Debrisoquine 4-hydroxylase Research Articles

Diversity in the oxidation of substrates by cytochrome P450 2D6: lack of an obligatory role of aspartate 301-substrate electrostatic bonding.

Cytochrome P450 (P450) 2D6 was first identified as the polymorphic human debrisoquine hydroxylase and subsequently shown to catalyze the oxidation of a variety of drugs containing a basic nitrogen. Residue Asp301 has been characterized as being involved in electrostatic interactions with substrates on the basis of homology modeling and site-directed mutagenesis experiments [Ellis, S. W., Hayhurst, G. P., Smith, G., Lightfoot, T., Wong, M. M. S., Simula, A. P., Ackland, M. J., Sternberg, M. J. E., Lennard, M. S., Tucker, G. T., and Wolf, C. R. (1995) J. Biol. Chem. 270, 29055-29058]. However, pharmacophore models based on the role of Asp301 in substrate binding are compromised by reports of catalytic activity toward substrates devoid of a basic nitrogen, which have generally been ignored. We characterized a high-affinity ligand for P450 2D6, also devoid of a basic nitrogen atom, spirosulfonamide [4-[3-(4-fluorophenyl)-2-oxo-1-oxaspiro[4.4]non-3-en-4-yl]benzenesulfonamide], with K(s) 1.6 microM. Spirosulfonamide is a substrate for P450 2D6 (k(cat) 6.5 min(-)(1) for the formation of a syn spiromethylene carbinol, K(m) 7 microM). Mutation of Asp301 to neutral residues (Asn, Ser, Gly) did not substantially affect the binding of spirosulfonamide (K(s) 2.5-3.5 microM). However, the hydroxylation of spirosulfonamide was attenuated in these mutants to the same extent (90%) as for the classic nitrogenous substrate bufuralol, and the effect of the D301N substitution was manifested on k(cat) but not K(m). Analogues of spirosulfonamide were also evaluated as ligands and substrates. Analogues in which the sulfonamide moiety was modified to an amide, thioamide, methyl sulfone, or hydrogen were ligands with K(s) values of 1.7-32 microM. All were substrates, and the methyl sulfone analogue was oxidized to the syn spiromethylene carbinol analogue of the major spirosulfonamide product. The D301N mutation produced varying changes in the oxidation patterns of the spirosulfonamide analogues. The peptidometic ritonavir and the steroids progesterone and testosterone had been reported to be substrates for P450 2D6, but the affinities (K(s)) were unknown; these were estimated to be 1.2, 1.5, and 15 microM, respectively (cf. 6 microM for the classic substrate bufuralol). The results are consistent with a role of Asp301 other than electrostatic interaction with a positively charged ligand. H-Bonding or electrostatic interactions probably enhance binding of some substrates, but our results show that it is not required for all substrates and explain why predictive models fail to recognize the proclivity for many substrates, especially those containing no basic nitrogen.

4-Hydroxylation of debrisoquine by human CYP1A1 and its inhibition by quinidine and quinine.

A panel of 15 recombinant cytochromes P450 expressed in human B-lymphoblastoid cells was used to study debrisoquine 4-hydroxylation. Both CYP2D6 and CYP1A1 carried out the reaction. The apparent K(m) (micromolar) and V(max) (picomoles per minute per picomole of P450) for CYP2D6 were 12.1 and 18.2 and for CYP1A1 were 23.1 and 15.2, respectively. CYP1A1 debrisoquine 4-hydroxylase was inhibited by the CYP1A1 inhibitor alpha-naphthoflavone and the CYP1A1 substrate 7-ethoxyresorufin. Additionally and surprisingly, this reaction was also inhibited by quinidine and quinine, with respective IC(50) values of 1.38 +/- 0.10 and 3.31 +/- 0.14 microM, compared with those for CYP2D6 debrisoquine 4-hydroxylase of 0.018 +/- 0.05 and 3.75 +/- 2.07 microM, respectively. Anti-CYP1A1 monoclonal antibody (mAb) 1-7-1 abolished CYP1A1 debrisoquine hydroxylase and anti-CYP2D6 mAb 50-1-3 eradicated CYP2D6 debrisoquine 4-hydroxylase. Three further CYP2D6-specific reactions were tested: dextromethorphan O-demethylation, bufuralol 1'-hydroxylation, and sparteine dehydrogenation. The CYP2D6 specificity, judged by the CYP2D6/CYP1A1 activity ratios was 18.5, 7.0, 6.0, and 1.6 for dextromethorphan, bufuralol, sparteine, and debrisoquine, respectively. Thus, debrisoquine is not a specific CYP2D6 substrate and quinidine is not a specific CYP2D6 inhibitor. These findings have significant implications for the conduct of in vitro drug metabolism inhibition studies and underscore the fallacy of "specific chemical inhibitors" of a supergene family of enzymes that have overlapping substrate specificities. The use of highly specific mAbs in such studies is mandated. It is unclear as yet whether these findings have implications for the relationship between CYP2D6 genotype and in vivo debrisoquine 4-hydroxylase activity.

Characterization of Cytochrome P450 2D6 Alleles Using the Invader ™ System

The cytochrome p450 (CYP) superfamily comprises enzymes that play an essential role in the transformation of medically relevant compounds. Accurate genotyping of polymorphisms in members of this family is drawing increasing interest because certain allelic variants may result in either loss of efficacy or toxic accumulation of therapeutic agents. Debrisoquine 4-hydroxylase, or CYP2D6, is among the most widely studied of the CYPs. The complexity of the CYP2D6 genomic region, including pseudogenes, gene deletions, and gene duplications, has offered numerous challenges to developing a genotyping strategy. We describe a comprehensive CYP2D6 genotyping strategy that employs both a PCR/Invader genotyping assay system and an Invader genomic copy number assay The Invader system is a homogeneous, isothermal, highly specific, and robust signal amplification system. Resultsfrom II CYP2D6 assays in an alle frequency study compare well to published allele frequency values for Caucasians. Further, Invader assays provided unambiguous genotyping determinations for 100% of the 171 samples that yielded a visible PCR product on an agarose gel. A copy number assay yielded only one equivocal result in 205 samples. We identified 17 single-copy individuals and 17 three-copy (or more) individuals.

Brief Communication SMOKING AND PARKINSON S DISEASE: EXPLANATORY HYPOTHESIS

A systematic review was conducted to estimate the pooled risk of smoking for Parkinson s disease in Chinese populations. The four identified case-control studies had odds ratios with 95% confidence intervals nearly or overlapping unity. Pooled odds ratio of these studies was 0.77 with 95% confidence interval 0.60 to 0.97. It was suggested that smoking induces debrisoquine 4-hydroxylase, which is responsible for the metabolism of antipsychotic drugs and the detoxification of certain environmental toxins known to cause dopaminergic neural damage. This could be the explanation of these contradictory results as cytochrome P-450 CYP2D6 debrisoquine hydroxylase gene polymorphism is known to be much lower in Chinese than in Caucasian people. This systematic review raises concerns about generalization of the conclusion previously settled by many cohort and case-control studies.

Rapid Detection of the C−1496G Polymorphism in the CYP2D6 *2 Allele

The CYP2D6 gene, encoding debrisoquine hydroxylase, is involved in the metabolism of a large number of medications (1). Recently, Raimundo et al. (2) described a C−1496G polymorphism in the promoter region of the CYP2D6 *2 allele that has a strong effect on debrisoquine metabolic phenotype when present in combination with a null allele. The *2 allele is the most common allele encoding intermediate debrisoquine hydroxylase activity in Caucasians (3), but to date, substantial variability among *2 carriers in metabolic activity has been reported. To accurately predict debrisoquine phenotype from CYP2D6 genotype in *2 carriers, determining C−1496G genotype will be necessary. We sought to develop a rapid, high-throughput genotyping assay for the CYP2D6 C−1496G promoter polymorphism described by Raimundo et al. (2). Because no available restriction enzyme differentially digests the polymorphic site (4), we introduced a Bsr I restriction site (actggn∧) into the amplicon using a forward primer with a 3′ single-nucleotide mismatch (underlined and in bold). The primers 2D6–1496F [gcctggacaacttggaagaac t ; modified from the forward primer upf14 described by Raimundo et al. (2)] and 2D6–1496R3 (gtgccaccacgtctagcttt) (5) amplify a 203-bp amplicon. The following were mixed with 1 μL of genomic DNA at 0.23–1.1 μg/μL (extracted from whole blood using a Gentra reagent set) in a total volume of 25 μL: 2.5 μL of 10× PCR buffer (Applied Biosystems); 0.5 μL of 10 mM dNTP (Amersham Pharmacia Biotech); 0.1 …

CYP2D6 Genotyping with Oligonucleotide Microarrays and Nortriptyline Concentrations in Geriatric Depression

Recent advances in oligonucleotide microarray technology (“gene chips”) permit rapid screening for DNA sequence variation. The CYP2D6 gene encodes debrisoquine hydroxylase, which metabolizes the antidepressant nortriptyline and other psychotropic medications. Nortriptyline plasma concentrations were obtained after at least three weeks of treatment in 36 geriatric patients with major depression who were taking a mean of 8.6 other medications besides nortriptyline. Oligonucleotide microarrays were used to detect 16 CYP2D6 alleles that affect debrisoquine hydroxylase activity. Subjects carrying alleles encoding impaired debrisoquine hydroxylase activity had significantly greater nortriptyline concentrations and lower nortriptyline doses than did other subjects. Significant correlations were found between the numbers of alleles encoding decreased metabolism and nortriptyline plasma concentration, nortriptyline dose, and nortriptyline plasma concentration standardized for dose, indicating a gene dosage effect. These results demonstrate that CYP2D6 genotyping on a microarray platform can be used to predict plasma antidepressant concentrations despite advanced patient age and numerous concurrent medications.

Diversity in Mechanisms of Substrate Oxidation by Cytochrome P450 2D6: LACK OF AN ALLOSTERIC ROLE OF NADPH-CYTOCHROME P450 REDUCTASE IN CATALYTIC REGIOSELECTIVITY

Cytochrome P450 (P450) 2D6 was first identified as the polymorphic human debrisoquine hydroxylase and subsequently shown to catalyze the oxidation of a variety of drugs containing a basic nitrogen. Differences in the regioselectivity of oxidation products formed in systems containing NADPH-P450 reductase/NADPH and the model oxidant cumene hydroperoxide have been proposed by others to be due to an allosteric influence of the reductase on P450 2D6 (Modi, S., Gilham, D. E., Sutcliffe, M. J., Lian, L.-Y., Primrose, W. U., Wolf, C. R., and Roberts, G. C. K. (1997) Biochemistry 36, 4461-4470). We examined the differences in the formation of oxidation products of N-methyl-4-phenyl-1,2,5,6-tetrahydropyridine, metoprolol, and bufuralol between reductase-, cumene hydroperoxide-, and iodosylbenzene-supported systems. Catalytic regioselectivity was not influenced by the presence of the reductase in any of the systems supported by model oxidants, ruling out allosteric influences. The presence of the reductase had little effect on the affinity of P450 2D6 for any of these three substrates. The addition of the reaction remnants of the model oxidants (cumyl alcohol and iodobenzene) to the reductase-supported system did not affect reaction patterns, arguing against steric influences of these products on catalytic regioselectivity. Label from H(2)18O was quantitatively incorporated into 1'-hydroxybufuralol in the iodosylbenzene- but not in the reductase- or cumene hydroperoxide-supported reactions. We conclude that the P450 systems utilizing NADPH-P450 reductase, cumene hydroperoxide, and iodosylbenzene use similar but distinct chemical mechanisms. These differences are the basis for the variable product distributions, not an allosteric influence of the reductase.

A study of the expression of the xenobiotic-metabolising cytochrome P450 proteins and of testosterone metabolism in bovine liver

The expression of xenobiotic-metabolising cytochrome P450 proteins in the liver of cattle was determined using substrate probes and immunologically by Western blot analysis. Compared to the rat, cattle displayed much higher coumarin 7-hydroxylase (CYP2A) and ethoxyresorufin O-deethylase (CYP1) activity but, in contrast, it exhibited much lower debrisoquine 4-hydroxylase (CYP2D) and lauric acid hydroxylase activities (CYP4A). The ethoxyresorufin O-deethylase activity was markedly inhibited by furafylline and α-naphthoflavone, and coumarin 7-hydroxylase by 8-methoxypsoralen. Immunoblot analysis employing antibodies to rat CYP1A1 recognised two immunorelated proteins in bovine liver whose expression appeared to be higher compared with rat. Kinetic studies indicated that a single enzyme is likely to be responsible for the O-deethylation of 7-ethoxyresorufin in bovine liver. When bovine microsomes were probed with antibodies to rat CYP2A2, a single protein was detected in cattle liver. Kinetic analysis followed by construction of Eadie-Hofstee plots indicated that more than one enzyme contributes to the 7-hydroxylation of coumarin. Immunoblot analysis employing antibodies to human CYP2D6 and rat CYP4A1 revealed in both cases a single, poorly expressed immunoreacting band in bovine microsomes. Similar immunoblot studies detected proteins in cattle liver immunorelated to the CYP2B, CYP2C, CYP2E, and CYP3A subfamilies. Bovine microsomes metabolised testosterone but, in contrast to the rat, failed to produce 2α- and 16α-hydroxytestosterone. On the other hand, bovine microsomes produced levels of another hydroxylated metabolite, possibly 12-hydroxytestosterone. In conclusion, results emanating from this study indicate the presence of proteins in the cattle liver belonging to all the xenobiotic-metabolising families of cytochrome P450.

Interaction of plasma proteins with cytochromes P450 mediated metabolic reactions: inhibition by human serum albumin and α-globulins of the debrisoquine 4-hydroxylation (CYP2D) in liver microsomes of human, hamster and rat

The effect of human serum albumin (HSA), α1-acid glycoprotein (α1-AGP), and α- and γ-globulins on the in vitro metabolism of debrisoquine in human, hamster and rat liver microsomes was studied. Interaction of albumin with cytochrome P450 mediated phenytoin metabolism has been reported. Since plasma protein binding of phenytoin is high, in the present study a weakly protein bound drug, debrisoquine, was studied. Debrisoquine is a substrate of CYP2D6. The debrisoquine 4-hydroxylation was measured using a radio-TLC method. Among the four plasma proteins, α-globulins had the strongest inhibitory effect on the debrisoquine 4-hydroxylase activity. The inhibition with 2% α-globulins was 42±18% for human and higher for hamster and rat liver microsomes (65–71%). HSA had less effect than α-globulins. In the presence of HSA, the decrease in activity was between 18 and 35% for all liver microsomes studied. The debrisoquine 4-hydroxylase activity was not significantly changed by α1-AGP or γ-globulins. Using an ultra-filtration method, the protein binding of debrisoquine to 4% HSA, 0.5% α1-AGP, 2% α-globulins and 2% γ-globulins was found to be 22, 20, 22 and 5%, respectively. Since the observed inhibition is inconsistent with level of protein binding, it appears, particularly in the case of α-globulins, that the plasma proteins interact with CYP2D directly.

Inhibition of human CYP1A2 activity in vitro by methylxanthines: potent competitive inhibition by 8-phenyltheophylline

1. Humans are exposed in vivo to methylxanthines by dietary ingestion, as well as from their use as therapeutic agents. The inhibitory effect of a series of these compounds on high-affinity phenacetin O-deethylase activity in the human liver microsomal fraction, a measure of CYP1A2 activity, has been evaluated. 2. Paracetamol, the product of phenacetin O-deethylase activity, was analysed by gas chromatography/negative-ion mass spectrometry using a novel bistrifluoromethylbenzoyl/ trimethylsilyl derivative, and incubation conditions for assessing high-affinity phenacetin O-deethylase activity were examined and optimized. 3. 1-Methylxanthine, caffeine, theophylline, 8-methylxanthine, pentoxyfylline and 3- isobutyl-1-methylxanthine caused moderate inhibition with IC50 = 260, 140, 120, 100, 62 and 36 μM respectively. 4. 8-Phenyltheophylline was a potent competitive inhibitor of high-affinity phenacetin O-deethylase activity with an IC50 = 0.7 μM and Ki = 0.11 μM. 5. The specificity of inhibition by 8-phenyltheophylline was assessed by measuring its effect on debrisoquine 4-hydroxylase (CYP2D6), terfenadine hydroxylase (CYP3A4), chlorzoxazone 6-hydroxylase (CYP2E1) and tolbutamide 4-hydroxylase (CYP2C9) activities in human liver microsomal fraction. No inhibition of any of these activitieswas observed. 6. The potency and specificity of 8-phenyltheophylline as an inhibitor of human hepatic CYP1A2 indicate that the compound may be useful as a chemical inhibitor of this enzyme for further in vitro studies.

Lack of association in Japanese patients between neuroleptic malignant syndrome and a debrisoquine 4-hydroxylase genotype with low enzyme activity.

Decreased activity of debrisoquine 4-hydroxylase (CYP2D6), which participates in hepatic metabolism of several frequently used neuroleptics and antidepressants, is inherited as an autosomal recessive trait through polymorphic CYP2D6 gene alleles. In eastern Orientals, a C --> T substitution at nucleotide 188 (Pro34Ser) is primarily responsible for decreased ability to metabolize CYP2D6 substrates. We therefore studied a possible association between neuroleptic malignant syndrome (NMS) and the C188T mutation. We examined the frequency of the C188T mutation by polymerase chain reaction and restriction fragment length polymorphism analysis in 36 Japanese patients previously diagnosed with NMS and 107 neuroleptic-treated schizophrenic patients with no NMS history. The C188T allele frequency was 0.417 in NMS patients and 0.463 in patients without NMS. No significant allele or genotype associations were observed. We cannot conclude that low CYP2D6 activity genotype causes susceptibility to NMS in Japanese patients.

Occurrence of CYP2D6 Gene Duplication in Hong Kong Chinese

The cytochrome P450 CYP2D6 enzyme debrisoquine 4-hydroxylase metabolizes many different type of drugs commonly used in psychopharmacotherapy, such as tricyclic antidepressants and neuroleptics (1). The CYP2D6 gene, which encodes for the CYP2D6 enzyme, is part of a cluster on chromosome 22 that includes two to three related pseudogenes (2). Starting at the 5′ end of the cluster, there are two nonfunctional pseudogenes termed CYP2D8P and CYP2D7AP (an additional pseudogene, CYP2D7BP , also can be found) followed by the active gene CYP2D6 . Several mutated alleles of the CYP2D6 gene have been identified (3) and associated with alterations or polymorphisms in the metabolism of debrisoquine and related drugs metabolized by the CYP2D6 enzyme. As a result, CYP2D6 enzymatic activity ranges from ultrafast to a complete absence; the corresponding phenotypes are called ultrarapid (UM), extensive, and poor (PM) metabolizer. Unequal distribution of the alleles among different populations gives rise to interracial metabolic differences in addition to interindividual variation (4). Individuals homozygous or heterozygous for deficient CYP2D6 alleles metabolize drugs at a low rate, increasing the risks of side effects and drug toxicity. On the other hand, individuals with duplication/multiplication of the active CYP2D6 gene metabolize drugs at ultrarapid rate, hence requiring more than average doses of drugs to reach therapeutic plasma concentrations (5). The mechanism behind the duplication involves mainly the active allelic variant CYP2D62 (6). The occurrence of gene duplication varies widely, from 29% in Ethiopians (7), to 20% in Saudi Arabians (8), to 1–7% in Caucasians (9)(10), to 1–2% in Orientals (11)(12)(13), although not many data are available for the latter. Establishing the prevalence of duplicated CYP2D6 active alleles may help prevent therapeutic failure in UM individuals treated with CYP2D6 enzyme-substrates at standard doses. We investigated the prevalence of the …

Molecular cloning and characterization of three novel cytochrome P450 2D isoforms, CYP2D20, CYP2D27, and CYP2D28 in the Syrian hamster (Mesocricetus auratus).

We cloned three novel cytochrome P450 (CYP) 2D cDNAs in the Syrian hamster (Mesocricetus auratus). Each clone contained an open reading frame of 1500 nucleotides encoding a protein of 500 amino acids. The deduced amino acid sequences of these had high identities with those of the other CYP2D members, therefore, the clones were assigned as CYP2D20, CYP2D27, and CYP2D28. Northern blot analysis showed that the CYP2D27 mRNA was expressed in liver, but not in kidney, small intestine, and brain, while the CYP2D20 and CYP2D28 mRNAs were not detected in these tissues examined. The expression of CYP2D27 mRNA in liver did not show sex difference and was not induced by either 3-methylcholanthrene or phenobarbital treatment. We characterized the enzyme activities of recombinant CYP2D27 expressed in COS-7 cells. The CYP2D27 protein had the bufuralol 1'-hydroxylase and debrisoquine 4-hydroxylase activities that are specific to the CYP2D subfamily.

Stability of cytochrome P450 proteins in cultured precision-cut rat liver slices

The objective of this study was to evaluate the stability of individual, xenobiotic-metabolising, cytochrome P450 proteins in precision-cut rat liver slices cultured for up to 72 h using the multiwell plate system. This was achieved using established diagnostic probes (O-dealkylation of methoxy-, ethoxy- and pentoxy-resorufin, testosterone 2α-hydroxylase, debrisoquine 4-hydroxylase, aniline p-hydroxylase and lauric acid hydroxylase) and immunologically using Western blotting. All cytochrome P450 activities declined in culture, the most rapid loss occurring at about 8–12 h of culture; in all cases no detectable activity was present in the 72-h cultured slices. Isoform-specific differences in the stability of various cytochrome P450 proteins were observed, with CYP2E1 being the most stable. When cytochrome P450 expression was determined immunologically, a different picture emerged. High levels of apoprotein were retained in the slices even when activity was very low. In the case of CYP2B, apoprotein levels even increased following the culture of hepatic slices. It is concluded, that for tissue slices to become an acceptable in vitro alternative system for long-term incubations, the culturing conditions must be improved to ensure that cytochrome P450 activities are better maintained.

Case-control study of debrisoquine 4-hydroxylase, N-acetyltransferase 2, and apolipoprotein E gene polymorphisms in Parkinson's disease.

We investigated the association of Parkinson's disease (PD) with two genes encoding liver-detoxifying enzymes, debrisoquine 4-hydroxylase (CYP2D6) and N-acetyltransferase 2 (NAT2), and with one gene related to Alzheimer's disease, apolipoprotein E (APOE). In a sample of 139 unrelated PD cases and 113 control subjects, the NAT2 M3 allele was associated with PD (odds ratio = 7.9; 95% confidence interval = 1.7-36.3). Case-control analyses for CYP2D6, APOE, and NAT2 M1 or M2 did not show a significant association. However, the age at onset of PD was significantly earlier in cases with the APOE epsilon2/epsilon3 genotype than in cases with the epsilon3/epsilon3 genotype.

CYP2D6 and CYP2C19 genotypes of patients with terodiline cardiotoxicity identified through the yellow card system.

Terodiline has concentration dependent QT prolonging effects and thus the potential for cardiotoxicity. Pharmacogenetic variation in terodiline metabolism could be responsible for cardiotoxicity. We sought to determine whether CYP2D6 (debrisoquine hydroxylase) or CYP2C19 (S-mephenytoin hydroxylase) status is a risk factor for terodiline cardiotoxicity. Using the UK Yellow Card scheme to identify patients, blood samples were obtained from eight patients who survived ventricular tachycardia or torsades de pointes suspected to be due to terodiline, for determination of CYP2D6 and CYP2C19 genotypes. Genotype prevalence was compared with that in published general population groups. One patient was a CYP2D6 poor metaboliser (CYP2D6*4 homozygous) and a second was heterozygous for CYP2D6*4, a slightly lower frequency for these genotypes compared with the general population (P = 0.31). In the case of CYP2C19, one patient was a poor metaboliser and four were heterozygous for the variant CYP2C19*2 allele, compared with general population frequencies of 2% and 23%, respectively (P = 0.035). These findings suggest that debrisoquine poor metaboliser status is not primarily responsible for terodiline cardiotoxicity. However, possession of the CYP2C19*2 allele appears to contribute to adverse cardiac reactions to terodiline. The present study demonstrates the feasibility of using spontaneous adverse drug reaction reporting schemes to determine the contribution of genotype for metabolizing enzymes to uncommon adverse drug reactions.

Polymorphisms of the CYP2D6 gene increase susceptibility to ankylosing spondylitis.

Ankylosing spondylitis (AS) is a common and highly familial rheumatic disorder. The sibling recurrence risk ratio for the disease is 63 and heritability assessed in twins >90%. Although MHC genes, including HLA-B27, contribute only 20-50% of the genetic risk for the disease, no non-MHC gene has yet been convincingly demonstrated to influence either susceptibility to the disease or its phenotypic expression. Previous linkage and association studies have suggested the presence of a susceptibility gene for AS close to, or within, the cytochrome P450 2D6 gene (CYP2D6, debrisoquine hydroxylase) located at chromosome 22q13.1. We performed a linkage study of chromosome 22 in 200 families with AS affected sibling-pairs. Association of alleles of the CYP2D6 gene was examined by both case-control and within-family means. For case-control studies, 617 unrelated individuals with AS (361 probands from sibling-pair and parent-case trio families and 256 unrelated non-familial sporadic cases) and 402 healthy ethnically matched controls were employed. For within-family association studies, 361 families including 161 parent-case trios and 200 affected sibling-pair families were employed. Homozygosity for poor metabolizer alleles was found to be associated with AS. Heterozygosity for the most frequent poor metabolizer allele (CYP2D6*4) was not associated with increased susceptibility to AS. Significant within-family association of CYP2D6*4 alleles and AS was demonstrated. Weak linkage was also demonstrated between CYP2D6 and AS. We postulate that altered metabolism of a natural toxin or antigen by the CYP2D6 gene may increase susceptibility to AS.

A micromethod for quantitation of debrisoquine and 4-hydroxydebrisoquine in urine by liquid chromatography.

We describe a new simple, selective and sensitive micromethod based on HPLC and fluorescence detection to measure debrisoquine (D) and 4-hydroxydebrisoquine (4-OHD) in urine for the investigation of xenobiotic metabolism by debrisoquine hydroxylase (CYP2D6). Four hundred microl of urine was required for the analysis of D and 4-OHD. Peaks were eluted at 8.3 min (4-OHD), 14.0 min (D) and 16.6 min for the internal standard, metoprolol (20 microg/ml). The 5-microm CN-reverse-phase column (Shimpack, 250 x 4.6 mm) was eluted with a mobile phase consisting of 0.25 M acetate buffer, pH 5.0, and acetonitrile (9:1, v/v) at 0.7 ml/min with detection at lambdaexcitation = 210 nm and lambdaemission = 290 nm. The method, validated on the basis of measurements of spiked urine, presented 3 ng/ml (D) and 6 ng/ml (4-OHD) sensitivity, 390-6240 ng/ml (D) and 750-12000 ng/ml (4-OHD) linearity, and 5.7/8.2% (D) and 5.3/8.2% (4-OHD) intra/interassay precision. The method was validated using urine of a healthy Caucasian volunteer who received one 10-mg tablet of Declinax(R), po, in the morning after an overnight fast. Urine samples (diuresis of 4 or 6 h) were collected from zero to 24 h. The urinary excretion of D and 4-OHD, Fel (0-24 h), i.e., fraction of dose administered and excreted into urine, was 6.4% and 31.9%, respectively. The hydroxylation capacity index reported as metabolic ratio was 0.18 (D/4-OHD) for the person investigated and can be compared to reference limits of >12.5 for poor metabolizers (PM) and <12.5 for extensive metabolizers (EM). In parallel, the recovery ratio (RR), another hydroxylation capacity index, was 0.85 (4-OHD: SigmaD + 4-OHD) versus reference limits of RR <0.12 for PM and RR >0. 12 for EM. The healthy volunteer was considered to be an extensive metabolizer on the basis of the debrisoquine test.

Venlafaxine serum levels and CYP2D6 genotype.

Thirty-three patients with depression treated with 225 mg venlafaxine were genotyped for the polymorphic enzyme, debrisoquine 4-hydroxylase (CYP2D6). The relationship between drug and metabolite levels and between genotype and clinical response were investigated. Although the number of responders in this study is insufficient for definite conclusions to be drawn, a target therapeutic concentration ranging from 195-400 microg/L for the sum of venlafaxine and O-desmethylvenlafaxine is suggested. The ratio of O-desmethylvenlafaxine to venlafaxine in the serum concentrations is a measure of metabolic turnover, and can be used to distinguish between ultrarapid and poor metabolizers. All but one of the nonresponders in this study had lower ratios than the responders. Three patients (9%) had homozygous defective CYP2D6 alleles and did not readily metabolize venlafaxine to O-desmethylvenlafaxine, pointing to poor metabolism. In these patients, N-desmethylation was increased. Two out of four patients detected by the ratio as potentially ultrarapid metabolizers were shown to have multiple copies of a functional CYP2D6 gene.

Rapid and comprehensive determination of cytochrome P450 CYP2D6 poor metabolizer genotypes by multiplex polymerase chain reaction.

The liver enzyme cytochrome P450 CYP2D6 (debrisoquine 4-hydroxylase) metabolizes numerous drugs, including many antidepressants, neuroleptics, antiarrhythmics, and antihypertensive agents. Variability in the gene that encodes this enzyme is an important factor underlying variable drug treatment responses. Some 5-10% of Caucasians lack functional CYP2D6, and the genetic basis of most of these "poor metabolizer" alleles is now well defined. As the CYP2D6 status of a patient can have profound effects on response to drug treatment, it is important to devise methods that permit rapid and economical determination of CYP2D6 genotype. We have developed a robust polymerase chain reaction method that simultaneously identifies the variants CYP2D6 *3, *4, *6, *8, *11, *12, *14, *15, *19, and *20. This constitutes most of the poor metabolizer alleles described in Caucasian and Asian populations. Separate PCR reactions or Southern blots are required for *7, the *5 deletion, and the hybrid alleles *13 and *16. The multiplex assay was validated on 100 individuals previously genotyped by specific polymerase chain reaction-restriction fragment length polymorphism analysis, and proved 100% accurate in this sample. The assay performed consistently with Taq DNA polymerases from various suppliers, within a broad range of temperatures and MgCl(2) concentrations, and using genomic DNA prepared by a range of methods including extraction from dried blood spots on card. This multiplexed, amplification refractory mutation system (ARMS) method is reliable, rapid, relatively cheap, amenable to automation, and offers the advantages of minimal sample handling with no requirement for restriction enzymes as in earlier CYP2D6 assays.