Cytochrome P450 2E1 mRNA Levels Research Articles

Targeting of CYP2E1 by miRNAs in alcohol-induced intestine injury

Although binge alcohol-induced gut leakage has been studied extensively in the context of reactive oxygen species (ROS)-mediated signaling, it was recently revealed that post-transcriptional regulation plays an essential role as well. Ethanol (EtOH)-inducible cytochrome P450-2E1 (CYP2E1), a key enzyme in EtOH metabolism, promotes alcohol-induced hepatic steatosis and inflammatory liver disease, at least in part by mediating changes in intestinal permeability. For instance, gut leakage and elevated intestinal permeability to endotoxins have been shown to be regulated by enhancing CYP2E1 mRNA and CYP2E1 protein levels. Although it is understood that EtOH promotes CYP2E1 induction and activation, the mechanisms that regulate CYP2E1 expression in the context of intestinal damage remain poorly defined. Specific miRNAs, including miR-132, miR-212, miR-378, and miR-552, have been shown to repress the expression of CYP2E1, suggesting that these miRNAs contribute to EtOH-induced intestinal injury. Here, we have shown that CYP2E1 expression is regulated post-transcriptionally through miRNA-mediated degradation, as follows: 1) the RNA-binding protein AU-binding Factor 1 (AUF1) binds mature miRNAs, including CYP2E1-targeting miRNAs, and this binding modulates the degradation of corresponding target mRNAs upon EtOH treatment; 2) the Serine/Threonine kinase MST1 mediates oxidative stress-induced phosphorylation of AUF1. Those findings suggest that ROS-mediated signaling modulates AUF1/miRNA interaction through MST1-mediated phosphorylation. Thus, our study demonstrates the critical functions of AUF1 phosphorylation by MST1 in the decay of miRNAs targeting CYP2E1, the stabilization of CYP2E1 mRNA in the presence of EtOH, and the relationship of this pathway to subsequent intestinal injury.

Crocin attenuates CCl4-induced liver fibrosis via PPAR-γ mediated modulation of inflammation and fibrogenesis in rats.

Liver fibrosis is a chronic pathological condition with a leading cause of liver-related mortality worldwide. In the present study, we have evaluated the antifibrotic effect of crocin, a carotenoid present in the stigma of Crocus sativus, and also explored its putative mechanism of action. Liver fibrosis was induced by intraperitoneal administration of 30% carbon tetrachloride (CCl4). The crocin was administered orally at 20, 40 and 80 mg/kg body weight along with CCl4 up to 8 weeks. Chronic exposure to CCl4 resulted in elevated levels of liver enzymes and reduced cytochrome P450 2E1 (CYP2E1) activity in the liver. The liver tissue showed cellular swelling, vacuolization, necrosis, infiltration of inflammatory cells and fibrotic changes. The crocin treatment significantly lowered the levels of liver enzymes in serum and improved the liver CYP2E1 mRNA levels. The pathological changes in the liver were also lowered by crocin treatment. The level of pro-inflammatory cytokines, nuclear factor-kappa B, interleukin-6 and tumor necrosis factor α and fibrogenic factor, transforming growth factor β, and α-smooth muscle actin were elevated by the CCl4 in the liver tissue. However, crocin treatment at different doses significantly reduced the expression of these factors. The increased caspase 3/7 activity was also lowered by crocin. CCl4 administration decreased the expression of peroxisome proliferator-activated receptor γ (PPAR-γ) in liver tissue. The improved PPAR-γ expression in the liver by crocin treatment indicates its role in the therapeutic effect of crocin. Crocin attenuated the various events in the progression of liver fibrosis via PPAR-γ mediated modulation of inflammatory and fibrogenic pathways.

Upregulation of CYP2E1 expression causes oxidative damage induced by 2-chloroethanol in primary cultured rat astrocytes

Brain edema caused by subacute poisoning with 1,2-dichloroethane (1,2-DCE) has gained much attention during recent years, but its underlying mechanism is poorly understood. As an intermediate metabolite of 1,2-DCE in vivo, 2-chloroethanol (2-CE) can be transformed into chloroacetaldehyde and reactive oxygen species (ROS) through cytochrome P450 2E1 (CYP2E1) mediated metabolism. In previous studies, it was found that CYP2E1 expression is enhanced in the brain of mice treated with 1,2-DCE. This study was designed to verify the roles of CYP2E1 overexpression in 2-CE induced cytotoxicity in rat astrocytes, and the contribution of specific signaling molecules to the upregulation of CYP2E1 expression caused by 2-CE. The results of this study demonstrate that treatment with 2-CE can enhance CYP2E1 protein and mRNA levels, cause an increase in ROS and MDA levels, and higher percentages of apoptotic cells in rat astrocytes. Pretreatment with either diallyl sulfide or vitamin C, the inhibitor of CYP2E1 or scavenger of ROS, respectively, can suppress the levels of CYP2E1 expression, ROS and MDA, ameliorate cell apoptosis, and attenuate phosphorylation of extracellular signal-regulated kinase 1/2 (ERK1/2) in these cells. Additionally, pretreatment with the inhibitor of either ERK1/2 or transcriptional factor specificity protein 1 (SP1) can suppress the CYP2E1 expression, and alleviate the oxidative damage caused to these cells. In conclusion, our findings demonstrate that CYP2E1 overexpression plays a crucial role in 2-CE induced oxidative damage of rat astrocytes, and that CYP2E1 expression is upregulated partially through the activation of the ERK1/2 and SP1 signaling pathways by ROS generated during CYP2E1-mediated 2-CE metabolism. This study provides novel information that can be used in elucidating the mechanism by which 1,2-DCE induces brain edema.

Toxic effects of combined treatment of 1,2-dichloroethane and ethanol on mouse brain and the related mechanisms.

The aim of this study was to explore the mechanisms of brain damage induced by the combined treatment of mice with 1,2-dichloroethane (1,2-DCE) and ethanol. Mice were divided into control group; 1,2-DCE-intoxicated group; ethanol-treated group; and low-, medium-, and high-dose combined treatment groups. Histological observations along with brain organ coefficients and water content were used to measure the brain damage directly and indirectly. The levels of nonprotein sulfhydryls, malondialdehyde (MDA), and superoxide dismutase activity were used as parameters to evaluate oxidative stress in the brain. Protein and messenger RNA (mRNA) levels of cytochrome P450 2E1 (CYP2E1), zonula occludens-1 (occludin and zo-1), aquaporin-4 (AQP4), nuclear factor erythroid 2-related factor 2 (Nrf2), heme oxygenase (HO)-1, and the γ-glutamyl cysteine synthetase catalytic and modulatory subunits (γ-GCSc, GR, and γ-GCSm) in the brain were examined by Western blot analysis and quantitative polymerase chain reaction analysis, respectively. Effects of the combined treatment of 1,2-DCE and ethanol were evaluated by analysis of variance with a factorial design. The results suggested that combined exposure to ethanol and 1,2-DCE synergistically increased CYP2E1 protein and mRNA levels, accelerated the metabolism of ethanol and 1,2-DCE in the brain tissue, induced high production of reactive oxygen species (ROS), and increased MDA levels, thereby damaging the blood-brain barrier and causing obvious pathological changes in brain tissue. However, the increased level of ROS activated the Nrf2 signal transduction pathway, promoting the expression of HO-1 and glutathione-related antioxidant enzymes in the brain to protect the cells from oxidative damage.

Effect of a stilbene glycoside-rich extract from Polygoni Multiflori Radix on experimental non-alcoholic fatty liver disease based on principal component and orthogonal partial least squares discriminant analysis.

Polygoni Multiflori Radix is a traditional Chinese medicine used clinically to support the functions of the liver and kidneys and to treatment hyperlipidemia. In previous studies, an effective fraction, rich in 2,3,5,4′-tetrahydroxy stilbene-2-O-β-D-glucoside (TSG), was separated from Polygoni Multiflori Radix and demonstrated hypolipidemic activity. The present study aimed to systematically assess the effect of this fraction on non-alcoholic fatty liver disease (NAFLD). A NAFLD model was established by feeding Sprague-Dawley rats a high-fat diet with 10% fructose solution for 18 weeks. Hematoxylin and eosin staining was applied for hepatic histopathological analysis. In addition, enzyme activities, lipid metabolism, inflammatory factors and insulin resistance indices were measured using a fully automatic blood biochemistry analyser and ELISA. Furthermore, cytochrome P450 2E1 (CYP2E1) and peroxisome proliferator-activated receptor α (PPARα) mRNA and protein expression were evaluated using reverse transcription-quantitative polymerase chain reaction and western blot analysis. Principal component analysis and orthogonal partial least squares discriminant analysis were used to analyse the data. The results revealed that the TSG-rich fraction (TSGP) significantly lowered the serum total cholesterol and triglyceride levels, and the liver free fatty acid, CYP2E1 mRNA and malondialdehyde levels, in addition to mitigating hepatic enlargement and alleviating liver steatosis. Furthermore, it upregulated PPARα mRNA expression in the liver tissue. The results indicated that TSGP exhibited a protective effect against NAFLD and the underlying mechanism may involve augmentation of anti-lipid peroxidation capacity via regulation of PPARα and CYP2E1-mediated pathways.

A systematic evaluation of microRNAs in regulating human hepatic CYP2E1

Cytochrome P450 2E1 (CYP2E1) is an important drug metabolizing enzyme for processing numerous xenobiotics in the liver, including acetaminophen and ethanol. Previous studies have shown that microRNAs (miRNAs) can suppress CYP2E1 expression by binding to the 3′-untranslated region (3′-UTR) of its transcript. However, a systematic analysis of CYP2E1 regulation by miRNAs has not been described. Here, we applied in silico, in vivo, and in vitro approaches to investigate miRNAs involved in the regulation of CYP2E1. Initially, potential miRNA binding sites in the CYP2E1 mRNA transcript were identified and screened using in silico methods. Next, inverse correlations were found in human liver samples between the expression of CYP2E1 mRNA and the levels of two miRNA species, hsa-miR-214-3p and hsa-miR-942-5p. In a HepG2-derived CYP2E1 over-expression cell model, hsa-miR-214-3p exhibited strong suppression of CYP2E1 expression by targeting the coding region of its mRNA transcript, but hsa-miR-942-5p did not inhibit CYP2E1 levels. Electrophoretic mobility shift assays confirmed that hsa-miR-214-3p recruited other cellular protein factors to form stable complexes with specific sequences present in the CYP2E1 mRNA open reading frame. Transfection of HepaRG cells with hsa-miR-214-3p mimics inhibited expression of the endogenous CYP2E1 gene. Further, hsa-miR-214-3p mimics partially blocked ethanol-dependent increases in CYP2E1 mRNA and protein levels in HepG2 cells and they reduced the release of alanine aminotransferase from CYP2E1-overexpressing HepG2 cells exposed to acetaminophen. These results substantiate the suppressing effect of hsa-miR-214-3p on CYP2E1 expression.

The induction of cytochrome P450 2E1 by ethanol leads to the loss of synaptic proteins via PPARα down-regulation.

Ethanol, one of the most commonly abused substances throughout history, is a substrate and potent inducer of cytochrome P450 2E1 (CYP2E1). Our previous study showed that brain CYP2E1 was induced by chronic ethanol treatment and was associated with ethanol-induced neurotoxicity in rats. We therefore investigated the possible mechanism of brain CYP2E1 involvement in ethanol-induced neurodegeneration. Compared with the controls, chronic ethanol treatment (3.0g/kg, i.g., 160days) significantly increased CYP2E1 mRNA levels in the rat cortex, but the mRNA levels of peroxisome proliferator-activated receptor α (PPARα) and the pre- and post-synaptic proteins (synaptophysin, SYP, and drebrin1, DBN1) were decreased. Ethanol treatment dose-dependently induced CYP2E1 mRNA expression, and CYP2E1 overexpression exacerbated the ethanol-induced neurotoxicity. Pretreatment with p38 inhibitor (SB202190) and ERK1/2 inhibitor (U0126) attenuated the induction of CYP2E1 mRNA and protein levels by ethanol; however, no change was observed with JNK inhibitor pretreatment. Ethanol exposure or CYP2E1 overexpression significantly decreased PPARα, SYP, and DBN1 expression as indicated by the data from real-time RT-PCR, Western blotting and immunocytochemistry. The activation of PPARα by WY14643 increased the activity of the SYP and DBN1 promoters and attenuated the inhibition of these genes by ethanol. The specific siRNA for CYP2E1 significantly attenuated the ethanol-induced inhibition of PPARα, SYP and DBN1 mRNA levels. These results suggest that the induction of CYP2E1 by ethanol may be mediated via the p38 and ERK1/2 signaling pathways in neurons but not via the JNK pathway. The CYP2E1-PPARα axis may play a role in ethanol-induced neurotoxicity via the alteration of the genes related with synaptic function.

CYP2E1 in the Human Retinal Pigment Epithelium: Expression, Activity, and Induction by Ethanol.

Cytochrome p450 2E1 (CYP2E1) is a detoxifying enzyme with particular affinity for ethanol (EtOH) expressed in several tissues. Although CYP2E1 has been identified in human RPE, nothing is known about its metabolic activity. Expression of CYP2E1 and activity after EtOH exposure have been studied in human RPE and ARPE-19 cells. Ethanol-induced CYP2E1 mRNA expression was analyzed by RT-PCR and quantitative PCR (qPCR) from human donor RPE as well as from ARPE-19 cells. Expression of CYP2E1 protein was determined by Western blot. Cytoplasmic CYP2E1 location also was demonstrated by immunocytochemistry. Cell viability was studied by the colorimetric assay XTT after EtOH treatment. Diallyl sulfide (DAS) was used to inhibit CYP2E1 activity. The microsomal CYP2E1 activity assay was determined by quantification of 4-nitrocatechol (4NC) formation through HPLC. Relevant CYP2E1 mRNA levels are present in human RPE. Ethanol augmented the formation of reactive oxygen species (ROS) in ARPE-19 cells. Expression of CYP2E1 mRNA, CYP2E1 protein activity, and ROS production were induced by ethanol in a concentration-dependent manner. Interestingly, the treatment with DAS reduced all the aforementioned increased values. The presence of CYP2E1 in both hRPE and ARPE-19 cells reinforces the protective role of the RPE and strongly suggests additional roles for CYP2E1 related to vision.

Pre-endurance training prevents acute alcoholic liver injury in rats through the regulation of damaged mitochondria accumulation and mitophagy balance.

The aim of this study is to investigate the effect of pre-endurance training on the prevention of alcohol-induced acute hepatic injury and on hepatic mitophagy. Forty-eight male Sprague-Dawley rats were randomly divided into four groups: (1) control group, (2) 12-week exercise training group, (3) 5-day alcohol intake group, and (4) 12-week exercise training plus 5-day alcohol intake group. The rats were examined to determine the following: BCL2/adenovirus E1B 19kDa protein-interacting protein 3 (BNIP3), hypoxia-inducible factor-1α (HIF-1α), cytochrome P450 2E1 (CYP2E1), alcohol dehydrogenase (ADH), microtubule-associated protein 1 light chain 3 (LC3II), Beclin1 mRNA and protein expressions, mitochondrial reactive oxygen species (ROS) production, mitochondrial thiobarbituric acid-reactive substances (TBARS) level, aconitase and ATP synthase activities, mitochondrial inner membrane potential, NADH/NAD(+) ratio, triglyceride (TG), the number of mtDNA and mitochondrial respiration functions in liver tissue, and serum ALT and AST. Pre-endurance training attenuated acute alcohol treatment-induced increase in mitochondrial TBARS, ROS production, NADH/NAD(+) ratio, state 4 respiration rate, TG, serum ALT and AST, as well as BNIP3, HIF-1α, LC3II, and Beclin 1 mRNA and protein levels, however, CYP2E1 and ADH mRNA and protein levels unchanged. Meanwhile, it attenuated the acute alcohol intake-induced decrease in aconitase activity, inner mitochondrial membrane potential (Δψ), ATP synthase activity, state 3 respiration rate, respiratory control ratio, and the number of mtDNA. Pre-endurance training can decrease acute alcohol intake-induced damaged mitochondria accumulation and reduced acute alcohol intake-induced mitophagy, which built a new balance between mitophagy and damaged mitochondria accumulation.

2,3,7,8-Tetrachlorodibenzo-p-dioxin enhances CCl4-induced hepatotoxicity in an aryl hydrocarbon receptor-dependent manner

1. Cytochrome P4502E1 (CYP2E1) is involved in the biotransformation of several low molecular weight chemicals and plays an important role in the metabolic activation of carcinogens and hepatotoxins such as CCl4. Induction of CYP2E1 is exerted mainly at posttranscriptional levels through mRNA and protein stabilization, and there is little evidence of xenobiotic induction at the transcriptional level. Previously, we reported microarray analysis data suggesting a decrease in Cyp2e1 gene expression on Ahr-null livers when compared to wild-type mouse livers.2. The goal of the present study was to determine whether 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) increased mouse CYP2E1 levels in an AhR-dependent manner and the impact on CCl4-induced hepatotoxicity.3. TCDD treatment induced CYP2E1 mRNA and protein levels in mouse liver, and this effect was aryl hydrocarbon receptor (AhR)-dependent.4. Moreover, TCDD pre-treatment increased the CCl4-induced alanine aminotransferase (ALT) activity, the extent of CCl4-induced necrosis, and the number of sinusoidal cells in wild-type animals, while this potentiating effect was not observed in Ahr-null mice.5. In conclusion, this study revealed that TCDD, probably in an AhR-dependent manner, exacerbated CCl4-induced hepatotoxicity through induction of CYP2E1.

CYP2E1 mRNA Expression, Genetic Polymorphisms in Peripheral Blood Lymphocytes and Liver Abnormalities in Chinese VCM-Exposed Workers

To study the relationship between expression of cytochrome P4502E1 (CYP2E1) in human lymphocytes, variant CYP2E1 genotype, exposure to vinyl chloride monomer (VCM), and liver abnormalities in VCM-exposed workers. A case-control study was performed on 90 male occupationally exposed workers and 42 matched male nonexposed controls. Data were collected based on health surveillance, workplace investigation and questionnaire Survey. Total RNA and DNA were isolated from peripheral blood lymphocytes, and CYP2E1 mRNA expression was determined using RT-PCR, and the presence of CYP2E1 polymorphisms was identified based on PCR-RFLP. The mRNA expression of CYP2E1 in exposed workers (0.89+/-0.46) was significantly higher than in nonexposed controls (0.61+/-0.35) (P < 0.01). Logistic regression analysis demonstrated a statistically significant association between CYP2E1 mRNA expression levels and liver abnormalities in the VCM-exposed workers (OR = 3.66, P < 0.05). The genotype frequency for CYP2E1 variants among VCM-exposed workers was not significantly different between workers with liver abnormalities and those without. Liver abnormalities in subjects exposed to VCM are positively associated with expression of peripheral blood lymphocyte mRNA, which is significantly increased in exposed workers compared to nonexposed controls. Therefore, CYP2E1 mRNA levels may be useful for health surveillance and protection of VCM-exposed workers.

Occupational Toluene Exposure Induces Cytochrome P450 2E1 mRNA Expression in Peripheral Lymphocytes

Print workers are exposed to organic solvents, of which the systemic toxicant toluene is a main component. Toluene induces expression of cytochrome P450 2E1 (CYP2E1), an enzyme involved in its own metabolism and that of other protoxicants, including some procarcinogens. Therefore, we investigated the association between toluene exposure and the CYP2E1 response, as assessed by mRNA content in peripheral lymphocytes or the 6-hydroxychlorzoxazone (6OH-CHZ)/chlorzoxazone (CHZ) quotient (known as CHZ metabolic ratio) in plasma, and the role of genotype (5′-flanking region RsaI/PstI polymorphic sites) in 97 male print workers. The geometric mean (GM) of toluene concentration in the air was 52.80 ppm (10–760 ppm); 54% of the study participants were exposed to toluene concentrations that exceeded the maximum permissible exposure level (MPEL). The GM of urinary hippuric acid at the end of a work shift (0.041 g/g creatinine) was elevated relative to that before the shift (0.027 g/g creatinine; p < 0.05). The GM of the CHZ metabolic ratio was 0.33 (0–9.3), with 40% of the subjects having ratios below the GM. However, the average CYP2E1 mRNA level in peripheral lymphocytes was 1.07 (0.30–3.08), and CYP2E1 mRNA levels within subjects correlated with the toluene exposure ratio (environmental toluene concentration:urinary hippuric acid concentration) (p = 0.014). Genotype did not alter the association between the toluene exposure ratio and mRNA content. In summary, with further validation, CYP2E1 mRNA content in peripheral lymphocytes could be a sensitive and noninvasive biomarker for the continuous monitoring of toluene effects in exposed persons.

Comparison of cytochrome P4502E1 (CYP2E1) activity and hepatic and lymphocyte mRNA expression in patients with chronic hepatitis C

The induction of cytochrome P4502E1 (CYP2E1) is believed to play a role in the development of fibrosis in hepatitis C patients. However, information about CYP2E1 activity in chronic hepatitis C patients is fragmentary and the relationship between CYP2E1 activity and mRNA expression is unknown in this disease. The purpose of this study was (a) to characterise CYP2E1 activity in those patients and (b) to analyse its relationship with CYP2E1 mRNA expression in the liver and in peripheral blood lymphocytes (PBLs), previously proposed as a surrogate to assess changes in CYP2E1 activity. Fourteen chronic hepatitis C patients were submitted to a routine transcutaneous liver biopsy. CYP2E1 activity was assessed by using chlorzoxazone (CZX) pharmacokinetic parameters and hepatic and PBLs CYP2E1 mRNA expression was measured by real-time RT-PCR. The mean oral clearance of CZX (CL T: 21.5 ± 10.1 L/h) was within the normal range and the chlorzoxazone metabolic ratio (CMR) at t = 2 h was closely related to other CZX pharmacokinetic parameters. None of the pharmacokinetic parameters did significantly correlate with CYP2E1 mRNA, neither in the liver nor in PBLs. Furthermore, there was no significant relationship between CYP2E1 mRNA levels in paired liver and PBL samples. Our data indicate that early stages of chronic hepatitis C are not associated with CYP2E1 induction. In this disease, the determination of the CMR at t = 2 h represents a reliable index to assess CYP2E1 activity. The measurement of CYP2E1 expression, at the mRNA level, in PBLs or in liver is not useful for that purpose.

Study of Cytochrome P4502E1 mRNA Level of Mononuclear Cells in Patients With Alcoholic Liver Disease

Background: Cytochrome P‐4502E1 (CYP2E1) is an important enzyme because of its unique ability to convert many substrates to cytotoxins. The increased production of reactive intermediates by elevated enzyme concentrations leads to various pathological conditions. Therefore, it is important to detect induced CYP2E1 levels in alcoholic individuals to avoid xenobiotic‐promoted liver injury. In the present investigation, we detected CYP2E1 mRNA levels of mononuclear cells obtained from 10 ml of blood by using competitive polymerase chain reaction (PCR) method.Methods: Mononuclear cells were obtained from healthy individuals who did and did not drink habitually and patients with alcoholic liver disease (ALD). Complementary DNA synthesis was performed with RNA obtained from mononuclear cells by reverse transcription‐PCR. Competitive PCR of CYP2E1 was performed with the sense (5′‐CTGCAACGTCATA‐GCCGACA‐3′) and antisense (5′‐TCCATTTCCACGAGCAGGCA‐3′) primer and competitor DNA. Competitive PCR of β‐actin also was performed. Electrophoresis was scanned, and each band was digitized. The concentration of CYP2E1 and β‐actin mRNA was calculated from the ratio of competitor DNA.Results: In healthy individuals who did and did not drink habitually, CYP2E1 mRNA levels were 103.3 copies/μl RNA and 101.7 copies/μl RNA, respectively. In actively drinking patients with ALD, CYP2E1 mRNA levels were 103.5 copies/μl RNA, but those levels decreased to 101.7 copies/μl RNA after 4 days of abstinence. No significant difference was observed in CYP2E1 mRNA levels between alcoholic fibrosis and cirrhosis. As control, we measured β‐actin mRNA levels in mononuclear cells in all samples. The mean value of β‐actin mRNA was 104.3 copies/μl RNA in all cases, which included patients with ALD.Conclusions: The results demonstrated that it is possible to measure the CYP2E1 mRNA levels of mononuclear cells in a 10 ml blood sample. The CYP2E1 mRNA level in mononuclear cells increases during drinking and decreases in abstinence for a short period of 3 to 4 days. It is concluded that CYP2E1 mRNA level may be used as an effective marker for alcoholic intake.

Study of cytochrome P4502E1 mRNA level of mononuclear cells in patients with alcoholic liver disease.

Cytochrome P-4502E1 (CYP2E1) is an important enzyme because of its unique ability to convert many substrates to cytotoxins. The increased production of reactive intermediates by elevated enzyme concentrations leads to various pathological conditions. Therefore, it is important to detect induced CYP2E1 levels in alcoholic individuals to avoid xenobiotic-promoted liver injury. In the present investigation, we detected CYP2E1 mRNA levels of mononuclear cells obtained from 10 ml of blood by using competitive polymerase chain reaction (PCR) method. Mononuclear cells were obtained from healthy individuals who did and did not drink habitually and patients with alcoholic liver disease (ALD). Complementary DNA synthesis was performed with RNA obtained from mononuclear cells by reverse transcription-PCR. Competitive PCR of CYP2E1 was performed with the sense (5'-CTGCAACGTCATA-GCCGACA-3') and antisense (5'-TCCATTTCCACGAGCAGGCA-3') primer and competitor DNA. Competitive PCR of beta-actin also was performed. Electrophoresis was scanned, and each band was digitized. The concentration of CYP2E1 and beta-actin mRNA was calculated from the ratio of competitor DNA. In healthy individuals who did and did not drink habitually, CYP2E1 mRNA levels were 103.3 copies/microl RNA and 101.7 copies/microl RNA, respectively. In actively drinking patients with ALD, CYP2E1 mRNA levels were 103.5 copies/microl RNA, but those levels decreased to 101.7 copies/microl RNA after 4 days of abstinence. No significant difference was observed in CYP2E1 mRNA levels between alcoholic fibrosis and cirrhosis. As control, we measured beta-actin mRNA levels in mononuclear cells in all samples. The mean value of beta-actin mRNA was 104.3 copies/microl RNA in all cases, which included patients with ALD. The results demonstrated that it is possible to measure the CYP2E1 mRNA levels of mononuclear cells in a 10 ml blood sample. The CYP2E1 mRNA level in mononuclear cells increases during drinking and decreases in abstinence for a short period of 3 to 4 days. It is concluded that CYP2E1 mRNA level may be used as an effective marker for alcoholic intake.

Role of glucose utilization in the restoration of hypophysectomy-induced hepatic cytochrome P450 2E1 by growth hormone in rats

Growth hormone and insulin are the primary determinants for cytochrome P450 2E1 (CYP2E1) expression. The role of glucose on the induction of CYP2E1 by hypophysectomy and on the restorative effect by growth hormone was investigated in the rat liver. Western and Northern blot analyses revealed that hypophysectomy induced CYP2E1 by 5-fold at 1–4 weeks, relative to control, with a concomitant increase in CYP2E1 mRNA. Hypophysectomized rats (HXR) showed a 20% reduction in the plasma glucose level. Hypophysectomy-induced increase in the CYP2E1 mRNA was completely abolished by glucose feeding in drinking water (10%) for 7 days. Treatment of HXR with hGH (2 I.U./kg, twice a day, for 7 days) inhibited the increases in CYP2E1 protein and mRNA levels with restoration of the plasma glucose level. In contrast to the effect of human growth hormone (hGH) on CYP2E1 in HXR with free access to foods, CYP2E1 expression failed to be restored by hGH in starving HXR. However, glucose feeding of starving HXR abolished the induction of CYP2E1. Effects of hypophysectomy and hGH treatment were studied in streptozotocin-induced diabetic rats. Insulin, but not hGH, prevented an increase in CYP2E1 mRNA in diabetic rats. The hepatic CYP2E1 induction in hypophysectomized diabetic rats was inhibited by hGH treatment, indicating that the hGH effect on CYP2E1 expression did not involve insulin production. These results provide evidence that the induction of hepatic CYP2E1 by hypophysectomy may result from reduced glucose utilization, and that the effect of hGH on CYP2E1 expression may be mediated with enhanced glucose utilization, but not with insulin production.

The induction of the human hepatic CYP2E1 gene by interleukin 4 is transcriptional and regulated by protein kinase C.

Cytochrome P4502E1 (CYP2E1) plays a key role in the metabolism of numerous drug substrates, mostly in mammalian liver. Both the apoprotein and mRNA levels are increased in response to interleukin 4 (IL-4) in primary human hepatocyte cultures. We developed a human hepatoma cell model that faithfully reproduces the responsiveness of the CYP2E1 gene to IL-4 at least in part through transcriptional activation, upon treatment with 150 U/ml of IL-4. As expected, IL-4 induced tyrosine phosphorylation of the STAT6 transcription factor, an effect prevented by the tyrosine kinase inhibitor tyrphostin A25. However, this inhibitor as well as genistein (another inhibitor of tyrosine kinases) had no effect on the IL-4 induction of CYP2E1. Similarly, protein kinase A activators (forskolin and dibutyryl-cAMP) and inhibitor (H89) did not influence the response to IL-4. However, PKC inhibitors (H7 and calphostin C) strongly blocked any induction of the gene, as well as the IL-4-dependent translocation of PKCS. Taken together, our results show that IL-4 coordinately induces CYP2E1 transcription, mRNA and apoprotein levels in human hepatoma cells in a PKC-dependent manner, potentially through the activity of the PKCzeta isoform.

Differential expression of cytochrome P4502E1 (CYP2E1) in Morris hepatomas and livers of tumor bearing rats.

The objective of this investigation was to determine if the decrease of cytochrome P4502E1 (CYP2E1) in hepatomas is related to the tumor growth rate. There was a significant correlation between N-nitrosodimethylamine (NDMA) demethylase activities and CYP2E1 protein levels in rat liver and hepatomas. The levels of NDMA demethylase activities and CYP2E1 protein content were lower in hepatomas than in the corresponding host livers. NDMA demethylase activities and CYP2E1 protein levels were greater in hepatomas of slow and intermediate growth rate than in fast growing hepatomas. A similar trend was also observed with CYP2E1 mRNA levels. The results demonstrated an inverse relationship between growth rate of rat hepatomas and the expression of CYP2E1.

Differential Effects of Ciprofibrate on Renal and Hepatic Cytochrome P450 2E1 Expression

Since cytochrome P450 2E1 (CYP2E1) mRNA levels have been reported to be increased during physiological states in which peroxisomes are increased, we examined the effects of the peroxisome proliferator, ciprofibrate (CIPRO), on renal and hepatic CYP2E1 expression, as well as other enzymes associated with peroxisome proliferation, including CYP4A, CYP2B, fatty acyl CoA oxidase (FACO), and peroxisomal thiolase (PT). Male rats were treated with CIPRO for 18, 48, or 120 hr. Northern blot or immunoblot analyses were used to determine mRNA or protein levels, respectively, relative to levels in vehicle controls. CIPRO elevated renal CYP2E1 and CYP4A mRNA levels approximately 3- to 4-fold at 18 hr, and these levels remained elevated to 120 hr. CIPRO progressively increased renal CYP2E1 and CYP4A protein levels, so that approximately 7- and 4-fold increases, respectively, were observed at 120 hr of treatment. CIPRO treatment increased renal peroxisomal FACO mRNA levels approximately 2-fold and PT mRNA levels approximately 4- to 6-fold at all time points. In contrast to results observed in the kidney, hepatic CYP2E1 mRNA and protein levels were unchanged by CIPRO treatment. Hepatic CYP4A mRNA levels were increased approximately 100-fold at all time points. Hepatic CYP2B mRNA levels were elevated approximately 5-fold, but only at the 120-hr time point. Hepatic CYP4A and CYP2B protein levels were elevated in proportion to the respective mRNA levels. Hepatic FACO mRNA levels were increased approximately 5-, 9-, and 20-fold, and hepatic PT mRNA levels were increased approximately 15-, 24-, and 39-fold, at 18, 48, and 120 hr, respectively. These results show that CIPRO-mediated, tissue-specific changes in CYP2E1 expression are not obligatorily associated with elevations in peroxisomal enzymes.

Differential effects of ciprofibrate on renal and hepatic cytochrome P450 2E1 expression

Since cytochrome P450 2E1 (CYP2E1) mRNA levels have beenreported to be increased during physiological states in which peroxisomes are increased, we examined the effects of the peroxisome proliferator, ciprofibrate (CIPRO), on renal and hepatic CYP2E1 expression, as well as other enzymes associated with peroxisome proliferation, including CYP4A, CYP2B, fatty acyl CoA oxidase (FACO), and peroxisomal thiolase (PT). Male rats were treated with CIPRO for 18, 48, or 120 hr. Northern blot or immunoblot analyses were used to determine mRNA or protein levels, respectively, relative to levels in vehicle controls. CIPRO elevated renal CYP2E1 and CYP4A mRNA levels ∼3- to 4-fold at 18 hr, and these levels remained elevated to 120 hr. CIPRO progressively increased renal CYP2E1 and CYP4A protein levels, so that ∼7-and 4-fold increases, respectively, were observed at 120 hr of treatment. CIPRO treatment increased renal peroxisomal FACO mRNA levels ∼2-fold and PT mRNA levels ∼4- to 6-fold at all time points. In contrast to results observed in the kidney, hepatic CYP2E1 mRNA and protein levels were unchanged by CIPRO treatment. Hepatic CYP4A mRNA levels were increased ∼100-fold at all time points. Hepatic CYP2B mRNA levels were elevated ∼5-fold, but only at the 120-hr time point. Hepatic CYP4A and CYP2B protein levels were elevated in proportion to the respective mRNA levels. Hepatic FACO mRNA levels were increased ∼5-, 9-, and 20-fold, and hepatic PT mRNA levels were increased ∼15-, 24-, and 39-fold, at 18, 48, and 120 hr, respectively. These results show that CIPRO-mediated, tissue-specific changes in CYP2E1 expression are not obligatorily associated with elevations in peroxisomal enzymes.