Detection Of Sequence Variants Research Articles

Validation of the IDseek® OmniSTR™ Global Autosomal STR Profiling kit, reverse complement PCR as an improved tool/method for routine massively parallel sequencing of short tandem repeats

Massively Parallel Sequencing (MPS) has gained interest in the forensic community over the past decade. Most of the published MPS methods focus on specialty applications intended for use in a limited number of samples with protocols that are relatively laborious. Recent developments using Reverse-Complement PCR enable an efficient MPS protocol suited for routine analysis of high numbers of samples. This method is implemented in the IDseek® OmniSTR™ Global Autosomal STR Profiling kit (Nimagen) for sequencing 28 of the most commonly used forensic autosomal STRs, one Y-chromosomal STR and Amelogenin. This study describes the validation of this kit and focuses on sensitivity, inhibitor tolerance, sequence variation detection and performance with mixtures up to 5 contributors. Results are compared to a Capillary Electrophoresis method (the PowerPlex® Fusion 6 C system, Promega) and the first commercial forensic MPS kit (ForenSeq™ DNA Signature prep, Qiagen) and for a concordance study with data from the Powerseq® MPS kit as well. Analysis settings in FDSTools are deduced and discussed, and an almost completely automated analysis is achieved. Using FDSTools noise correction, contributions in a mixture down to a level of 1.5 % of the major allele of a marker can be detected.

Congenital peribronchial myofibroblastic tumors harbor a recurrent EGFR kinase domain duplication

Congenital peribronchial myofibroblastic tumor (CPMT) is a rare benign infantile pulmonary neoplasm that presents prenatally or early in infancy, and exhibits distinctive histologic features characterized by the presence of cartilaginous islands intermixed with bland spindle cells, not uncommonly displaying prominent mitoses. Despite its benign nature, CPMT can lead to fetal demise, postnatal respiratory distress, or complications from perinatal surgical resection. Although the morphologic and clinical features of CPMT are well-described, its molecular features and oncogenesis remain elusive. Following the detection of EGFR kinase domain duplication (KDD) of exons 18-25 in an index case, we identified three additional cases of morphologically classic and clinically well-characterized CPMTs from the archives and performed targeted RNA- and DNA-based profiling via next generation sequencing for detection of rearrangements, sequence variants and copy number variants on all cases. Two cases were detected prenatally, one patient presented at birth and one at 8 weeks of life. All tumors were resected, with follow-up period ranging from 0 days to 10 years. One patient died shortly after surgical resection, and the other three have had no recurrences. In all cases, EGFR KDD was detected. In two of four cases, gains of select whole chromosomes were noted. Our findings establish EGFR KDD as a recurrent oncogenic driver of CPMT. Notably, this alteration is also found in classical congenital mesoblastic nephromas (CMNs), infantile kidney tumors with which CPMTs share striking morphologic and clinical similarities. This strongly suggests CPMTs and classical CMNs share common oncogenesis, and represent the same tumor in different locations. EGFR KDDs have also been reported in neonatal soft tissue tumors with infantile fibrosarcoma-like histology and cartilaginous differentiation, raising questions about their relationship. EGFR KDD emerges as a diagnostic marker, potential therapeutic target, and a window into the oncogenesis of a distinct subset of infantile mesenchymal tumors.

Scalable and unsupervised discovery from raw sequencing reads using SPLASH2.

We introduce SPLASH2, a fast, scalable implementation of SPLASH based on an efficient k-mer counting approach for regulated sequence variation detection in massive datasets from a wide range of sequencing technologies and biological contexts. We demonstrate biological discovery by SPLASH2 in single-cell RNA sequencing (RNA-seq) data and in bulk RNA-seq data from the Cancer Cell Line Encyclopedia, including unannotated alternative splicing in cancer transcriptomes and sensitive detection of circular RNA.

A reference-free algorithm discovers regulation in the plant transcriptome.

Most plant genomes and their regulation remain unknown. We used SPLASH - a new, reference-genome free sequence variation detection algorithm - to analyze transcriptional and post-transcriptional regulation from RNA-seq data. We discovered differential homolog expression during maize pollen development, and imbibition-dependent cryptic splicing in Arabidopsis seeds. SPLASH enables discovery of novel regulatory mechanisms, including differential regulation of genes from hybrid parental haplotypes, without the use of alignment to a reference genome.

Comparison of an Unlabeled Probe High-Resolution Melting Analysis Assay (HRMA) for Factor V Leiden 1691 G/A Mutation to a Fluorogenic 5' Nuclease PCR Hydrolysis Assay.

The clinically significant Factor V Leiden (FVL) point mutation (1691 G/A) causes replacement of Arg with Gln (glutamine), preventing activated protein C from inactivating Factor V leading to a lengthened clotting process. Individuals with the Factor V Leiden mutations have an increased risk for venous thrombosis. The aim of this study is to compare an unlabeled probe high-resolution melting analysis (HRMA) assay for Factor V Leiden mutation to a TaqMan hydrolysis assay (fluorogenic 5' nuclease PCR hydrolysis assay). HRMA is a post-PCR, homogenous, closed-tube system for the detection of sequence variants. Post-PCR, the amplicons are heated gradually until the melting temperature is reached and the fluorescent dye unbinds from the amplicon and exhibits low fluorescence. A melt-curve analysis is generated that is characteristic of a particular sequence variant. Therefore, HRMA allows for comparison of one base changes in genetic sequences based on their differences in melting rate. Blood samples were collected in EDTA tubes and DNA extracted using the Roche MagNaPure. Reactions of both HRMA and TaqMan were carried out on 3 controls (1691 G/G, 1691 G/A, and 1691 G/G and G/A) and 20 samples. The genotypes for 3 reference controls purchased from Coriell (F5 1691 G/G, FVL 1691 G/A, and Heterozygote 1691 G/G and G/A) were confirmed by both the HRMA and TaqMan FVL assays. All 20 samples were confirmed to be F5 1691 G/G by both HRMA and TaqMan assays. Comparing the results of the unlabeled probe HRMA FVL assay with a real-time TaqMan probe end point genotyping assay resulted in 100% sensitivity and 100% specificity for both assays.

LiftoffTools: a toolkit for comparing gene annotations mapped between genome assemblies.

In 2020 we published Liftoff, which was the first standalone tool specifically designed for transferring gene annotations between genome assemblies of the same or closely related species. While the gene content is expected to be very similar in closely related genomes, the differences may be biologically consequential, and a computational method to extract all gene-related differences should prove useful in the analysis of such genomes. Here we present LiftoffTools, a toolkit to automate the detection and analysis of gene sequence variants, synteny, and gene copy number changes. We provide a description of the toolkit and an example of its use comparing genes mapped between two human genome assemblies.

Harnessing Next-Generation Sequencing as a Timely and Accurate Second-Tier Screening Test for Newborn Screening of Inborn Errors of Metabolism.

In this study, we evaluated the implementation of a second-tier genetic screening test using an amplicon-based next-generation sequencing (NGS) panel in our laboratory during the period of 1 September 2021 to 31 August 2022 for the newborn screening (NBS) of six conditions for inborn errors of metabolism: citrullinemia type II (MIM #605814), systemic primary carnitine deficiency (MIM #212140), glutaric acidemia type I (MIM #231670), beta-ketothiolase deficiency (#203750), holocarboxylase synthetase deficiency (MIM #253270) and 3-hydroxy-3-methylglutaryl-CoA lyase deficiency (MIM # 246450). The custom-designed NGS panel can detect sequence variants in the relevant genes and also specifically screen for the presence of the hotspot variant IVS16ins3kb of SLC25A13 by the copy number variant calling algorithm. Genetic second-tier tests were performed for 1.8% of a total of 22,883 NBS samples. The false positive rate for these six conditions after the NGS second-tier test was only 0.017%, and two cases of citrullinemia type II would have been missed as false negatives if only biochemical first-tier testing was performed. The confirmed true positive cases were citrullinemia type II (n = 2) and systemic primary carnitine deficiency (n = 1). The false positives were later confirmed to be carrier of citrullinemia type II (n = 2), carrier of glutaric acidemia type I (n = 1) and carrier of systemic primary carnitine deficiency (n = 1). There were no false negatives reported. The incorporation of a second-tier genetic screening test by NGS greatly enhanced our program's performance with 5-working days turn-around time maintained as before. In addition, early genetic information is available at the time of recall to facilitate better clinical management and genetic counseling.

Implementation, Evolution, and Laboratory Performance of Methods-Based Proficiency Testing for Next-Generation Sequencing Detection of Germline Sequence Variants.

Next-generation sequencing (NGS)-based assays are used for diagnosis of diverse inherited disorders. Limited data are available pertaining to interlaboratory analytical performance of these assays. To report on the College of American Pathologists (CAP) NGS Germline Program, which is methods based, and explore the evolution in laboratory testing practices. Results from the NGS Germline Program from 2016-2020 were analyzed for interlaboratory analytical performance. Self-reported laboratory testing practices were also evaluated. From 2016-2020, a total of 297 laboratories participated in at least 1 program mailing. Of the 289 laboratories that provided information on tests offered, 138 (47.8%) offered only panel testing throughout their enrollment, while 35 (12.1%) offered panels and exome testing, 30 (10.4%) offered only exomes, 9 (3.1%) offered only genomes, and 15 (5.2%) offered panels, exomes, and genomes. The remainder (62 laboratories, 21.4%) changed their test offerings during the 2016-2020 timeframe. Considering each genomic position/interval, the median detection percentage at variant positions across the 2016-2020 mailings ranged from 94.3% to 100%, while at reference positions (no variant detected), the median correct response percentage was 100% across all mailings. When considering performance of individual laboratories, 89.5% (136 of 152) to 98.0% (149 of 152) of laboratories successfully met the detection threshold (≥90% of the variants present), while 94.6% (87 of 92) to 100% (163 of 163) of laboratories met the 95% specificity threshold across mailings. Since the inception of this program, laboratories have consistently performed well. The median sensitivity and specificity of detection of sequence variants included in this program (eg, single nucleotide variants, insertions, and deletions) were 100.0%.

Detection of Mosaic Sequence Variants Associated with Human Genetic Diseases

Detection of Mosaic Sequence Variants Associated with Human Genetic Diseases

B-224 Comparison of an Unlabeled Probe High Resolution Melting Analysis (HRMA) Assay for Factor V Leiden 1691 G > A Mutation to a TaqMan Hydrolysis Assay

Abstract Background The clinically significant Factor V Leiden (FVL) mutation (1691 G > A) causes replacement of Arg with Gln, preventing activated protein C from inactivating Factor V leading to a lengthened clotting process. Individuals with the Factor II and Factor V Leiden mutations have an increased risk for venous thrombosis. The aim of this study is to compare an unlabeled probe High Resolution Melting Analysis (HRMA) assay for Factor V Leiden mutation to a TaqMan hydrolysis assay. High Resolution Melting Analysis (HRMA) is a post-PCR, homogenous, closed tube system for the detection of sequence variants. Post-PCR, the amplicons are heated gradually until the melting temperature is reached and the fluorescent dye unbinds from the amplicon and exhibits low fluorescence. A melt-curve analysis is generated that is characteristic of a particular sequence variant, therefore HRMA allows for comparison of one base changes in genetic sequences based on their differences in melting rate. Methods HRMA Assay: Blood samples were collected in EDTA tubes and DNA extracted using the Roche MagnaPure. DNA content was determined to supply 66 ng of genomic DNA to each reaction mixture. Factor Vc.1601 G > A Novallele Genotyping Assay by Canon Biosciences was used. The following primer and probe sequences were used: forward primer sequence: 5′-CCCATTATTTAGCCAGGAGA-3′, reverse primer sequence: 5′-GCCTCTGGGCTAATAGGACT-3′, unlabeled probe sequence: 5′-TTCAAGGACAAAATACCTGTATTCCTCGCCT/3AmM/3′. PCR was performed in Roche Light Cycler 480 with 11 uL volumes per reaction of 66.6 ng of DNA. Forward primer, reverse primer and probe concentration was 100 uM and a 5× volume excess amount of forward primer and probe was used. A 151 bp amplicon was generated. Three control references obtained from Coriell Institute were used including wild type (WT), mutant (MUT) and heterozygote (HET). The HRMA FVL assay was performed on a total of seventeen samples. The TaqMan hydrolysis FVL assay uses the following DNA primers and probe: forward primer: GCCTCTGGGCTAATAGGACTACTTC; reverse primer: TTTCTGAAAGGTTACTTCAAGGACAA; WT FVL probe: HEX-ACC TGT ATT CCT CGC CT-BHQ-2; MUT FVL probe: FAM-ACC TGT ATT CCT TGC CT-BHQ-2. Reactions were performed in a 20 ul volume with 50 ng of DNA per reaction. The same sets of reference DNA and 17 samples of DNA as the high-resolution melting analysis were used. Results For FVL, the Tm was 65.58 °C and 69.75 °C respectively for the WT and MUT. Tm for all 17 samples was 69.75 °C respectively indicating all 17 samples were WT FVL. This TaqMan FVL assay confirmed the FVL genotype of the 17 samples and reference samples. Conclusion Comparing the results of the unlabeled probe, HRMA FVL assay with a real-time TaqMan probe endpoint genotyping assay resulted in 100% sensitivity and 100% specificity for both assays.

Clinical validation of a single NGS targeted panel pipeline using the KAPA HyperChoice system for detection of germline, somatic and mitochondrial sequence and copy number variants

ABSTRACT Background Comprehensive molecular diagnostics are highly dependent on the technical performance of next-generation sequencing (NGS) pipelines, which are assessed by data quality, cost, turnaround time, and accuracy of detecting a range of sequence and copy number variants. Methods A dataset of 285 clinically validated cases (205 retrospective and 80 prospective), carrying complex sequence and copy number variants and thousands of genetic polymorphisms underwent a clinical validation of the KAPA HyperChoice target enrichment system with parallel sample fidelity assessment across a number of NGS panels. The analysis included assessment of peripheral blood, urine, muscle and FFPE tissues. Results High-quality and exceptionally uniform data with 100% coverage of all targeted panels were obtained, resulting in complete sensitivity and specificity for all variant types across nearly all panels and tissue types. Overall reduction in cost and turnaround times was obtained with the implementation of a parallel genotyping sample fidelity system. Conclusion Results of the laboratory quality improvement study focused on a single NGS pipeline that includes both nuclear and mitochondrial genomes demonstrated utility in the clinical setting to assess a range of referral reasons, necessary due to the complex molecular etiology of human genetic disorders, while reducing costs and turnaround times.

High functional allelic diversity and copy number in both MHC classes in the common buzzard

BackgroundThe major histocompatibility complex (MHC), which encodes molecules that recognize various pathogens and parasites and initiates the adaptive immune response in vertebrates, is renowned for its exceptional polymorphism and is a model of adaptive gene evolution. In birds, the number of MHC genes and sequence diversity varies greatly among taxa, believed due to evolutionary history and differential selection pressures. Earlier characterization studies and recent comparative studies suggest that non-passerine species have relatively few MHC gene copies compared to passerines. Additionally, comparative studies that have looked at partial MHC sequences have speculated that non-passerines have opposite patterns of selection on MHC class I (MHC-I) and class II (MHC-II) loci than passerines: namely, greater sequence diversity and signals of selection on MHC-II than MHC-I. However, new sequencing technology is revealing much greater MHC variation than previously expected while also facilitating full sequence variant detection directly from genomic data. Our study aims to take advantage of high-throughput sequencing methods to fully characterize both classes and domains of MHC of a non-passerine bird of prey, the common buzzard (Buteo buteo), to test predictions of MHC variation and differential selection on MHC classes.ResultsUsing genetic, genomic, and transcriptomic high-throughput sequencing data, we established common buzzards have at least three loci that produce functional alleles at both MHC classes. In total, we characterize 91 alleles from 113 common buzzard chicks for MHC-I exon 3 and 41 alleles from 125 chicks for MHC-IIB exon 2. Among these alleles, we found greater sequence polymorphism and stronger diversifying selection at MHC-IIB exon 2 than MHC-I exon 3, suggesting differential selection pressures on MHC classes. However, upon further investigation of the entire peptide-binding groove by including genomic data from MHC-I exon 2 and MHC-IIA exon 2, this turned out to be false. MHC-I exon 2 was as polymorphic as MHC-IIB exon 2 and MHC-IIA exon 2 was essentially invariant. Thus, comparisons between MHC-I and MHC-II that included both domains of the peptide-binding groove showed no differences in polymorphism nor diversifying selection between the classes. Nevertheless, selection analysis indicates balancing selection has been acting on common buzzard MHC and phylogenetic inference revealed that trans-species polymorphism is present between common buzzards and species separated for over 33 million years for class I and class II.ConclusionsWe characterize and confirm the functionality of unexpectedly high copy number and allelic diversity in both MHC classes of a bird of prey. While balancing selection is acting on both classes, there is no evidence of differential selection pressure on MHC classes in common buzzards and this result may hold more generally once more data for understudied MHC exons becomes available.

Multiplexed long-read plasmid validation and analysis using OnRamp.

Recombinant plasmid vectors are versatile tools that have facilitated discoveries in molecular biology, genetics, proteomics, and many other fields. As the enzymatic and bacterial processes used to create recombinant DNA can introduce errors, sequence validation is an essential step in plasmid assembly. Sanger sequencing is the current standard for plasmid validation; however, this method is limited by an inability to sequence through complex secondary structure and lacks scalability when applied to full-plasmid sequencing of multiple plasmids owing to read-length limits. Although high-throughput sequencing does provide full-plasmid sequencing at scale, it is impractical and costly when used outside of library-scale validation. Here, we present Oxford nanopore-based rapid analysis of multiplexed plasmids (OnRamp), an alternative method for routine plasmid validation that combines the advantages of high-throughput sequencing's full-plasmid coverage and scalability with Sanger's affordability and accessibility by leveraging nanopore's long-read sequencing technology. We include customized wet-laboratory protocols for plasmid preparation along with a pipeline designed for analysis of read data obtained using these protocols. This analysis pipeline is deployed on the OnRamp web app, which generates alignments between actual and predicted plasmid sequences, quality scores, and read-level views. OnRamp is designed to be broadly accessible regardless of programming experience to facilitate more widespread adoption of long-read sequencing for routine plasmid validation. Here we describe the OnRamp protocols and pipeline and show our ability to obtain full sequences from pooled plasmids while detecting sequence variation even in regions of high secondary structure at less than half the cost of equivalent Sanger sequencing.

Copy number variants from 4800 exomes contribute to ~7% of genetic diagnoses in movement disorders, muscle disorders and neuropathies

Various groups of neurological disorders, including movement disorders and neuromuscular diseases, are clinically and genetically heterogeneous. Diagnostic panel-based exome sequencing is a routine test for these disorders. Despite the success rates of exome sequencing, it results in the detection of causative sequence variants in ‘only’ 25–30% of cases. Copy number variants (CNVs), i.e. deletion or duplications, explain 10–20% of individuals with multisystemic phenotypes, such as co-existing intellectual disability, but may also have a role in disorders affecting a single system (organ), like neurological disorders with normal intelligence. In this study, CNVs were extracted from clinical exome sequencing reports of 4800 probands primarily with a movement disorder, myopathy or neuropathy. In 88 (~2%) probands, phenotype-matching CNVs were detected, representing ~7% of genetically confirmed cases. CNVs varied from involvement of over 100 genes to single exons and explained X-linked, autosomal dominant, or - recessive disorders, the latter due to either a homozygous CNV or a compound heterozygous CNV with a sequence variant on the other allele. CNVs were detected affecting genes where deletions or duplications are established as a common mechanism, like PRKN (in Parkinson’s disease), DMD (in Duchenne muscular dystrophy) and PMP22 (in neuropathies), but also genes in which no intragenic CNVs have been reported to date. Analysis of CNVs as part of panel-based exome sequencing for genetically heterogeneous neurological diseases provides an additional diagnostic yield of ~2% without extra laboratory costs. Therefore it is recommended to perform CNV analysis for movement disorders, muscle disease, neuropathies, or any other single-system disorder.

Low-pass whole-genome and targeted sequencing of cell-free DNA from cerebrospinal fluid in pediatric patients with central nervous system tumors.

Central nervous system tumors are the most common pediatric solid tumors and the most frequent cause of cancer-related morbidity in childhood. Significant advances in understanding the molecular features of these tumors have facilitated the development of liquid biopsy assays that may aid in diagnosis and monitoring response to therapy. In this report, we describe our comprehensive liquid biopsy platform for detection of genome-wide copy number aberrations, sequence variants, and gene fusions using cerebrospinal fluid (CSF) from pediatric patients with brain, spinal cord, and peripheral nervous system tumors. Cell-free DNA was isolated from the CSF from 55 patients, including 47 patients with tumors and 8 controls. Abnormalities in cell-free DNA were detected in 24 (51%) patients including 11 with copy number alterations, 9 with sequence variants, and 7 with KIAA1549::BRAF fusions. Positive findings were obtained in patients spanning histologic subtypes, tumor grades, and anatomic locations. This study demonstrates the feasibility of employing this platform in routine clinical care in upfront diagnostic and monitoring settings. Future studies are required to determine the utility of this approach for assessing response to therapy and long-term surveillance.

P562: Sequence and copy number variant detection in autosomal recessive conditions utilizing tiered-testing approach

P562: Sequence and copy number variant detection in autosomal recessive conditions utilizing tiered-testing approach

Germline mismatch repair (MMR) gene analyses from English NHS regional molecular genomics laboratories 1996–2020: development of a national resource of patient-level genomics laboratory records

ObjectiveTo describe national patterns of National Health Service (NHS) analysis of mismatch repair (MMR) genes in England using individual-level data submitted to the National Disease Registration Service (NDRS) by the...

Identification of differentially methylated regions in rare diseases from a single-patient perspective

BackgroundDNA methylation (5-mC) is being widely recognized as an alternative in the detection of sequence variants in the diagnosis of some rare neurodevelopmental and imprinting disorders. Identification of alterations in DNA methylation plays an important role in the diagnosis and understanding of the etiology of those disorders. Canonical pipelines for the detection of differentially methylated regions (DMRs) usually rely on inter-group (e.g., case versus control) comparisons. However, these tools might perform suboptimally in the context of rare diseases and multilocus imprinting disturbances due to small cohort sizes and inter-patient heterogeneity. Therefore, there is a need to provide a simple but statistically robust pipeline for scientists and clinicians to perform differential methylation analyses at the single patient level as well as to evaluate how parameter fine-tuning may affect differentially methylated region detection.ResultWe implemented an improved statistical method to detect differentially methylated regions in correlated datasets based on the Z-score and empirical Brown aggregation methods from a single-patient perspective. To accurately assess the predictive power of our method, we generated semi-simulated data using a public control population of 521 samples and investigated how the size of the control population, methylation difference, and region size affect DMR detection. In addition, we validated the detection of methylation events in patients suffering from rare multi-locus imprinting disturbance and evaluated how this method could complement existing tools in the context of clinical diagnosis.ConclusionIn this study, we present a robust statistical method to perform differential methylation analysis at the single patient level and describe its optimal parameters to increase DMRs identification performance. Finally, we show its diagnostic utility when applied to rare disorders.

Generation of DNA Methylation Signatures and Classification of Variants in Rare Neurodevelopmental Disorders Using EpigenCentral.

There are more than 700 genes that encode proteins that function in epigenetic regulation and chromatin modification. Germline variants in these genes (typically heterozygous) are associated with rare neurodevelopmental disorders (NDDs) characterized by growth abnormalities and intellectual and developmental delay. Advancements in next-generation sequencing have dramatically increased the detection of pathogenic sequence variants in genes encoding epigenetic machinery associated with NDDs and, concurrently, the number of clinically uninterpretable variants classified as variants of uncertain significance (VUS). Recently, DNA methylation (DNAm) signatures, disorder-specific patterns of DNAm change, have emerged as a functional tool that provides insights into disorder pathophysiology and can classify pathogenicity of variants in NDDs. To date, our group and others have identified DNAm signatures for more than 60 Mendelian neurodevelopmental disorders caused by variants in genes encoding epigenetic machinery. There is broad interest in both the research and clinical communities to develop and catalog DNAm signatures in rare NDDs, but there are challenges in optimizing study design considerations and availability of platforms that integrate bioinformatics tools with the appropriate statistical framework required to analyze genome-wide DNAm data. We previously published EpigenCentral, a platform for analysis of DNAm data in rare NDDs. In this article, we utilize the published Weaver syndrome dataset to provide step-by-step protocols for using EpigenCentral for exploratory analysis to identify DNAm signatures and for classification of NDD variants. We also provide important considerations for experimental design and interpretation of DNAm results. © 2022 Wiley Periodicals LLC. Basic Protocol 1: Exploratory analysis to identify disorder-specific DNAm signatures Basic Protocol 2: Classification of variants associated with neurodevelopmental disorders.

LiftoffTools: a toolkit for comparing gene annotations mapped between genome assemblies

In 2020 we published Liftoff, which was the first standalone tool specifically designed for transferring gene annotations between genome assemblies of the same or closely related species. While the gene content is expected to be very similar in closely related genomes, the differences may be biologically consequential, and a computational method to extract all gene-related differences should prove useful in the analysis of such genomes. Here we present LiftoffTools, a toolkit to automate the detection and analysis of gene sequence variants, synteny, and gene copy number changes.  We provide a description of the toolkit and an example of its use comparing genes mapped between two human genome assemblies.