI1-SOM (SIT48) and L1/EAI6-BGD1 (SIT591) showed a poor correlation with SNP data and are not monophyletic. L1/EAI8-MDG and L1/EAI3-IND belonged to C5; this result suggests that they share a common ancestor. L1.1.3/SIT129, a spoligotype pattern found in SNPs-cluster C6, was found to be shared between Pará/Brazil and Malawi. SIT129 was independently found to be highly prevalent in Mozambique, which suggests a migration history from East-Africa to Brazil during the 16th–18th slave trade period to Northern Brazil.

Identification and genetic characterization of Piroplasmida and Anaplasmataceae agents in feeding Amblyomma variegatum ticks from Benin.

In many African countries including Benin, the reluctance of some livestock owners to blood collection from their cattle makes epidemiological surveys cumbersome and prevents regular monitoring of tick-borne diseases. In the present study, Amblyomma variegatum ticks were used to find out more about bovine tick-borne pathogens. DNA extracts from 910 adult ticks collected off cattle in North East Benin were examined for Babesia bigemina, B. bovis, Theileria taurotragi, T. annulata, T. orientalis, T. parva, T. mutans, Anaplasma marginale and Ehrlichia ruminantium using pathogen-specific PCR assays and sequence analyses. Altogether, 21.6% of the ticks carried at least one pathogen. A. marginale (142/910) was the most frequent pathogen, followed by E. ruminantium (57/910), B. bovis (10/910), T. mutans (3/910) and B. bigemina (1/910). Theileria taurotragi, T. annulata, T. orientalis, T. parva were not detected in the samples. Babesia bigemina, B. bovis and T. mutans were present in only one location whereas A. marginale and E. ruminantium were found in ticks from 7/8 locations surveyed. Coinfections occurred in 7.1% of all positive ticks. The analyses of partial sequences of B. bovis spherical body protein 4, B. bigemina rhoptry-associated protein-1a, T. mutans 18S rRNA and A. marginale major surface protein 5 showed high sequence conservation and homologies between Benin isolates and those from other African countries. However, E. ruminantium pCS20 partial sequences were different from published West African isolates and presented similar genetic variation with South and East African isolates. These results provide information on the pathogens circulating in North East Benin and suggest that Am. variegatum, one of the most abundant ticks in Africa, may play a role in the transmission of A. marginale.

Identification and molecular characterization of Taro bacilliform virus and Taro bacilliform CH virus from East Africa.

Taro (Colocasia esculenta) and tannia (Xanthosoma sp.) are important root crops cultivated mainly by small-scale farmers in sub-Saharan Africa and the South Pacific. Viruses are known to be one of the most important constraints to production, with infections resulting in severe yield reduction. In 2014 and 2015, surveys were conducted in Ethiopia, Kenya, Tanzania and Uganda to determine the identity of viruses infecting taro in East Africa. Screening of 392 samples collected from the region using degenerate badnavirus primers revealed an incidence of 58–74% among the four countries surveyed, with sequence analysis identifying both Taro bacilliform virus (TaBV) and Taro bacilliform CH virus (TaBCHV). TaBCHV was identified from all four countries while TaBV was identified in all except Ethiopia. Full-length sequences from representative TaBV and TaBCHV isolates showed that the genome organization of TaBV isolates from East Africa was consistent with previous reports while TaBCHV isolates from East Africa were found to encode only four ORFs, distinct from a previous report from China. Phylogenetic analysis showed that all East African TaBV isolates form a single subgroup within known TaBV isolates, while TaBCHV isolates form at least two distinct subgroups. To the authors’ knowledge, this is the first report describing the occurrence and genome organization of TaBV and TaBCHV isolates from East Africa and the first full-length sequence of the two viruses from tannia.

Complete sequence and diversity of a maize-associated Polerovirus in East Africa.

Since 2011-2012, Maize lethal necrosis (MLN) has emerged in East Africa, causing massive yield loss and propelling research to identify viruses and virus populations present in maize. As expected, next generation sequencing (NGS) has revealed diverse and abundant viruses from the family Potyviridae, primarily sugarcane mosaic virus (SCMV), and maize chlorotic mottle virus (MCMV) (Tombusviridae), which are known to cause MLN by synergistic co-infection. In addition to these expected viruses, we identified a virus in the genus Polerovirus (family Luteoviridae) in 104/172 samples selected for MLN or other potential virus symptoms from Kenya, Uganda, Rwanda, and Tanzania. This polerovirus (MF974579) nucleotide sequence is 97% identical to maize-associated viruses recently reported in China, termed 'maize yellow mosaic virus' (MaYMV) and maize yellow dwarf virus (MaYMV; KU291101, KU291107, MYDV-RMV2; KT992824); and 99% identical to MaYMV (KY684356) infecting sugarcane and itch grass in Nigeria; 83% identical to a barley-associated polerovirus recently identified in Korea (BVG; KT962089); and 79% identical to the U.S. maize-infecting polerovirus maize yellow dwarf virus (MYDV-RMV; KT992824). Nucleotide sequences from ORF0 of 20 individual East African isolates collected from Kenya, Uganda, Rwanda, and Tanzania shared 98% or higher identity, and were detected in 104/172 (60.5%) of samples collected for virus-like symptoms, indicating extensive prevalence but limited diversity of this virus in East Africa. We refer to this virus as "MYDV-like polerovirus" until symptoms of the virus in maize are known.

Detection and characterization of Maize chlorotic mottle virus and Sugarcanemosaic virus associated with maize lethal necrosis disease in Ethiopia: an emerging threat to maize production in the region

Maize Lethal Necrosis Disease (MLND) develops from synergistic co-infection by Sugarcane mosaic virus and Maize chlorotic mottle virus. The disease causes symptoms ranging from leaf tissue mottling and malformed ears to premature plant death. Information on the diversity and transmission of those viruses are limited in Ethiopia. No attempts were made to characterize and identify SCMV and MCMV strains of Oromia and Benishangul-Gumuz regions. The aim of this research was to study MLND responsible viruses via serological and molecular techniques. A total of 174 symptomatic maize leaf samples were collected. Using Double Antibody Sandwich-ELISA (DAS-ELISA), 43 samples showed strong reaction for MCMV antibody and only 14 samples were clearly positive for SCMV. Reverse transcriptase polymerase chain reaction (RT-PCR) technique revealed the presence of MCMV and SCMV in most samples. Analysis of the genetic diversity of MCMV and SCMV by sequencing the coat protein of all isolates shows strong homology with previous East African isolates deposited in the GenBank. The phylogenetic analysis indicated that the virus isolates are highly similar with each other. In conclusion, this study unequivocally confirmed the association of MCMV and SCMV with MLND in the investigated areas and for the first time provided information on the genetic variability by sequence analysis of several Ethiopian samples. Since the risk posed by MLND in the investigated area is high, there is an urgent need for developing integrated management options for controlling the disease.

Phylogenetic, epidemiological and functional analyses of the Streptococcus bovis/Streptococcus equinus complex through an overarching MLST scheme.

BackgroundThe Streptococcus bovis/Streptococcus equinus complex (SBSEC) comprises seven (sub)species classified as human and animal commensals, emerging opportunistic pathogens and food fermentative organisms. Changing taxonomy, shared habitats, natural competence and evidence for horizontal gene transfer pose difficulties for determining their phylogeny, epidemiology and virulence mechanisms. Thus, novel phylogenetic and functional classifications are required. An SBSEC overarching multi locus sequence type (MLST) scheme targeting 10 housekeeping genes was developed, validated and combined with host-related properties of adhesion to extracellular matrix proteins (ECM), activation of the immune responses via NF-KB and survival in simulated gastric juice (SGJ).ResultsCommensal and pathogenic SBSEC strains (n = 74) of human, animal and food origin from Europe, Asia, America and Africa were used in the MLST scheme yielding 66 sequence types and 10 clonal complexes differentiated into distinct habitat-associated and mixed lineages. Adhesion to ECMs collagen I and mucin type II was a common characteristic (23 % of strains) followed by adhesion to fibronectin and fibrinogen (19.7 %). High adhesion abilities were found for East African dairy and human blood isolate branches whereas commensal fecal SBSEC displayed low adhesion. NF-KB activation was observed for a limited number of dairy and blood isolates suggesting the potential of some pathogenic strains for reduced immune activation. Strains from dairy MLST clades displayed the highest relative survival to SGJ independently of dairy adaptation markers lacS/lacZ.ConclusionCombining phylogenetic and functional analyses via SBSEC MLST enabled the clear delineation of strain clades to unravel the complexity of this bacterial group. High adhesion values shared between certain dairy and blood strains as well as the behavior of NF-KB activation are concerning for specific lineages. They highlighted the health risk among shared lineages and establish the basis to elucidate (zoonotic-) transmission, host specificity, virulence mechanisms and enhanced risk assessment as pathobionts in an overarching One Health approach.Electronic supplementary materialThe online version of this article (doi:10.1186/s12866-016-0735-2) contains supplementary material, which is available to authorized users.

Genome-wide sequencing reveals two major sub-lineages in the genetically monomorphic pathogen xanthomonas campestris pathovar musacearum.

The bacterium Xanthomonas campestris pathovar musacearum (Xcm) is the causal agent of banana Xanthomonas wilt (BXW). This disease has devastated economies based on banana and plantain crops (Musa species) in East Africa. Here we use genome-wide sequencing to discover a set of single-nucleotide polymorphisms (SNPs) among East African isolates of Xcm. These SNPs have potential as molecular markers for phylogeographic studies of the epidemiology and spread of the pathogen. Our analysis reveals two major sub-lineages of the pathogen, suggesting that the current outbreaks of BXW on Musa species in the region may have more than one introductory event, perhaps from Ethiopia. Also, based on comparisons of genome-wide sequence data from multiple isolates of Xcm and multiple strains of X. vasicola pathovar vasculorum, we identify genes specific to Xcm that could be used to specifically detect Xcm by PCR-based methods.

Is Trypanosoma vivax genetically diverse?

Is Trypanosoma vivax genetically diverse?

First Report of Sweet potato chlorotic stunt virus Infecting Sweet Potato in China.

Sweet potato chlorotic stunt virus (SPCSV) (genus Crinivirus, family Closteroviridae) is a whitefly-transmitted co-infectant of the sweet potato virus disease (SPVD), which can cause severe yield losses in sweet potato (Ipomoea batatas (L.) Lam.) (2,3). One isolate was obtained in Guangdong Province in August 2009 from sweet potato plants of cv. Guangshu No. 87 exhibiting symptoms typical of SPVD, including stunting, leaf distortion, vein clearing, and chlorosis. Leaf extracts from the symptomatic plants tested positive for SPCSV by nitrocellulose membrane ELISA with antisera specific for SPCSV obtained from the International Potato Center. Total RNA was extracted from young leaves of sweet potato and reverse transcription-PCR was performed by using primer pairs SPSP1 (5'-ATGRMTACTGRCAAAGTAAACGATG-3') and SPSP4 (5'-TCAACAGTGAAGACCRGYACCRGTCAA-3') corresponding to the capsid protein (CP) gene of SPCSV. Expected DNA fragments of 774 bp were obtained from symptomatic plants but not from control plants. The 774-bp fragments obtained by amplification were purified and cloned into the PMD19-T vector (TaKaRa, Dalian, China). Recombinant plasmids were then transformed into competent cells of Escherichia coli strain Jm109. Sequencing of the fragments from two individually clones plasmids yielded a nucleotide sequence (GenBank Accession No. HM773432) with 97.4 to 98.7% similarity to the CP gene of East African SPCSV isolates (1). To our knowledge, this is the first report of SPCSV in sweet potato fields from China. This virus may threaten sweet potato production in China, so cultivars and germplasm should be evaluated for resistance.

Phylogenetic analysis of Trypanosoma vivax supports the separation of South American/West African from East African isolates and a new T. vivax-like genotype infecting a nyala antelope from Mozambique

In this study, we addressed the phylogenetic and taxonomic relationships of Trypanosoma vivax and related trypanosomes nested in the subgenus Duttonella through combined morphological and phylogeographical analyses. We previously demonstrated that the clade T. vivax harbours a homogeneous clade comprising West African/South American isolates and the heterogeneous East African isolates. Herein we characterized a trypanosome isolated from a nyala antelope (Tragelaphus angasi) wild-caught in Mozambique (East Africa) and diagnosed as T. vivax-like based on biological, morphological and molecular data. Phylogenetic relationships, phylogeographical patterns and estimates of genetic divergence were based on SSU and ITS rDNA sequences of T. vivax from Brazil and Venezuela (South America), Nigeria (West Africa), and from T. vivax-like trypanosomes from Mozambique, Kenya and Tanzania (East Africa). Despite being well-supported within the T. vivax clade, the nyala trypanosome was highly divergent from all other T. vivax and T. vivax-like trypanosomes, even those from East Africa. Considering its host origin, morphological features, behaviour in experimentally infected goats, phylogenetic placement, and genetic divergence this isolate represents a new genotype of trypanosome closely phylogenetically related to T. vivax. This study corroborated the high complexity and the existence of distinct genotypes yet undescribed within the subgenus Duttonella.

Further Evidence for Limited Genetic Diversity among East African Isolates of Sweet potato chlorotic stunt virus

AbstractIn Africa, the crinivirus Sweet potato chlorotic stunt virus (SPCSV) exists in two serologically and genetically distinct strains, geographically distinguished as a West African (SPCSVWA) and an East African (SPCSVEA) strain. To obtain a better understanding of the genetic diversity among SPCSVEA isolates, the major coat protein (CP) and heat shock protein 70 homologue (Hsp70h) gene sequences of 24 further isolates of SPCSVEA were determined and compared. SPCSVEA diversity was also examined using available monoclonal antibodies (mAbs) to SPCSVEA but there was no apparent coincidence between CP and partial Hsp70h gene nucleotide sequences and the subdivision of SPCSVEA isolates by the mAbs into two serotypes, suggesting this latter may not be of great biological significance. The nucleotide (nt) sequences of isolates of SPCSVEA displayed a high degree of conservation and the only variation observed consisted of a few base exchanges. Pairwise alignments of CP nucleotide sequences revealed differences of <4% between SPCSVEA isolates. Comparisons with published SPCSV sequences confirmed a more distant relationship (up to 34.6% nt; 12% amino acid divergence) between the Hsp70h sequences of isolates of SPCSVEA and SPCSVWA and indicated that SPCSVEA in East and Southern Africa is the more homogeneous than SPCSVWA isolates from West Africa, North and South America, which were up to 12.4% nt divergent among themselves.

Genome Microevolution of Chikungunya Viruses Causing the Indian Ocean Outbreak

BackgroundA chikungunya virus outbreak of unprecedented magnitude is currently ongoing in Indian Ocean territories. In Réunion Island, this alphavirus has already infected about one-third of the human population. The main clinical symptom of the disease is a painful and invalidating poly-arthralgia. Besides the arthralgic form, 123 patients with a confirmed chikungunya infection have developed severe clinical signs, i.e., neurological signs or fulminant hepatitis.Methods and FindingsWe report the nearly complete genome sequence of six selected viral isolates (isolated from five sera and one cerebrospinal fluid), along with partial sequences of glycoprotein E1 from a total of 127 patients from Réunion, Seychelles, Mauritius, Madagascar, and Mayotte islands. Our results indicate that the outbreak was initiated by a strain related to East-African isolates, from which viral variants have evolved following a traceable microevolution history. Unique molecular features of the outbreak isolates were identified. Notably, in the region coding for the non-structural proteins, ten amino acid changes were found, four of which were located in alphavirus-conserved positions of nsP2 (which contains helicase, protease, and RNA triphosphatase activities) and of the polymerase nsP4. The sole isolate obtained from the cerebrospinal fluid showed unique changes in nsP1 (T301I), nsP2 (Y642N), and nsP3 (E460 deletion), not obtained from isolates from sera. In the structural proteins region, two noteworthy changes (A226V and D284E) were observed in the membrane fusion glycoprotein E1. Homology 3D modelling allowed mapping of these two changes to regions that are important for membrane fusion and virion assembly. Change E1-A226V was absent in the initial strains but was observed in >90% of subsequent viral sequences from Réunion, denoting evolutionary success possibly due to adaptation to the mosquito vector.ConclusionsThe unique molecular features of the analyzed Indian Ocean isolates of chikungunya virus demonstrate their high evolutionary potential and suggest possible clues for understanding the atypical magnitude and virulence of this outbreak.