Function Of Dendritic Cells Research Articles

Sepsis-Related Lung Injury and the Complication of Extrapulmonary Pneumococcal Pneumonia.

Globally, sepsis and pneumonia account for significant mortality and morbidity. A complex interplay of immune-molecular pathways underlies both sepsis and pneumonia, resulting in similar and overlapping disease characteristics. Sepsis could result from unmanaged pneumonia. Similarly, sepsis patients have pneumonia as a common complication in the intensive care unit. A significant percentage of pneumonia is misdiagnosed as septic shock. Therefore, our knowledge of the clinical relationship between pneumonia and sepsis is imperative to the proper management of these syndromes. Regarding pathogenesis and etiology, pneumococcus is one of the leading pathogens implicated in both pneumonia and sepsis syndromes. Growing evidence suggests that pneumococcal pneumonia can potentially disseminate and consequently induce systemic inflammation and severe sepsis. Streptococcus pneumoniae could potentially exploit the function of dendritic cells (DCs) to facilitate bacterial dissemination. This highlights the importance of pathogen-immune cell crosstalk in the pathophysiology of sepsis and pneumonia. The role of DCs in pneumococcal infections and sepsis is not well understood. Therefore, studying the immunologic crosstalk between pneumococcus and host immune mediators is crucial to elucidating the pathophysiology of pneumonia-induced lung injury and sepsis. This knowledge would help mitigate clinical diagnosis and management challenges.

Blocking senescence and tolerogenic function of dendritic cells induced by γδ Treg cells enhances tumor-specific immunity for cancer immunotherapy

BackgroundRegulatory T (Treg) cells are a key component in maintaining the suppressive tumor microenvironment and immune suppression in different types of cancers. A precise understanding of the molecular mechanisms used...

Tolerogenic dendritic cell-mediated regulatory T cell differentiation by Chinese herbal formulation attenuates colitis progression

IntroductionUlcerative colitis (UC) is a chronic inflammatory disease characterized by loss of immune tolerance to luminal antigens and progressive intestinal tissue injury. Thus, the re-establishment of immune tolerance is crucial for suppressing aberrant immune responses and UC progression. ObjectivesThis study aimed to investigate the mechanisms underlying the action of CDD-2103 and its bioactive compounds in mediating immune regulation in mouse models of colitis. MethodsTwo experimental colitis models, chronic 2,4,6-trinitrobenzene sulfonic acid (TNBS)- and T-cell transfer-induced Rag1-/- mice, were used to determine the effects of CDD-2103 on colitis progression. Single-cell transcriptome analysis was used to profile the immune landscape and its interactions after CDD-2103 treatment. Liquid chromatography-mass spectrometry (LC-MS) was used to analyze the major components interacting with lymphoid cells. A primary cell co-culture system was used to confirm the effects of bioactive component. ResultsCDD-2103 dose-dependently suppresses the progression of colitis induced by chemicals or T cell transplantation in Rag1-/- mice. The effect of CDD-2103 is primarily attributable to an increase in the de novo generation of regulatory T cells (Tregs) in the lamina propria (LP). Single-cell transcriptomic analysis revealed that CDD-2103 treatment increased the number of tolerogenic dendritic cells (DCs). Mechanistically, CDD-2103 promoted tolerogenic DCs accumulation and function by upregulating several genes in the electron transport chain related to oxidative phosphorylation, leading to increased differentiation of Tregs. Further LC-MS analysis identified several compounds in CDD-2103, particularly those distributed within the mesenteric lymph nodes of mice. Subsequent studies revealed that palmatine and berberine promoted tolerogenic bone marrow-derived dendritic cells (BMDC)-mediated Treg differentiation. ConclusionOverall, our study demonstrated that the clinically beneficial effect of CDD-2103 in the treatment of UC is based on the induction of immune tolerance. In addition, this study supports berberine and palmatine as potential chemical entities in CDD-2103 that modulate immune tolerance.

Adipose-derived stem cell modulate tolerogenic dendritic cell-induced T cell regulation is correlated with activation of Notch-NFκB signaling

BackgroundAdipose-derived stem cells (ASCs) are recognized for their potential immunomodulatory properties. In the immune system, tolerogenic dendritic cells (DCs), characterized by an immature phenotype, play a crucial role in inducing regulatory T cells (Tregs) and promoting immune tolerance. Notch1 signaling has been identified as a key regulator in the development and function of DCs. However, the precise involvement of Notch1 pathway in ASC-mediated modulation of tolerogenic DCs and its impact on immune modulation remain to be fully elucidated. This study aims to investigate the interplay between ASCs and DCs, focusing the role of Notch1 signaling and downstream pathways in ASC-modulated tolerogenic DCs. MethodsRat bone marrow-derived myeloid DCs were directly co-cultured with ASCs to generate ASC-treated DCs (ASC-DCs). Notch signaling was inhibited using DAPT, while NFκB pathways were inhibited by NEMO binding domain peptide and si-NIK. Flow cytometry assessed DC phenotypes. Real-time quantitative PCR, Western blotting and immunofluorescence determined the expression of Notch1, Jagged1 and the p52/RelB complex in ASC- DCs. ResultsNotch1 and Jagged1 were highly expressed on both DCs and ASCs. ASC-DCs displayed significantly reduced levels of CD80, CD86 and MHC II compared to mature DCs. Inhibiting the Notch pathway with DAPT reversed the dedifferentiation effects. The percentage of induced CD25+/FOXP3+/CD4+ Tregs decreased when ASC-DCs were treated with DAPT (inhibition of the Notch pathway) and si-NIK (inhibition of the non-canonical NFκB pathway). ConclusionsASCs induce DC tolerogenicity by inhibiting maturation and promoting downstream Treg generation, involving the Notch and NFκB pathways. ASC-induced tolerogenic DCs can be a potential immunomodulatory tool for clinical application.

Optimal conditions for adenoviral transduction of immature dendritic cells without affecting the tolerogenic activity of DC-based immunotherapy

Dendritic cells (DCs) play a pivotal role in maintaining immune tolerance. Using recombinant adenovirus (rAd) to deliver vectors to immature dendritic cells (imDCs) is an important method for studying the tolerogenic function of DCs. We found that using RPMI medium and a higher MOI during transduction increased the expression of CD80, CD86, and MHC-II on the surface of imDCs. Our data reveal a significant increase in the secretion of the pro-inflammatory cytokine IL-6 in the group showing the most pronounced phenotypic changes. In the mouse heart transplant model, imDCs with unstable phenotype and function due to adenoviral transduction resulted in an increased proportion of Th1 and Th17 cells in recipients. However, these effects can be managed, and our proposed optimized transduction strategy significantly minimizes these adverse effects. Our study holds significant implications for the development and optimization of immunotherapy utilizing tolerogenic dendritic cells.

Abstract 5343: Depletion of gut microbiota with broad spectrum antibiotics drives Pten-null prostate cancer growth in mice

Abstract Gut microbes have the potential to be either promoters or inhibitors of cancer. Use of antibiotics during cancer therapy can lead to dysbiosis, which may affect treatment outcomes. Here, we examine the effects of broad-spectrum antibiotics on cancer progression in mice with Pten-null castration resistant prostate cancer (CRPC). After five or eight weeks, orchiectomized conditional Pten-null knockout (KO) mice aged 50 and 90 weeks were given two biweekly cycles of a broad-spectrum antibody cocktail (BSAbx), respectively. The effects of BSAbx on tumor burden were compared, and molecular and immunological responses were analyzed by quantitative IHC (qIHC) and qRt-PCR at week four after antibiotic treatment. BSAbx treatment resulted in tumor burdens of 1.2 and 2.4-fold higher than in control mice in mice aged 50 and 90 weeks, respectively. qIHC analysis of KI67 showed increased proliferation in stromal and cancer cells. Additionally, androgen receptor (AR) protein and gene expression levels of Ar and Ar target genes (Fkbp5, Tmprss2, and Timp4) were elevated in tumors of BSAbx-treated mice. Restoring gut microbiota by fecal microbiota transplantation (FMT) from KO mice CRPC after BSAbx restored AR transcriptional activity to basal levels and lessened tumor growth. FMT from non-castrated KO with castration-naïve prostate cancer or heathy wildtype mice further reduced AR Transcriptional activity. Moreover, altering the gut microbiota of CRPC mice with FMT from heathy mice resulted in a tendency for lower tumor burden, 21% reduction versus control mice. Immunologically, BSAbx treatment resulted in decreased CD11b+/GR1+ cells in tumors and were associated with decreased interferon-gamma (IFN-gamma), dendritic cell functions and T cell-mediated cytotoxicity gene signatures. Mice that received FMT form health mice showed enhanced T cell mediated immunity as demonstrated by higher IFN-gamma signatures and tumor abundances of CD8+ T cells expression IFN-gamma, TNF-alpha and the cytotoxic granule granzyme B. Our study shows that broad spectrum antibiotics caused dysbiosis and promoted prostate cancer growth in mice with Pten-null prostate cancer. The effects were partly mediated through the upregulation of AR signaling and the impairment of neutrophil and T cell-mediated immune responses in tumors. Citation Format: Marco A. De Velasco, Yurie Kura, Kazuko Sakai, Mitsuhisa Nishimoto, Yasunori Mori, Kazuhiro Yoshimura, Kazutoshi Fujita, Kazuto Nishio, Hirotsugu Uemura. Depletion of gut microbiota with broad spectrum antibiotics drives Pten-null prostate cancer growth in mice [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 5343.

Abstract 2476: Electroporation-mediated novel albumin-fused Flt3L DNA delivery promotes cDC1-associated anticancer immunity

Abstract Introduction: Dendritic cells (DCs) constitute a distinct type of immune cell found within tumors, serving a central role in mediating tumor antigen-specific immunity against cancer cells. Frequently, DC functions are dysregulated by the immunosuppressive signals present within the tumor microenvironment (TME). Consequently, DC manipulation holds great potential to enhance the cytotoxic T cell response against cancer diseases. The Fms-like tyrosine kinase receptor 3 ligand (Flt3L) is a pluripotent growth factor that regulates the maturation and differentiation of DCs in hematopoiesis. The in vivo administration of Flt3L itself is limited by its short serum half-life. To overcome this major drawback, our group developed a novel fusion protein albumin-Flt3L (alb-Flt3L), which is the conjugation of albumin to Flt3L. Our hypothesis is that the Flt3L, which has extended bioavailability, is a feasible therapeutic strategy to overcome these treatment limitations. Method: A novel alb-Flt3L DNA, a plasmid encoding the alb-Flt3L protein, was administrated for its anti-tumor effect on TC-1 tumor-bearing C57BL/6 mice. For the generation of pcDNA3-albFlt3L, mouse Flt3 ligand was amplified by PCR using cDNA template of pcDNA3-Flt3L1 and a set of primers, 5′- TTTGAATTCGGGACACCTGACTGTTACTTC-3′ and 5′- AAACTTAAGCTACTGCCTGGGCCGAGGCTCTGG -3′. alb-Flt3L DNA (10ug), Flt3L DNA (10ug) or vehicle control was injected intratumorally followed by electroporation for a total of three times in 5-day intervals. Peripheral blood mononuclear cells and tumor-infiltrated immune cells were isolated after treatment. Flow cytometry was performed for immune cell analysis. Results: In this current study, the electroporation-mediated delivery of alb-Flt3L DNA demonstrated the ability to induce an anti-tumor immune response. This albumin fusion construct possesses more persistent bioactivity in targeted organs. Furthermore, mice receiving alb-Flt3L DNA treatment presented better tumor control and superior survival. Cellular analysis revealed that alb-Flt3L DNA administration displayed greater systemic DC population. In addition, robust cDC1 expansion, which is associated with superior antigen cross-presentation and cellular immunity against tumors, developed extensively in the tumor, lymph node, and blood. In addition, increased levels of IFN-γ-secreting CD8+ lymphocytes and tumor-infiltrated immune cells were found in correlation to greater cDC1 population. Conclusion: Our data showcases a novel DC-based immunotherapy using electroporation to administer alb-Flt3L DNA. The treatment effect is revealed by a controlled tumor response, characterized by enhanced DC mobilization and accumulation in both the lymph nodes and TME, coupled with an increase in the expansion of cDC1 subsets and a heightened level of CD8+ T cell activation. Citation Format: Ming-Hung Hu, Tzyy-Choou Wu, Chien-Fu Hung. Electroporation-mediated novel albumin-fused Flt3L DNA delivery promotes cDC1-associated anticancer immunity [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 2476.

Abstract 97: A E2F6 ceRNA network suppresses dendritic cell function, via PBX1/IL-10 signaling, in ovarian cancer

Abstract It is reported that long-term use of estrogen could increase the risk of ovarian cancer. However, the role of estrogen in immunoevasion is not fully explored. We have previously demonstrated that estrogen-mediated upregulation of E2F6, and, c-Kit, by epigenetic silencing of miR-193a, and a competing endogenous (ceRNA) mechanism. In this study, we found that PBX1, a transcriptional activator of the immunosuppressive cytokine, IL-10, is also a target of miR-193a. Importantly, overexpression of the E2F6 3’UTR upregulates both E2F6 and, PBX1, as well as IL10 in ovarian cancer cell lines, suggesting that ceRNA mechanism exists between E2F6 and PBX1. These phenomena are further supported by our stochastic simulation of the estrogen-mediated E2F6 ceRNA network on the distribution of E2F6 and PBX1 mRNA in cancer cells, which is consistent with the TCGA ovarian cancer RNA-Seq dataset. Importantly, monocyte-derived dendritic cell activation of T-cell function was inhibited by pretreatment of conditioned media derived from ovarian cancer cells overexpressing E2F6 3’UTR; such inhibition was rescueable by an anti-IL-10 antibody. Clinically, IL10 level was higher in ovarian cancer patients with higher E2F6 and PBX1, and in ovarian cancer cell lines overexpressed with E2F6 3’UTR. Taken together, these results showed that E2F6 could suppress anti-tumor immune response of dendritic cell, E2F6 ceRNA network. Epigenetic intervention in restoring the expression of miR-193a may be able to enhance anti-tumor immune response against ovarian cancer. Citation Format: Michael W.Y. Chan, Yin-Chen Chen, Ching-Wen Lin, Frank Cheng, Ching-Cher Sanders Yan, Chao-Ping Hsu, Yu-Min Chuang, Jie-Ting Low, Xiaojing Ma, Yao-Ting Huang, Chia-Bin Chang, Chin Li, Hung-Cheng Lai, Shu-Fen Wu, Shih-Hsun Hung, Je-Chiang Tsai. A E2F6 ceRNA network suppresses dendritic cell function, via PBX1/IL-10 signaling, in ovarian cancer [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 97.

Abstract 1363: Blocking inhibitory receptor ILT3 by an antibody with enhanced Fc function promoted adaptive immunity against hematopoietic malignancy independent of ADCC

Abstract Immunoglobulin-like transcript 3 (ILT3) is an inhibitory receptor that is expressed by mature monocytes, dendritic cells (DC), plasma blasts, and the malignant cells arising thereof including acute myeloid leukemia (AML), B cell lymphoma and multiple myeloma (MM). We developed an anti-ILT3 blocking monoclonal antibody (mAb) 17G8 to test the hypothesis that blockade of ILT3 on hematopoietic malignant cells might drive anti-cancer responses through several mechanisms such as cell migration, ADCC, and T cell driven immune responses. Blockade of ILT3 using 17G8 without Fc effector function impaired AML cell line THP1 dissemination into distant sites in vivo and using 17G8 with enhanced Fc function through afucosylation further reduced the tumor burden. This effect of afucosylated 17G8 appears to be mediated by a mechanism other than ADCC, since afucosylated 17G8 showed modest tumor inhibition in ICR mice carrying ILT3 positive AML and MM xenografts. In immune competent mice carrying murine syngeneic AML cell C1498 expressing human ILT3, 17G8 also showed modest anti-tumor effects as a single agent, however, when combined with anti-PD1, afucosylated 17G8 increased CD8+ effector memory T cells, reduced proportion of cells with an exhausted phenotype and significantly improved survival when compared to different controls. Since T cells don’t express ILT3, the effects of 17G8 on T cells are hypothesized to be mediated by blocking ILT3 expressed on myeloid cells. The expression of ILT3 on immature human monocyte-derived DC (moDC) is higher than on mature moDC. Blocking ILT3 with afucosylated 17G8 on immature moDC potentiated maturation of moDC when compared to the controls in vitro. Surprisingly, afucosylated 17G8 stimulated IFNγ production from moDC during maturation. The enhanced DC function induced by afucosylated 17G8 was subsequently found to be translated into enhanced T cell function in an allogeneic mixed lymphocyte reaction (allo-MLR) assay, in which afucosylated 17G8 significantly increased IFNγ production when combined with anti-PD1. The activation of effector T cells was also monitored through a cytotoxicity assay by mixing THP-1 cells with human PBMC in culture. Afucosylated 17G8 induced strong cytotoxicity on THP-1 cells with minimal effects on normal ILT3 positive cells such as monocytes or moDC, suggesting that blockade of ILT3 with afucosylated 17G8 induced more potent T cell mediated allogeneic cytotoxicity than innate cell mediated ADCC killing. In summary, ILT3 is a highly selective M4/M5 AML target. Developing a blocking antibody with enhanced Fc function could add an additional therapeutic strategy of inducing host anti-tumor immunity to current AML treatments which induce direct tumor killing, such as chemotherapy, targeted therapy, and antibody drug conjugate. Citation Format: Shiming Ye, Dong Zhang, Min-Zu Wu, Harini Raghu, Diane Cohen, Mally Romero, Siu-Sze Tan, Donghee Choi, Jonathan Hickson, John Engelhardt, Alex Shoemaker. Blocking inhibitory receptor ILT3 by an antibody with enhanced Fc function promoted adaptive immunity against hematopoietic malignancy independent of ADCC [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 1363.

Abstract 2966: Senescent cancer cell vaccines induce cytotoxic T cell responses targeting primary tumors and disseminated tumor cells

Abstract Diverse conventional cancer therapies, including genotoxic agents and cell cycle or cell division-targeting drugs, can trigger cancer cell senescence. Senescent cells (SnCs) induced by cancer therapy often display unrepaired chromosomal damage but persist indefinitely. SnCs remain metabolically active and display distinct alterations in transcription, secretion, and membrane protein expression/presentation. While initially viewed as a favorable outcome and likely tumor-suppressive mechanism, therapy-induced senescence has more recently been recognized as contributing to resistance, recurrence and metastasis. Adverse effects may be mediated in part by release of inflammatory mediators as components of the senescence-associated secretory phenotype (SASP). Recent studies have argued for reconsidering the potential benefits of therapy-induced senescence, especially in modulating the tumor microenvironment to potentiate anti-tumor immunity and potentiate immunotherapy. We have explored the potential for SnCs to serve as vaccines, building upon prior findings where we demonstrated the immunogenic senescence triggered by the combination of ionizing radiation (IR) and the PARP1/2 inhibitor veliparib. We find that SnCs are avidly taken up by type I conventional, CD11c+/CD103+ dendritic cells (DCs), promoting their activation and maturation. Thereby, SnCs promote DC function in T cell priming and stimulation. The capacity of SnCs to activate DCs depends on how the SnCs are formed, with our results confirming IR+veliparib induces high immunogenicity and implicating a distinct SASP in these effects. On the other hand, blocking STING signaling limits SnC activation of DCs. In vivo experiments with the murine tumor models CT26 and 4T1 suggest that both SnCs and SnC-pulsed DCs serve as effective anti-tumor vaccines. They not only confer protective immunity against tumor engraftment but also act as therapeutic vaccines, inhibiting both primary and disseminated tumor growth, and synergize with radiotherapy and immune checkpoint blockade. While direct administration of tumor-derived SnCs to patients may raise safety concerns, pulsing autologous DCs with tumor SnCs may help drive anti-tumor immune response, offering a promising path toward personalized cancer immunotherapy. Citation Format: Yue Liu, Joanna Pagacz, Donald J. Wolfgeher, Stephen J. Kron. Senescent cancer cell vaccines induce cytotoxic T cell responses targeting primary tumors and disseminated tumor cells [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 2966.

Abstract 2471: State-of-the-art Specific T cell Activating Modulator on ePENDY platform (STAM.eP) activates specific CD8+ T cell by stimulating TCR signal

Abstract After decades of research, therapeutic cancer vaccine approach now sheds light on developing efficient cancer therapy treating patients who have resistance to other cancer immunotherapy. However, cancer vaccine approach using conventional modalities such as protein, peptide, and mRNA is considered a powerful cancer treatment only when the patients have healthy immune systems. In addition, dendritic cell (DC) cancer vaccine can be a great alternative therapy, but manufacture of DC vaccines in vitro is a labor-intensive, time- and money-consuming procedure. Here, we developed Specific T cell Activating Modulator (STAM) on our engineered IgM backbone, ePENDY (engineered PENtamer boDY), with high avidity based on multivalent binding sites to overcome the disadvantages of other therapeutic cancer vaccines. STAM on ePENDY (STAM.eP) consists of ten peptide-loaded-HLAs linked to ePENDY to simulate priming signal of CD8+ T cell by TCR cluster and a costimulatory signal molecule is linked to J chain of ePENDY to prevent CD8+ T cell from becoming anergic status. With these features, STAM.eP mimics cognately licensed DC that can present tumor peptide-loaded MHC class I molecule to CD8+ T cell and promote its priming. Thus, one of the greatest advantages of STAM.eP is to be a potential treatment for immunosuppressive cancer patients with DCs that do not respond appropriately. Another advantage is that any tumor specific antigen (TSA), including from intracellular proteins, can be applied to STAM.eP concept to activate specific CD8+ T cells for targeting cancer cells. In this study, we used Human Papillomavirus (HPV) E7-derived peptide which is an oncoprotein associated with cervical and head/neck cancers. We observed that HPV E7-derived peptide loaded STAM.eP, named IMB-401, increases antigen-specific CD8+ T cell population and shows cytotoxicity activity against cancer cells expressing HPV E7 protein in vitro test model. In vivo test model, it was also observed that population of specific CD8+ T cells and memory T cells were increased in the blood and spleens of transgenic mice treated with IMB-401. Furthermore, we confirmed that IMB-401 shows anti-tumor efficacy due to an increase of antigen-specific CD8+ T cell in vivo humanized mouse model. These results suggest that IMB-401 can be a new therapeutic cancer vaccine technology that replaces DC function and is expected to have robust anti-tumor activity in combination with immune checkpoint inhibitors. Citation Format: Kyung-gi Hyun, Sungmuk Kang, Yongjun Kang, Jihye Koo, Suho Park, Sunghyun Byun, Sunghyun Yoon, Jaebeom Lee, Hong Jai Lee, Hong Kyu Lee, Eunyoung Cho, Chungmin Lee, Kyung-Chul Choi, Gyongsik Ha. State-of-the-art Specific T cell Activating Modulator on ePENDY platform (STAM.eP) activates specific CD8+ T cell by stimulating TCR signal [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 2471.

Development of Cell Technologies Based on Dendritic Cells for Immunotherapy of Oncological Diseases.

Immunotherapy using dendritic cell-based vaccination is a natural approach using the capabilities and functions inherent in the patient's immune system to eliminate tumor cells. The development of dendritic cell-based cell technologies evolved as the disorders of dendritic cell differentiation and function in cancer were studied; some of these functions are antigen presentation, priming of cytotoxic T-lymphocytes and induction of antigen-specific immune responses. At the initial stage of technology development, it was necessary to develop protocols for the in vitro generation of functionally mature dendritic cells that were capable of capturing tumor antigens and processing and presenting them in complex with MHC to T-lymphocytes. To achieve this, various forms of tumor-associated antigen delivery systems were tested, including lysates, tumor cell proteins (peptides), and DNA and RNA constructs, and it was shown that the use of DNA and RNA constructs was the most effective method, as it made it possible not only to deliver the most immunogenic epitopes of tumor-associated antigens to dendritic cells, but also to enhance their ability to induce antigen-specific cytotoxic T-lymphocytes. Currently, cell therapy based on dendritic cells is a modern basis for antigen-specific immunotherapy of cancer due to the simplicity of creating DNA and RNA constructs encoding information about both target tumor antigens and regulatory molecules. The potential development of cell technologies based on dendritic cells aims to obtain antigen-specific cytotoxic T-lymphocytes induced by dendritic cells, study their functional activity and develop cell-based therapy.

CDC2 plasticity and acquisition of a DC3-like phenotype mediated by IL-6 and PGE2 in a patient-derived colorectal cancer organoids model.

Metastatic colorectal cancer (CRC) is highly resistant to therapy and prone to recur. The tumor-induced local and systemic immunosuppression allows cancer cells to evade immunosurveillance, facilitating their proliferation and dissemination. Dendritic cells (DCs) are required for the detection, processing, and presentation of tumor antigens, and subsequently for the activation of antigen-specific T cells to orchestrate an effective antitumor response. Notably, successful tumors have evolved mechanisms to disrupt and impair DC functions, underlining the key role of tumor-induced DC dysfunction in promoting tumor growth, metastasis initiation, and treatment resistance. Conventional DC type 2 (cDC2) are highly prevalent in tumors and have been shown to present high phenotypic and functional plasticity in response to tumor-released environmental cues. This plasticity reverberates on both the development of antitumor responses and on the efficacy of immunotherapies in cancer patients. Uncovering the processes, mechanisms, and mediators by which CRC shapes and disrupts cDC2 functions is crucial to restoring their full antitumor potential. In this study, we use our recently developed 3D DC-tumor co-culture system to investigate how patient-derived primary and metastatic CRC organoids modulate cDC2 phenotype and function. We first demonstrate that our collagen-based system displays extensive interaction between cDC2 and tumor organoids. Interestingly, we show that tumor-corrupted cDC2 shift toward a CD14+ population with defective expression of maturation markers, an intermediate phenotype positioned between cDC2 and monocytes, and impaired T-cell activating abilities. This phenotype aligns with the newly defined DC3 (CD14+ CD1c+ CD163+) subset. Remarkably, a comparable population was found to be present in tumor lesions and enriched in the peripheral blood of metastatic CRC patients. Moreover, using EP2 and EP4 receptor antagonists and an anti-IL-6 neutralizing antibody, we determined that the observed phenotype shift is partially mediated by PGE2 and IL-6. Importantly, our system holds promise as a platform for testing therapies aimed at preventing or mitigating tumor-induced DC dysfunction. Overall, our study offers novel and relevant insights into cDC2 (dys)function in CRC that hold relevance for the design of therapeutic approaches.

Immunomodulatory and Anti-Inflammatory Effects of Vitamin A and Tryptophan on Monocyte-Derived Dendritic Cells Stimulated with Gliadin in Celiac Disease Patients.

Celiac Disease (CeD) is an autoimmune disorder with various symptoms upon gluten exposure. Dendritic cells (DCs) play a crucial role in gliadin-induced inflammation. Vitamin A (retinol; Ret) and its metabolite, retinoic acid (RA), along with tryptophan (Trp) and its metabolite, kynurenic acid (KYNA), are known to influence the immune function of DCs and enhance their tolerogenicity. This research aims to assess the impact of gliadin on DC maturation and the potential of vitamin A and tryptophan to induce immune tolerance in DCs. The monocyte cells obtained from peripheral blood mononuclear cells (PBMCs) of celiac disease patients were differentiated into DCs in the absence or presence of Ret, RA, Trp, KYNA, and then stimulated with peptic and tryptic (PT) digested of gliadin. We used flow cytometry to analyze CD11c, CD14, HLA-DR, CD83, CD86, and CD103 expression. ELISA was carried out to measure TGF-β, IL-10, IL-12, and TNF-α levels. qRT-PCR was used to assess the mRNA expression of retinaldehyde dehydrogenase 2 (RALDH2) and integrin αE (CD103). The mRNA and protein levels of Indoleamine 2, 3-dioxygenase (IDO) was analyzed by qRT-PCR and Western blot assays, respectively. Our findings demonstrate that PT-gliadin enhances the expression of maturation markers, i.e. CD83, CD86 and HLA-DR and promote the secretion of TNF-α and IL-12 in DCs. Interestingly, vitamin A, tryptophan, and their metabolites increase the expression of CD103, while limiting the expression of HLA-DR, CD83, and CD86. They also enhance RALDH2 and IDO expression and promote the secretion of TGF-β and IL-10, while limiting IL-12 and TNF-α secretion. These findings suggest that vitamin A and tryptophan have beneficial effects on PT-gliadin-stimulated DCs, highlighting their potential as therapeutic agents for celiac disease. However, further research is needed to fully understand their underlying mechanisms of action in these cells.

Innovative prognostic modeling in ESCC: leveraging scRNA-seq and bulk-RNA for dendritic cell heterogeneity analysis.

Globally, esophageal squamous cell carcinoma (ESCC) stands out as a common cancer type, characterized by its notably high rates of occurrence and mortality. Recent advancements in treatment methods, including immunotherapy, have shown promise, yet the prognosis remains poor. In the context of tumor development and treatment outcomes, the tumor microenvironment (TME), especially the function of dendritic cells (DCs), is significantly influential. Our study aims to delve deeper into the heterogeneity of DCs in ESCC using single-cell RNA sequencing (scRNA-seq) and bulk RNA analysis. In the scRNA-seq analysis, we utilized the SCP package for result visualization and functional enrichment analysis of cell subpopulations. CellChat was employed to identify potential oncogenic mechanisms in DCs, while Monocle 2 traced the evolutionary trajectory of the three DC subtypes. CopyKAT assessed the benign or malignant nature of cells, and SCENIC conducted transcription factor regulatory network analysis, offering a preliminary exploration of DC heterogeneity. In Bulk-RNA analysis, we constructed a prognostic model for ESCC prognosis and immunotherapy response, based on DC marker genes. This model was validated through quantitative PCR (qPCR) and immunohistochemistry (IHC), confirming the gene expression levels. In this study, through intercellular communication analysis, we identified GALECTIN and MHC-I signaling pathways as potential oncogenic mechanisms within dendritic cells. We categorized DCs into three subtypes: plasmacytoid (pDC), conventional (cDC), and tolerogenic (tDC). Our findings revealed that pDCs exhibited an increased proportion of cells in the G2/M and S phases, indicating enhanced cellular activity. Pseudotime trajectory analysis demonstrated that cDCs were in early stages of differentiation, whereas tDCs were in more advanced stages, with pDCs distributed across both early and late differentiation phases. Prognostic analysis highlighted a significant correlation between pDCs and tDCs with the prognosis of ESCC (P< 0.05), while no significant correlation was observed between cDCs and ESCC prognosis (P = 0.31). The analysis of cell malignancy showed the lowest proportion of malignant cells in cDCs (17%), followed by pDCs (29%), and the highest in tDCs (48%), with these results being statistically significant (P< 0.05). We developed a robust ESCC prognostic model based on marker genes of pDCs and tDCs in the GSE53624 cohort (n = 119), which was validated in the TCGA-ESCC cohort (n = 139) and the IMvigor210 immunotherapy cohort (n = 298) (P< 0.05). Additionally, we supplemented the study with a novel nomogram that integrates clinical features and risk assessments. Finally, the expression levels of genes involved in the model were validated using qPCR (n = 8) and IHC (n = 16), thereby confirming the accuracy of our analysis. This study enhances the understanding of dendritic cell heterogeneity in ESCC and its impact on patient prognosis. The insights gained from scRNA-seq and Bulk-RNA analysis contribute to the development of novel biomarkers and therapeutic targets. Our prognostic models based on DC-related gene signatures hold promise for improving ESCC patient stratification and guiding treatment decisions.

Retinoic acid-loaded liposomes induce human mucosal CD103+ dendritic cells that inhibit Th17 cells and drive regulatory T-cell development in vitro.

The active vitamin A metabolite, all-trans-retinoic acid (RA), primes precursor dendritic cells (DCs) into a mucosal phenotype with tolerogenic properties characterized by the expression of integrin CD103. CD103+ DCs can counteract pathogenic Th1 and Th17 in inflammatory bowel disease (IBD) or celiac disease (CD). Tolerogenic manipulation of DCs using nanoparticles carrying tolerogenic adjuvants and disease-specific antigens is a valuable treatment strategy to induce antigen-specific mucosal tolerance in vivo. Here, we investigated the effects of RA-loaded liposomes on human DC phenotype and function, including DC-driven T-cell development, both during the generation of monocyte-derived DCs (moDCs) as well as by priming immature moDCs. RA liposomes drove CD103+ DC differentiation as well as ALDH1A2 expression in DCs. Neutrophil-dependent Th17 cell development was reduced by RA-liposome-differentiated and RA-liposome-primed DCs. Moreover, RA liposome treatment shifted T-cell development toward a Th2 cell profile. Importantly, RA liposomes induced the development of IL-10-producing and FoxP3+ regulatory T cells (Tregs) of various Treg subsets, including ICOS+ Tregs, that were potent inhibitors of bystander memory T-cell proliferation. Taken together, RA-loaded liposomes could be a novel treatment avenue for IBD or CD patients.

Rhenium(I) coordinated carbon nitride as type II immunogenic cell death inducers for enhancing photoimmunotherapy against triple-negative breast cancer

Immunotherapy is a promising modality for treating triple-negative breast cancer (TNBC). However, its therapeutic effect is severely restricted by the drug resistance and non-immunogenic tumor microenvironment. Herein, an endoplasmic reticulum (ER)-targeting rhenium(I) coordinated carbon nitride photosensitizer based on Re(CO)5Cl coordinated to g-C3N4 nanosheets can realize photoimmunotherapy against hypoxic-drug resistant TNBC. Compared with the clinical anti-cancer chemotherapy drug doxorubicin, the photosensitizer induces robust ER stress to evoke damage-associated molecular patterns (DAMPs) exposure on the cell surface by a combinatorial interaction mechanism of apoptosis, pyroptosis, ferroptosis, and ICD under two-photon light irradiation. The DAMPs can stimulate the antigen-presenting function of dendritic cells. As a result, a series of immunological responses are activated, including CD8+ and CD4+ T cell proliferation, which effectively inhibited the growth of the primary and secondary distant tumor in vivo. In all, we present a light-dependent type II ICD inducer of metal-based complexes that can conquer drug resistance for hypoxic TNBC, which may have great potential in the substitution of clinical anticancer drugs.

Combined Photothermal Therapy and Cancer Immunotherapy by Immunogenic Hollow Mesoporous Silicon-shelled Gold Nanorods

Hyperthermia can be integrated with tumor-killing chemotherapy, radiotherapy and immunotherapy to give rise to an anti-tumor response. To this end, a nano-delivery system is built, which can connect hyperthermia and immunotherapy. On this basis, the impact of such a combination on the immune function of dendritic cells (DCs) is explored. The core of this system is the photothermal material gold nanorod (GNR), and its surface is covered with a silica shell. Additionally, it also forms a hollow mesoporous structure using the thermal etching approach, followed by modification of targeted molecule folic acid (FA) on its surface, and eventually forms a hollow mesoporous silica gold nanorod (GNR@void@mSiO2) modified by FA. GNR@void@mSiO2-PEG-FA (GVS-FA) performs well in photothermal properties, drug carriage and release and tumor targeting performance. Furthermore, the thermotherapy of tumor cells through in vitro NIR irradiation can directly kill tumor cells by inhibiting proliferation and inducing apoptosis. GVS-FA loaded with imiquimod (R837) can be used as a adjuvant to enhance the immune function of DCs through hyperthermia.

Dendritic Cells in Cancer Immunology and Immunotherapy.

Cancer immunotherapy modulates the immune system, overcomes immune escape and stimulates immune defenses against tumors. Dendritic cells (DCs) are professional promoters of immune responses against tumor antigens with the outstanding ability to coordinate the innate and adaptive immune systems. Evidence suggests that there is a decrease in both the number and function of DCs in cancer patients. Therefore, they represent a strong scaffold for therapeutic interventions. DC vaccination (DCV) is safe, and the antitumoral responses induced are well established in solid tumors. Although the addition of checkpoint inhibitors (CPIs) to chemotherapy has provided new options in the treatment of cancer, they have shown no clinical benefit in immune desert tumors or in those tumors with dysfunctional or exhausted T-cells. In this way, DC-based therapy has demonstrated the ability to modify the tumor microenvironment for immune enriched tumors and to potentiate systemic host immune responses as an active approach to treating cancer patients. Application of DCV in cancer seeks to obtain long-term antitumor responses through an improved T-cell priming by enhancing previous or generating de novo immune responses. To date, DCV has induced immune responses in the peripheral blood of patients without a significant clinical impact on outcome. Thus, improvements in vaccines formulations, selection of patients based on biomarkers and combinations with other antitumoral therapies are needed to enhance patient survival. In this work, we review the role of DCV in different solid tumors with their strengths and weaknesses, and we finally mention new trends to improve the efficacy of this immune strategy.

Alpha-fetoprotein predicts the treatment efficacy of immune checkpoint inhibitors for gastric cancer patients

BackgroundImmune checkpoint inhibitors (ICIs) are commonly used in conjunction with chemotherapy to improve treatment outcomes for patients with gastric cancer. Since AFP could influence immunity by both inhibiting natural killer (NK) cells and regulating negatively the function of dendritic cells, we evaluated the influence of baseline serum alpha-fetoprotein (AFP) levels on the curative effect of ICIs in advanced gastric cancer (AGC) patients.MethodsA retrospective analysis was conducted on 158 AGC patients who underwent ICI treatment. The patients were divided into high and low groups based on the AFP threshold of 20 ng/ml. The efficacy of ICI treatment was assessed using objective response rate (ORR), disease control rate (DCR), progression-free survival (PFS), and overall survival (OS).ResultsThe higher levels of baseline AFP were found to be associated with a decrease in the effectiveness of ICIs, as evidenced by a DCR of 50.0% in the group with high AFP levels compared to 87.7% in the group with low AFP levels (P < 0.001). Further analysis using Kaplan-Meier survival techniques indicated that a high AFP level was linked to shorter progression-free survival (PFS) (P < 0.001) and overall survival (OS) (P = 0.001) in AGC individuals receiving ICIs. After propensity score matching, a log rank test revealed that the high AFP group had a decrease in median PFS (P = 0.011) and median OS (P = 0.036) compared to the low AFP group. The high AFP levels also showed its association with shorter PFS and OS in the subgroup analysis of ICI plus chemotherapy patients.ConclusionsBaseline AFP levels may predict immune checkpoint inhibitor treatment efficacy in AGC patients.