Debrisoquine 4-hydroxylase Activity Research Articles

Characterization of the CYP2D6 drug metabolizing phenotypes of the Chilean mestizo population through polymorphism analyses

We tested the influence of four polymorphisms and gene duplication in CYP2D6 on in vivo enzyme activity in a Chilean mestizo population in order to identify the most relevant genetic profiles that account for observed phenotypes in this ethnic group.CYP2D6*2 (2850C>T), *3 (2549A>del), *4 (1846G>A), *17 (1023C>T) and gene duplication were determined by PCR-RFLP or PCRL in a group of 321 healthy volunteers. Individuals with different variant alleles were phenotyped by determining debrisoquine 4-hydroxylase activity as a metabolic ratio (MR) using a validated HPLC assay.Minor allele frequencies were 0.41, 0.01, 0.12 and 0.00 for CYP2D6*2, *3, *4 and *17 variants, respectively, and the duplication frequency was 0.003. Genotype analysis correlated with phenotypes in 18 of 23 subjects (78.3%). 11 subjects were extensive metabolizers (EM), 8 were intermediate metabolizers (IM), 2 were poor metabolizers (PM) and 2 were ultra-rapid metabolizers (UM) which is fairly coincident with expected phenotypes metabolic ratios ranged from 0.11 to 126.41. The influence of CYP2D6*3 was particularly notable, although only heterozygote carriers were present in our population. Individuals homozygous for *4 were always PM. As expected, the only subject with gene duplication was UM.In conclusion, there was a clear effect of genotype on observed CYP2D6 activity. Classification of EM, PM and UM through genotyping was useful to characterize CYP2D6 phenotype in the Chilean mestizo population.

Cloning and functional expression of a novel marmoset cytochrome P450 2D enzyme, CYP2D30: comparison with the known marmoset CYP2D19

Using a primer set designed on the cDNA encoding the known marmoset cytochrome P450 2D19 (CYP2D19), a cDNA encoding a novel CYP2D enzyme (CYP2D30) was cloned from the liver of a female marmoset bred at Kyoto University (KYU). In addition, a cDNA encoding CYP2D19 was cloned from the liver of a female marmoset bred at Kagoshima University (KAU). CYP2D30 and CYP2D19 showed homologies of 93.6 and 93.4% in their nucleotide and amino acid sequences, respectively. Reverse transcription polymerase chain reaction (RT-PCR) and digestion with NdeI demonstrated that the KYU-marmoset liver contained mainly mRNA for CYP2D30, while the KAU-marmoset liver contained mainly mRNA for CYP2D19. Marmoset CYP2D30, like human CYP2D6, exhibited high debrisoquine (DB) 4-hydroxylase activity and relatively low DB 5-, 6-, 7- and 8-hydroxylase activities, whereas CYP2D19 lacked DB 4-hydroxylase but exhibited marked 5-, 6-, 7- and 8-hydroxylase activities. The two marmoset recombinant enzymes showed enantioselective bufuralol (BF) 1″-hydroxylase activities, similar to CYP2D6. BF 1″-hydroxylation by CYP2D30 exhibited product-enantioselectivity of (1″ R-OH-BF ⪡ 1″ S-OH-BF), similar to that observed with human CYP2D6, whereas CYP2D19 showed a reversed selectivity of (1″ R-OH-BF ≥ 1″ S-OH-BF). BF 1″-hydroxylation in marmoset liver microsomes from both sources was inhibited by antibodies raised against rat CYP2D1 in a concentration-dependent manner. A known inhibitor of CYP2D6, quinidine, effectively inhibited the BF 1″-hydroxylation activities in liver microsomal fractions prepared from KYU- and KAU-marmosets. These results suggest that CYP2D19 and CYP2D30 proteins can be expressed as functional enzymes in marmoset livers, although it is unresolved whether both enzymes coexist in the same marmoset liver.

4-Hydroxylation of debrisoquine by human CYP1A1 and its inhibition by quinidine and quinine.

A panel of 15 recombinant cytochromes P450 expressed in human B-lymphoblastoid cells was used to study debrisoquine 4-hydroxylation. Both CYP2D6 and CYP1A1 carried out the reaction. The apparent K(m) (micromolar) and V(max) (picomoles per minute per picomole of P450) for CYP2D6 were 12.1 and 18.2 and for CYP1A1 were 23.1 and 15.2, respectively. CYP1A1 debrisoquine 4-hydroxylase was inhibited by the CYP1A1 inhibitor alpha-naphthoflavone and the CYP1A1 substrate 7-ethoxyresorufin. Additionally and surprisingly, this reaction was also inhibited by quinidine and quinine, with respective IC(50) values of 1.38 +/- 0.10 and 3.31 +/- 0.14 microM, compared with those for CYP2D6 debrisoquine 4-hydroxylase of 0.018 +/- 0.05 and 3.75 +/- 2.07 microM, respectively. Anti-CYP1A1 monoclonal antibody (mAb) 1-7-1 abolished CYP1A1 debrisoquine hydroxylase and anti-CYP2D6 mAb 50-1-3 eradicated CYP2D6 debrisoquine 4-hydroxylase. Three further CYP2D6-specific reactions were tested: dextromethorphan O-demethylation, bufuralol 1'-hydroxylation, and sparteine dehydrogenation. The CYP2D6 specificity, judged by the CYP2D6/CYP1A1 activity ratios was 18.5, 7.0, 6.0, and 1.6 for dextromethorphan, bufuralol, sparteine, and debrisoquine, respectively. Thus, debrisoquine is not a specific CYP2D6 substrate and quinidine is not a specific CYP2D6 inhibitor. These findings have significant implications for the conduct of in vitro drug metabolism inhibition studies and underscore the fallacy of "specific chemical inhibitors" of a supergene family of enzymes that have overlapping substrate specificities. The use of highly specific mAbs in such studies is mandated. It is unclear as yet whether these findings have implications for the relationship between CYP2D6 genotype and in vivo debrisoquine 4-hydroxylase activity.

Rapid Detection of the C−1496G Polymorphism in the CYP2D6 *2 Allele

The CYP2D6 gene, encoding debrisoquine hydroxylase, is involved in the metabolism of a large number of medications (1). Recently, Raimundo et al. (2) described a C−1496G polymorphism in the promoter region of the CYP2D6 *2 allele that has a strong effect on debrisoquine metabolic phenotype when present in combination with a null allele. The *2 allele is the most common allele encoding intermediate debrisoquine hydroxylase activity in Caucasians (3), but to date, substantial variability among *2 carriers in metabolic activity has been reported. To accurately predict debrisoquine phenotype from CYP2D6 genotype in *2 carriers, determining C−1496G genotype will be necessary. We sought to develop a rapid, high-throughput genotyping assay for the CYP2D6 C−1496G promoter polymorphism described by Raimundo et al. (2). Because no available restriction enzyme differentially digests the polymorphic site (4), we introduced a Bsr I restriction site (actggn∧) into the amplicon using a forward primer with a 3′ single-nucleotide mismatch (underlined and in bold). The primers 2D6–1496F [gcctggacaacttggaagaac t ; modified from the forward primer upf14 described by Raimundo et al. (2)] and 2D6–1496R3 (gtgccaccacgtctagcttt) (5) amplify a 203-bp amplicon. The following were mixed with 1 μL of genomic DNA at 0.23–1.1 μg/μL (extracted from whole blood using a Gentra reagent set) in a total volume of 25 μL: 2.5 μL of 10× PCR buffer (Applied Biosystems); 0.5 μL of 10 mM dNTP (Amersham Pharmacia Biotech); 0.1 …

CYP2D6 Genotyping with Oligonucleotide Microarrays and Nortriptyline Concentrations in Geriatric Depression

Recent advances in oligonucleotide microarray technology (“gene chips”) permit rapid screening for DNA sequence variation. The CYP2D6 gene encodes debrisoquine hydroxylase, which metabolizes the antidepressant nortriptyline and other psychotropic medications. Nortriptyline plasma concentrations were obtained after at least three weeks of treatment in 36 geriatric patients with major depression who were taking a mean of 8.6 other medications besides nortriptyline. Oligonucleotide microarrays were used to detect 16 CYP2D6 alleles that affect debrisoquine hydroxylase activity. Subjects carrying alleles encoding impaired debrisoquine hydroxylase activity had significantly greater nortriptyline concentrations and lower nortriptyline doses than did other subjects. Significant correlations were found between the numbers of alleles encoding decreased metabolism and nortriptyline plasma concentration, nortriptyline dose, and nortriptyline plasma concentration standardized for dose, indicating a gene dosage effect. These results demonstrate that CYP2D6 genotyping on a microarray platform can be used to predict plasma antidepressant concentrations despite advanced patient age and numerous concurrent medications.

A study of the expression of the xenobiotic-metabolising cytochrome P450 proteins and of testosterone metabolism in bovine liver

The expression of xenobiotic-metabolising cytochrome P450 proteins in the liver of cattle was determined using substrate probes and immunologically by Western blot analysis. Compared to the rat, cattle displayed much higher coumarin 7-hydroxylase (CYP2A) and ethoxyresorufin O-deethylase (CYP1) activity but, in contrast, it exhibited much lower debrisoquine 4-hydroxylase (CYP2D) and lauric acid hydroxylase activities (CYP4A). The ethoxyresorufin O-deethylase activity was markedly inhibited by furafylline and α-naphthoflavone, and coumarin 7-hydroxylase by 8-methoxypsoralen. Immunoblot analysis employing antibodies to rat CYP1A1 recognised two immunorelated proteins in bovine liver whose expression appeared to be higher compared with rat. Kinetic studies indicated that a single enzyme is likely to be responsible for the O-deethylation of 7-ethoxyresorufin in bovine liver. When bovine microsomes were probed with antibodies to rat CYP2A2, a single protein was detected in cattle liver. Kinetic analysis followed by construction of Eadie-Hofstee plots indicated that more than one enzyme contributes to the 7-hydroxylation of coumarin. Immunoblot analysis employing antibodies to human CYP2D6 and rat CYP4A1 revealed in both cases a single, poorly expressed immunoreacting band in bovine microsomes. Similar immunoblot studies detected proteins in cattle liver immunorelated to the CYP2B, CYP2C, CYP2E, and CYP3A subfamilies. Bovine microsomes metabolised testosterone but, in contrast to the rat, failed to produce 2α- and 16α-hydroxytestosterone. On the other hand, bovine microsomes produced levels of another hydroxylated metabolite, possibly 12-hydroxytestosterone. In conclusion, results emanating from this study indicate the presence of proteins in the cattle liver belonging to all the xenobiotic-metabolising families of cytochrome P450.

Interaction of plasma proteins with cytochromes P450 mediated metabolic reactions: inhibition by human serum albumin and α-globulins of the debrisoquine 4-hydroxylation (CYP2D) in liver microsomes of human, hamster and rat

The effect of human serum albumin (HSA), α1-acid glycoprotein (α1-AGP), and α- and γ-globulins on the in vitro metabolism of debrisoquine in human, hamster and rat liver microsomes was studied. Interaction of albumin with cytochrome P450 mediated phenytoin metabolism has been reported. Since plasma protein binding of phenytoin is high, in the present study a weakly protein bound drug, debrisoquine, was studied. Debrisoquine is a substrate of CYP2D6. The debrisoquine 4-hydroxylation was measured using a radio-TLC method. Among the four plasma proteins, α-globulins had the strongest inhibitory effect on the debrisoquine 4-hydroxylase activity. The inhibition with 2% α-globulins was 42±18% for human and higher for hamster and rat liver microsomes (65–71%). HSA had less effect than α-globulins. In the presence of HSA, the decrease in activity was between 18 and 35% for all liver microsomes studied. The debrisoquine 4-hydroxylase activity was not significantly changed by α1-AGP or γ-globulins. Using an ultra-filtration method, the protein binding of debrisoquine to 4% HSA, 0.5% α1-AGP, 2% α-globulins and 2% γ-globulins was found to be 22, 20, 22 and 5%, respectively. Since the observed inhibition is inconsistent with level of protein binding, it appears, particularly in the case of α-globulins, that the plasma proteins interact with CYP2D directly.

Inhibition of human CYP1A2 activity in vitro by methylxanthines: potent competitive inhibition by 8-phenyltheophylline

1. Humans are exposed in vivo to methylxanthines by dietary ingestion, as well as from their use as therapeutic agents. The inhibitory effect of a series of these compounds on high-affinity phenacetin O-deethylase activity in the human liver microsomal fraction, a measure of CYP1A2 activity, has been evaluated. 2. Paracetamol, the product of phenacetin O-deethylase activity, was analysed by gas chromatography/negative-ion mass spectrometry using a novel bistrifluoromethylbenzoyl/ trimethylsilyl derivative, and incubation conditions for assessing high-affinity phenacetin O-deethylase activity were examined and optimized. 3. 1-Methylxanthine, caffeine, theophylline, 8-methylxanthine, pentoxyfylline and 3- isobutyl-1-methylxanthine caused moderate inhibition with IC50 = 260, 140, 120, 100, 62 and 36 μM respectively. 4. 8-Phenyltheophylline was a potent competitive inhibitor of high-affinity phenacetin O-deethylase activity with an IC50 = 0.7 μM and Ki = 0.11 μM. 5. The specificity of inhibition by 8-phenyltheophylline was assessed by measuring its effect on debrisoquine 4-hydroxylase (CYP2D6), terfenadine hydroxylase (CYP3A4), chlorzoxazone 6-hydroxylase (CYP2E1) and tolbutamide 4-hydroxylase (CYP2C9) activities in human liver microsomal fraction. No inhibition of any of these activitieswas observed. 6. The potency and specificity of 8-phenyltheophylline as an inhibitor of human hepatic CYP1A2 indicate that the compound may be useful as a chemical inhibitor of this enzyme for further in vitro studies.

Molecular cloning and characterization of three novel cytochrome P450 2D isoforms, CYP2D20, CYP2D27, and CYP2D28 in the Syrian hamster (Mesocricetus auratus).

We cloned three novel cytochrome P450 (CYP) 2D cDNAs in the Syrian hamster (Mesocricetus auratus). Each clone contained an open reading frame of 1500 nucleotides encoding a protein of 500 amino acids. The deduced amino acid sequences of these had high identities with those of the other CYP2D members, therefore, the clones were assigned as CYP2D20, CYP2D27, and CYP2D28. Northern blot analysis showed that the CYP2D27 mRNA was expressed in liver, but not in kidney, small intestine, and brain, while the CYP2D20 and CYP2D28 mRNAs were not detected in these tissues examined. The expression of CYP2D27 mRNA in liver did not show sex difference and was not induced by either 3-methylcholanthrene or phenobarbital treatment. We characterized the enzyme activities of recombinant CYP2D27 expressed in COS-7 cells. The CYP2D27 protein had the bufuralol 1'-hydroxylase and debrisoquine 4-hydroxylase activities that are specific to the CYP2D subfamily.

Genetic Analysis of the CYP2D6 Locus in a Hong Kong Chinese Population

The cytochrome P450 CYP2D6 enzyme debrisoquine 4-hydroxylase metabolizes many different classes of commonly used drugs, such as tricyclic antidepressants and neuroleptics. Genetic polymorphism of the CYP2D6 gene is responsible for pronounced interindividual and interracial differences in the metabolism of these drugs. The CYP2D6*10 allele and its variants are the most frequent alleles found in Orientals, and they are responsible for diminished debrisoquine 4-hydroxylase activity because of the presence of a C(188)-->T mutation in exon 1. One hundred nineteen Hong Kong Chinese subjects were genotyped by means of allele-specific PCR, PCR, and restriction enzyme analysis for 10 CYP2D6 alleles (CYP2D6*1, *2, *4D, *5, *8/*14, *10A, *10B, *15, *16, and J9). CYP2D6*10B was the most prevalent allele, and CYP2D6*10/CYP2D6*10 was the most frequent genotype, representing 41.17% [corrected] of the population. There was no significant difference in the prevalence of the alleles analyzed between our study and the Chinese populations genotyped previously. This is the largest study in terms of the number of CYP2D6 alleles analyzed in an Oriental population and the first one conducted in a Hong Kong Chinese population.

Polymorphic debrisoquine 4-hydroxylase activity in the rat is due to differences in CYP2D2 expression.

The female Dark Agouti rat is widely used as an animal model for the CYP2D6 poor metabolizer phenotype, males of other strains such as Sprague Dawley or Wistar serving as models for the extensive metabolizer phenotype. To determine the relative level of expression of CYP2D enzymes in the liver of female and male Dark Agouti, Sprague Dawley and Wistar rats, anti-peptide antibodies were raised in rabbits against short synthetic peptides representing the C-termini of the rat P450 enzymes CYP2D1, CYP2D2, CYP2D3, CYP2D4 and CYP2D5. In immunoblotting studies, it was found that the hepatic expression of CYP2D1 was greater in Dark Agouti rats than Sprague Dawley or Wistar rats. In contrast, hepatic CYP2D2 was 30-40-fold less abundant in female Dark Agouti than female Sprague Dawley or Wistar rats and six- to eightfold less abundant in male Dark Agouti than male Sprague Dawley or Wistar rats. No hepatic CYP2D3 could be detected in either sex of any of the three strains. Hepatic CYP2D4 expression was generally greater in male than female rats, and higher in Dark Agouti compared with Sprague Dawley or Wistar strains. CYP2D5 was expressed in the livers of female and male Dark Agouti rats but not in female Sprague Dawley or Wistar rats. This form was variably expressed in livers of male Sprague Dawley and Wistar rats. Hepatic debrisoquine 4-hydroxylase activity was markedly reduced in female and male Dark Agouti rats as compared to Sprague Dawley or Wistar rats and correlated (r = 0.88; P < 0.001) with the hepatic CYP2D2 content. Recombinant CYP2D2 was 18-fold more active at catalysing the 4-hydroxylation of debrisoquine than CYP2D1. Furthermore, quinine markedly inhibited CYP2D2-mediated debrisoquine and metoprolol oxidation, while quinidine, its diastereoisomer, inhibited the reactions to a lesser extent. In conclusion, these results show that impaired debrisoquine 4-hydroxylase activity in the female Dark Agouti rat is due to low levels of CYP2D2.

Development of a Comprehensive Panel of Antibodies against the Major Xenobiotic Metabolising Forms of Cytochrome P450 in Humans

Mono-specific antibodies against the human cytochrome P450 (P450) enzymes CYP1A1, CYP1A2, CYP1B1, CYP2A6, CYP2B6, CYP2D6, CYP2E1, CYP3A4, CYP3A5 and CYP4A11 and an antibody that binds to CYP2C8, CYP2C9 and CYP2C19 have been produced by immunising rabbits with synthetic peptides representing small regions of each of these P450 enzymes. The specificity of the antibodies was confirmed by immunoblotting using recombinant P450 enzymes and samples of human hepatic microsomal fraction. Each of the antibodies bound only to their respective target P450 enzyme(s). The relative intensity of immunoreactive bands was compared with a variety of P450 activities and correlations were found between CYP1A2 and phenacetin O-deethylase activity, CYP2A6 and coumarin 7-hydroxylase activity, CYP2C9 and tolbutamide 4-hydroxylase activity, CYP2C19 and S-mephenytoin 4-hydroxylase activity, CYP2D6 and debrisoquine 4-hydroxylase activity, CYP2E1 and chlorzoxazone 6-hydroxylase activity, CYP3A4 and midazolam 1′-hydroxylase activity, and CYP4A11 and lauric acid 12-hydroxylase activity. A proportion of the 30 liver samples examined lacked CYP2A6 (7%), CYP2C19 (10%) or CYP2D6 (13%), consistent with the polymorphic expression of these P450 enzymes in human liver. Although CYP3A5 was detected in most individuals (97%), expression was polymorphic with 20% containing substantially higher levels. CYP2B6 was expressed in 20% of the human liver samples, with one sample containing a particularly high level. No immunodetectable CYP1A1 or CYP1B1 was found, consistent with the low level of expression of these P450 enzymes in human liver. The results demonstrate the utility of the antipeptide approach for producing specific antibodies against human P450 enzymes, enabling a comprehensive panel of antibodies against human P450 enzymes to be produced.

Molecular basis of the Dark Agouti rat drug oxidation polymorphism: importance of CYP2D1 and CYP2D2.

The Dark Agouti rat has been proposed as a model for the human debrisoquine 4-hydroxylase polymorphism. Earlier studies suggested that the poor metabolizer phenotype in the Dark Agouti rat is caused by the absence of the expression of CYP2D1 mRNA. Although CYP2D1 is the major enzyme catalyzing debrisoquine 4-hydroxylation, other reports have indicated the involvement of a CYP2D, purified from rat hepatic microsomes and presumed to be CYP2D2, which also exhibits this activity. The levels of CYP2D1 and CYP2D2 mRNAs were markedly lower in Dark Agouti as compared to Sprague Dawley rats. Using a baculovirus expression system, recombinant CYP2D1 and CYP2D2 from Spodoptera frugiperda insect cells were examined and were found to both forms catalize debrisoquine 4-hydroxylase activity. These results suggest that reduced debrisoquine 4-hydroxylase activity in the Dark Agouti rat is caused by the low level expression not only of CYP2D1, but also of CYP2D2. Interestingly, bunitrolol 4-hydroxylation was catalyzed by recombinant CYP2D2, while CYP2D1 was inactive toward this substrate. Thus, the low bunitrolol 4-hydroxylation in Dark Agouti rats was caused by the low level of CYP2D2 expression in this rat strain.

Expression and characterization of dog CYP2D15 using baculovirus expression system.

Dog CYP2D15 was expressed in Sf9 cells with a recombinant baculovirus. Infection of Sf9 insect cells with a recombinant dog CYP2D15-virus resulted in the expression of a protein which cross-reacted with a polyclonal antibody against a dog CYP2D15-specific peptide. The difference spectrum of CO-complex of reduced P450 of the infected cell microsomes had a maximal absorbance at 449 nm. The specific content of P450 was calculated to be 0.56 nmol/mg of Sf9 cell microsomal protein. Although the expressed dog CYP2D15 showed high catalytic activity for the hydroxylations of bunitrolol and imipramine at low substrate concentration (10 microM), the catalytic activity for that of debrisoquine (50 microM) was extremely low as compared with that of CYP2D from other species. Dog liver microsomes also showed bunitrolol and imipramine hydroxylase activities, but not debrisoquine hydroxylase activity at the same substrate concentrations. In addition, the expressed CYP2D showed high catalytic activity for imipramine N-demethylation. Thus, our study reveals that the expressed dog CYP2D15 engages in high catalytic activity and has a unique substrate specificity from other CYP2D subfamilies. Western blot analysis suggested that the dog CYP2D15 contents were less than 4% of the total liver P450 content, assuming that 100% of expressed CYP2D15 incorporated heme.

Specific inhibition of human CYPLA2 using a targeted antibody

The structural similarity of related forms of P450 makes selective immunoinhibition of individual forms notoriously difficult to achieve. We report the use of a targeted antibody to overcome this problem. An antibody was raised against the synthetic peptide, Ser-Lys-Lys-Gly-Pro-Arg-Ala-Ser-Gly-Asn-Leu-Ile, corresponding to residues 291–302 of human CYP1A2. This sequence of human CYP1A2 is located in a similar position to a proinhibitory region previously identified in rat CYP1A1 and CYP1A2. The antibody bound strongly and specifically to CYP1A2 in human hepatic microsomal fraction. Binding was unaffected by denaturation of the protein. The specificity of the antibody was demonstrated by immunoblotting of human hepatic microsomal fraction where a single immunoreactive band was identified at M, 54,000. The intensity of this band correlated strongly with high-affinity phenacetin O-deethylase activity of the microsomal fractions. In addition, the antibody bound to a single protein at M, 54,000 in the microsomal fraction of lymphoblastoid cells expressing human CYP1A2, but not to any other recombinant P450 enzyme. CYPlA2-dependent activity (high-affinity phenacetin O-deethylase) of human hepatic microsomal fraction was inhibited >90% by whole antiserum or purified immunoglobulin. This decrease in activity represents complete inhibition of CYP1A2 activity, residual phenacetin O-deethylase activity being due to low-affinity enzymes. In contrast, the antibody, which does not bind to rat CYP1A2, had no effect on CYPlA2-dependent activity (high-affinity phenacetin O-deethylase) of rat hepatic microsomal fraction. The antiserum also had no effect on human hepatic microsomal debrisoquine 4-hydroxylase (CYP2D6) or coumarin 7-hydroxylase (CYP2A6) activities, indicating that inhibition was specific to human CYP1A2. These results demonstrate the importance of the region comprising residues 291–302 of human CYP1A2 in the catalytic activity of this enzyme.

A novel mutant variant of the CYP2D6 gene (CYP2D6*17) common in a black African population: association with diminished debrisoquine hydroxylase activity.

1. The debrisoquine hydroxylase (CYP2D6) is polymorphically distributed. Not only are there differences in the proportions of extensive metabolisers to poor metabolisers in various ethnic groups, but there are also pronounced variations in the metabolic capacity among those classified as extensive metabolisers. 2. The mean debrisoquine metabolic ratio of Caucasian extensive metabolisers is lower than that for a number of African populations. In the present study, we have searched for novel CYP2D6 mutations to explain the diminished enzyme activity in African populations. 3. Three Zimbabwean Shona subjects with EM phenotypes (metabolic ratios for debrisoquine of 0.4, 1.5 and 10.5 respectively) were selected and the open reading frame of the CYP2D6 gene of each was sequenced. 4. The subject with metabolic ratio of 10.5 was found to be homozygous for an allele with a nucleotide exchange in exon 2, 1111C-->T causing a 107Thr-->Ile amino acid exchange in a conserved region of the enzyme. In addition, he was homozygous for the 2938C-->T and 4268G-->C mutations causing 296Arg-->Ser and 486Ser-->Thr amino acid substitution found in the CYP2D6*2 allele. 5. Seventy-six Zimbabwean Shona subjects were subsequently genotyped for the 1111C-->T mutation and for the intron 1 gene conversion present in the CYP2D6*2 gene. The 1111C-->T mutation was found at an allele frequency of 34% and was only present in alleles carrying the gene conversion in intron 1 indicative for the CYP2D6*2 gene. 6. This allele (CYP2D6*17), containing the 1111C-->T, 2938C-->T and 4268G-->C mutations, was found to be strongly associated with lower capacity for debrisoquine hydroxylation. We therefore postulate that the CYP2D6*17 allele might contribute to the molecular basis of the previously established diminished debrisoquine hydroxylase activity in African Bantu populations.

CYP2D6 allelic frequencies in young-onset Parkinson's disease.

Parkinson's disease (PD) is thought to develop as a result of interactions between genetic susceptibility factors and environmental exposures. One candidate gene is CYP2D6, which codes for the debrisoquine 4-hydroxylase cytochrome P450. Impairment of debrisoquine 4-hydroxylase activity has been associated with an increased risk of PD in patients with younger age at disease onset. Genotyping studies in patients with an older age at onset have reported modest increases in risk associated with the CYP2D6 B and A alleles; however, the risk for young-onset PD has not been adequately evaluated. We designed a case-control study to investigate the role of nonfunctional CYP2D6 allelic risk factors for young-onset PD in a sizable patient population and compared the distributions of CYP2D6 genotypes between young-onset ( < or = 51 years) PD patients (n = 108) and controls (n = 236). In contrast with the results from genotyping studies conducted among patients with an older age at onset, there were no significant differences in CYP2D6 allelic frequencies between young-onset PD cases and controls. The frequency of the B allele was slightly lower in the young-onset PD cases than in the controls (0.14 versus 0.20) (X2 = 2.66, p = 0.10). The presence of one or more B alleles was not associated with an increased risk of young-onset PD (odds ratio 0.58; 95% CI 0.33 to 1.00), nor was the presence of one or more nonfunctional alleles (i.e., A, B, D, and D2) (odds ratio 0.68; 95% CI 0.41 to 1.13). This study suggests that the young-onset PD population may differ from the older-onset population with respect to risk factors.

Polymorphism and smoking in bladder carcinogenesis

To study the relationship between smoking, a cytochrome P-450 gene polymorphism and the development of bladder cancer. The study comprised 126 patients with a diagnosis of bladder cancer from whom a full history was obtained. Genomic DNA was extracted from blood sampled from each patient and genotyping of the CYP2D6 locus, the gene responsible for debrisoquine hydroxylase activity, was performed using a polymerase chain-reaction technique. Of the 126 patients, 78% had a history of smoking. There was a relationship between the number of cigarettes smoked and the grade of the presenting bladder tumour; heavy smokers developed high-grade disease. There was a trend for those heterozygous at the CYP2D6 locus and with a history of smoking to develop more aggressive disease, but this trend did not reach statistical significance. The link between smoking and bladder cancer was confirmed. Furthermore, the grade of the presenting tumour was related to the 'cigarette-years'. The CYP2D6 genotype may influence the type of bladder cancer that develops in smokers.

The hyperthermic and neurotoxic effects of ‘Ecstasy’ (MDMA) and 3,4 methylenedioxyamphetamine (MDA) in the Dark Agouti (DA) rat, a model of the CYP2D6 poor metabolizer phenotype

1. The effect of administration of 3,4-methylenedioxymethamphetamine (MDMA or 'Ecstasy') and its N-demethylated product, 3,4-methylenedioxyamphetamine (MDA) on both rectal temperature and long term neurotoxic loss of cerebral 5-hydroxytryptamine (5-HT) has been studied in male and female Dark Agouti (DA) rats. The female metabolizes debrisoquine more slowly than the male and its use has been suggested as a model of the human debrisoquine 4-hydroxylase poor metabolizer phenotype. 2. A novel h.p.l.c. method was developed and used to measure plasma MDMA and MDA concentrations in the DA rats. 3. The hyperthermic response following MDMA was enhanced in female rats. Plasma MDMA concentrations were also 57% higher than in males 45 min post-injection, while plasma concentrations of MDA were 48% lower. 4. Plasma concentrations of MDMA and MDA in male rats were unaffected by pretreatment with proadifen (15 mg kg-1) or quinidine (60 mg kg-1), but the hyperthermic response to MDMA (10 mg kg-1, i.p.) was enhanced by quinidine pretreatment. 5. The hyperthermic response following MDA was greater in male DA rats, despite plasma drug concentrations being 40% higher in females 60 min after injection. 6. Seven days after a single dose of MDMA (10 mg kg-1, i.p.) there was a substantial loss in the concentration of 5-HT and 5-hydroxyindoleacetic acid (5-HIA) in cortex and hippocampus. [3H]-paroxetine binding was also decreased by 27% in the cortex, indicating that the amine loss reflected a neurodegenerative change. MDMA (5 mg kg-1, i.p.) was without effect on brain 5-HT content. content.7. A single dose of MDA (5 mg kg-1, i.p.) produced a major (approximately 40%) loss of 5-HT content of cortex and hippocampus 7 days later. The loss was similar in males and females.8 These data demonstrate that female DA rats are more susceptible to the acute hyperthermic effects ofMDMA, probably because of impaired N-demethylation and indicate that in human subjects acuteMDMA-induced toxicity may be exacerbated in poor metabolizer phenotypes. Low debrisoquine hydroxylase activity did not appear to impair the formation of a MDMA or MDA neurotoxic metabolite. Both severe acute hyperthermia and delayed neurotoxicity occurred following plasma levels of MDMA comparable to those reported in persons misusing the drug.

Dextromethorphan O-demethylase activity in rat brain microsomes

CYP2D, a genetically variable isoform of cytochrome P450, has been characterized mainly in the liver and the brain of mammals by measurement of debrisoquine hydroxylase activity. Moreover, ‘poor debrisoquine metabolizer’ phenotype is significantly increased in Parkinson's disease patients. We present here the first demonstration that the activity of the CYP2D isoform can be characterized in rat brain microsomes by the measurement of dextromethorphan O-demethylase capacity. The cerebral formation of dextrorphan, an antagonist of the N-methyl- d-aspartate receptor, was inhibited by the presence of quinidine and N-methyl-4-phenylpyridinium (MPP +), a dopaminergic neurotoxin inducing a chemical parkinsonism in humans.