Core Promoter Sequences Research Articles

Unlocking the Transcriptional Control of NCAPG in Bovine Myoblasts: CREB1 and MYOD1 as Key Players.

Muscle formation directly determines meat production and quality. The non-SMC condensin I complex subunit G (NCAPG) is strongly linked to the growth features of domestic animals because it is essential in controlling muscle growth and development. This study aims to elucidate the tissue expression level of the bovine NCAPG gene, and determine the key transcription factors for regulating the bovine NCAPG gene. In this study, we observed that the bovine NCAPG gene exhibited high expression levels in longissimus dorsi and spleen tissues. Subsequently, we cloned and characterized the promoter region of the bovine NCAPG gene, consisting of a 2039 bp sequence, through constructing the deletion fragment double-luciferase reporter vector and site-directed mutation-identifying core promoter region with its key transcription factor binding site. In addition, the key transcription factors of the core promoter sequence of the bovine NCAPG gene were analyzed and predicted using online software. Furthermore, by integrating overexpression experiments and the electrophoretic mobility shift assay (EMSA), we have shown that cAMP response element binding protein 1 (CREB1) and myogenic differentiation 1 (MYOD1) bind to the core promoter region (-598/+87), activating transcription activity in the bovine NCAPG gene. In conclusion, these findings shed important light on the regulatory network mechanism that underlies the expression of the NCAPG gene throughout the development of the muscles in beef cattle.

Novel synthetic inducible promoters controlling gene expression during water-deficit stress with green tissue specificity in transgenic poplar.

Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5' and 3' regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5': GTTAACTTCA) and Syn3-10b-2 (3': GGGCCTGTGG). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5' sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3' sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter.

The transcriptome of the parapoxvirus Orf virus reveals novel promoters for heterologous gene expression by poxvirus vectors

Orf virus (ORFV) has been used as a vaccine delivery vector for multiple animal species. Several strategies are being used to improve the immunogenicity and efficacy of ORFV vectors, including the use of poxviral promoter(s) with strong early and late activity capable of driving the expression of the heterologous genes for a prolonged time and eliciting a potent immune response. Here, we used RNA-sequencing (RNA-Seq) approach to analyze the transcriptome of ORFV during infection in primary ovine cells. Based on the transcriptional profile of individual ORFV genes, we identified ORFV promoters with strong early and late activity and have shown that they can be used to express heterologous genes in ORFV vectors. Our results show that the intergenic regulatory sequence containing core promoter sequences present upstream of ORF112 (p112) and ORF116 (p116) lead to markedly higher transgene expression than conventional poxviral promoters. Thus, these promoters are valuable alternatives to express transgenes in poxviral vectors.

A Novel Method to Screen Strong Constitutive Promoters in Escherichia coli and Serratia marcescens for Industrial Applications.

Promoters serve as the switch of gene transcription, playing an important role in regulating gene expression and metabolites production. However, the approach to screening strong constitutive promoters in microorganisms is still limited. In this study, a novel method was designed to identify strong constitutive promoters in E. coli and S. marcescens based on random genomic interruption and fluorescence-activated cell sorting (FACS) technology. First, genomes of E. coli, Bacillus subtilis, and Corynebacterium glutamicum were randomly interrupted and inserted into the upstream of reporter gene gfp to construct three promoter libraries, and a potential strong constitutive promoter (PBS) suitable for E. coli was screened via FACS technology. Second, the core promoter sequence (PBS76) of the screened promoter was identified by sequence truncation. Third, a promoter library of PBS76 was constructed by installing degenerate bases via chemical synthesis for further improving its strength, and the intensity of the produced promoter PBS76-100 was 59.56 times higher than that of the promoter PBBa_J23118. Subsequently, promoters PBBa_J23118, PBS76, PBS76-50, PBS76-75, PBS76-85, and PBS76-100 with different strengths were applied to enhance the metabolic flux of L-valine synthesis, and the L-valine yield was significantly improved. Finally, a strong constitutive promoter suitable for S. marcescens was screened by a similar method and applied to enhance prodigiosin production by 34.81%. Taken together, the construction of a promoter library based on random genomic interruption was effective to screen the strong constitutive promoters for fine-tuning gene expression and reprogramming metabolic flux in various microorganisms.

Sp1 Controls the Basal Level of Interleukin-34 Transcription

ABSTRACT Interleukin-34 (IL-34) is a cytokine that plays important roles at steady state and in diseases. The induced or inhibited expression of IL-34 by stimuli has been deeply investigated. However, the regulation of IL-34 basal expression is largely unknown. The aim of this study is to investigate whether IL-34 expression is regulated by a general transcription factor Specificity Protein 1 (Sp1) at transcription level. By using bioinformatic software, four putative Sp1-binding sites overlapping GC boxes were found in the core promoter region of IL-34. Alignment of the core promoter sequences of mammalian IL-34 showed GC box-C (−62/–57) and D (−11/–6) were conserved in some mammals. Luciferase assay results showed that only deletion of GC box-C (−62/–57) significantly reduced luciferase activities of IL-34 core promoter in SH-SY5Y cells. By using electrophoretic mobility shift assay (EMSA), it was found that Sp1 specifically interacted with GC box-C sequence CCCGCC (−62/–57) in the core promoter of IL-34. By using chromatin immunoprecipitation (ChIP), it was discovered that Sp1 bound to the core promoter of IL-34 in living cells. In addition, silencing of Sp1 expression by its specific siRNA reduced IL-34 mRNA and protein levels significantly in SH-SY5Y cells. Likewise, IL-34 expression was inhibited in a dose-dependent manner by a Sp1 inhibitor Plicamycin. Furthermore, silencing of Sp1 also downregulated mRNA and protein expression of IL-34 in GES-1 and 293T cell lines, suggesting that IL-34 transcription regulated by Sp1 was not cell-type specific. Taken together, these results indicate that Sp1 controls the basal level of IL-34 transcription.

Classification and characterization of alternative promoters in 26 lung adenocarcinoma cell lines.

Genome-wide landscape of alternative promoter use remains unknown. We determined expression profiles of promoters in 26 lung adenocarcinoma cell lines using the transcriptional start site-sequencing data and proposed an index 'canonical promoter usage' to quantify the diversity of alternative promoter usage. Transcriptional start site-sequencing and other datasets were obtained from the DataBase of Transcriptional Start Sites. Transcriptional start site-sequencing read clusters were mapped onto RefGene to determine the promoters. Commonly used promoters were designated as canonical promoters. The sequence logos, CpG islands, DNA methylation and histone modifications of canonical and non-canonical promoters were examined. Canonical promoter usage was calculated by dividing 'read counts of a canonical promoter' by 'read counts of all the units of promoters' on each gene. The expressed genes were subjected to hierarchical clustering according to their canonical promoter usage. Among 104 455 promoters for 14 297 genes, 8659 canonical and 68 197 non-canonical promoters were identified. Corresponding to higher expression, canonical promoters showed core promoter sequences, higher CpG island positivity, less DNA methylation and higher transcription-promoting histone modifications. Gene ontology enrichment analysis revealed that the clusters with lower canonical promoter usage were related to signalling pathways, whereas clusters of tightly regulated genes with higher canonical promoter usage were related to housekeeping genes. Canonical promoters were regulated by conventional transcriptional machinery, while non-canonical promoters would be targets of 'leaky' expression. Further investigation is warranted to analyse the correlation between alternative promoter usage and biological characteristics contributing to carcinogenesis.

Molecular Characteristics and Promoter Analysis of Porcine COL1A1.

COL1A1 encodes the type I collagen α1 chain, which shows the highest abundance among members of the collagen family and is widely expressed in different mammalian cells and tissues. However, its molecular characteristics are not completely elucidated. In this study, the molecular profiles of COL1A1 and characteristics of the COL1A1 protein were investigated using a promoter activity assay and multiple bioinformatics tools. The results showed that the 5' flanking region of porcine COL1A1 contained two CpG islands, five core promoter sequences, and twenty-six transcription factor-binding sites. In the luciferase assay, the upstream 294 bp region of the initiation codon of COL1A1 showed the highest activity, confirming that this section is the core region of the porcine COL1A1 promoter. Bioinformatic analysis revealed that COL1A1 is a negatively charged, hydrophilic secreted protein. It does not contain a transmembrane domain and is highly conserved in humans, mice, sheep, and pigs. Protein interaction analysis demonstrated that the interaction coefficient of COL1A1 with COL1A2, COL3A1, ITGB1, and ITGA2 was greater than 0.9, suggesting that this protein plays a crucial role in collagen structure formation and cell adhesion. These results provide a theoretical basis for further investigation of the functions of porcine COL1A1.

Core promoter in TNBC is highly mutated with rich ethnic signature.

The core promoter plays an essential role in regulating transcription initiation by controlling the interaction between transcriptional factors and sequence motifs in the core promoter. Although mutation in core promoter sequences is expected to cause abnormal gene expression leading to pathogenic consequences, limited supporting evidence showed the involvement of core promoter mutation in diseases. Our previous study showed that the core promoter is highly polymorphic in worldwide human ethnic populations in reflecting human history and adaptation. Our recent characterization of the core promoter in triple-negative breast cancer (TNBC), a subtype of breast cancer, in a Chinese TNBC cohort revealed the wide presence of core promoter mutation in TNBC. In the current study, we analyzed the core promoter in a Thai TNBC cohort. We also observed rich core promoter mutation in the Thai TNBC patients. We compared the core promoter mutations between Chinese and Thai TNBC cohorts. We observed substantial differences of core promoter mutation in TNBC between the two cohorts, as reflected by the mutation spectrum, mutation-effected gene and functional category, and altered gene expression. Our study confirmed that the core promoter in TNBC is highly mutable, and is highly ethnic-specific.

Roles of MEF2A and MyoG in the transcriptional regulation of bovine LATS2 gene

As an important downstream effector gene in the hippo signaling pathway, large tumor suppressor gene 2 (LATS2) is involved in cell proliferation and differentiation, organ size and tissue regeneration, and plays an important role in regulating the growth and development of animal muscles. The purpose of this study is to explore the temporal expression of bovine LATS2 gene, and determine the key transcription factors for regulating bovine LATS2 gene. The result showed that bovine LATS2 gene was highly expressed in liver and longissimus dorsi, and was up-regulated in infancy muscle. In addition, it was highly expressed on the 2th day during the differentiation stage of myoblast. The upstream 1.7 Kb sequence of the 5 ‘translation region of bovine LATS2 gene was cloned, and 7 different deletion fragments were amplified by the upstream primers. These fragments were constructed into double luciferase reporter vectors and transfected into myoblasts and myotubes cells, respectively to detect the core promoter regions. In addition, the key transcription factors of the core promoter sequence of the bovine LATS2 gene were analyzed and predicted by online software. Combining with site-directed mutations, siRNA interference and chromatin immunoprecipitation technology, it was identified that MEF2A and MyoG combined in core promoter region (−248/−56) to regulate the transcription activity of bovine LATS2 gene. The results have laid a theoretical foundation for exploring the molecular regulation mechanism of LATS2 gene in the process of muscle growth.

Etiological roles of core promoter variation in triple-negative breast cancer

Abnormal gene expression plays key role in cancer development. A core promoter is located around the transcriptional start site. Through interaction between core promoter sequences and transcriptional factors, core promoter controls transcriptional initiation. We hypothesized that in cancer, core promoter sequences could be mutated to interfere the interaction with transcriptional factors, resulting in altered transcriptional initiation and abnormal gene expression and cancer development. We used triple-negative breast cancer (TNBC) as a model to test our hypothesis. We collected genome-wide core promoter variants from 279 TNBC genomes. After extensive filtering of normal genomic polymorphism, we identified 19,427 recurrent somatic variants in 1,238 core promoters of 1,274 genes and 1,694 recurrent germline variants in 272 core promoters of 294 genes. Many of the affected genes were oncogenes and tumor suppressors. Analysis of RNA-seq data from the same patient cohort identified increased or decreased gene expression in 439 somatic and 85 germline variants-affected genes, and the results were validated by luciferase reporter assay. By comparing with the core promoter variation data from 610 unclassified breast cancer, we observed that core promoter variants in TNBC were highly TNBC-specific. We further identified the drugs targeting the genes with core promoter variation. Our study demonstrates that core promoter is highly mutable in cancer, and can play etiological roles in TNBC and other types of cancer through influencing transcriptional initiation.

Microarray profiling and identification of core promoter sequence in Gordonia

Gordonia are Gram-positive bacteria which have immense biotechnological potential. Genomes of several Gordonia spp. have been sequenced but a detailed analysis of the differentially expressed genes during growth, the promoters which drive their expression and the information on the core promoter sequence is lacking. Here, we report the identification of core promoter sequence in Gordonia sp. IITR100. The GC content of the promoters was found to be within a range of 62–65%. The 5′-UTR length in the genes was also analysed and about 56% promoters were found to have long 5′-UTR. The functionality of the promoters was validated by microarray profiling. Based on the differential expression of genes, two growth phase dependent promoters PdsbA and Pglx were isolated and analysed. They add to the existing repertoire of the promoters functional in both Gram-negative and Gram-positive bacteria. Our results suggest that the core promoter sequence identified is conserved in members of Gordonia spp. and is similar to that of other members of Actinobacteria.

Androgen receptor transactivates KSHV noncoding RNA PAN to promote lytic replication-mediated oncogenesis: A mechanism of sex disparity in KS.

Kaposi's sarcoma-associated herpesvirus (KSHV) preferentially infects and causes Kaposi's sarcoma (KS) in male patients. However, the biological mechanisms are largely unknown. This study was novel in confirming the extensive nuclear distribution of the androgen receptor (AR) and its co-localization with viral oncoprotein of latency-associated nuclear antigen in KS lesions, indicating a transcription way of AR in KS pathogenesis. The endogenous AR was also remarkably higher in KSHV-positive B cells than in KSHV-negative cells and responded to the ligand treatment of 5α-dihydrotestosterone (DHT), the agonist of AR. Then, the anti-AR antibody-based chromatin immunoprecipitation (ChIP)-associated sequencing was used to identify the target viral genes of AR, revealing that the AR bound to multiple regions of lytic genes in the KSHV genome. The highest peak was enriched in the core promoter sequence of polyadenylated nuclear RNA (PAN), and the physical interaction was verified by ChIP-polymerase chain reaction (PCR) and the electrophoretic mobility shift assay (EMSA). Consistently, male steroid treatment significantly transactivated the promoter activity of PAN in luciferase reporter assay, consequently leading to extensive lytic gene expression and KSHV production as determined by real-time quantitative PCR, and the deletion of nuclear localization signals of AR resulted in the loss of nuclear transport and transcriptional activity in the presence of androgen and thus impaired the expression of PAN RNA. Oncogenically, this study identified that the AR was a functional prerequisite for cell invasion, especially under the context of KSHV reactivation, through hijacking the PAN as a critical effector. Taken together, a novel mechanism from male sex steroids to viral noncoding RNA was identified, which might provide a clue to understanding the male propensity in KS.

Cryptic promoter activation occurs by at least two different mechanisms in the Arabidopsis genome.

In gene-trap screening of plant genomes, promoterless reporter constructs are often expressed without trapping of annotated gene promoters. The molecular basis of this phenomenon, which has been interpreted as the trapping of cryptic promoters, is poorly understood. Here, we found that cryptic promoter activation occurs by at least two different mechanisms using Arabidopsis gene-trap lines in which a firefly luciferase (LUC) open reading frame (ORF) without an apparent promoter sequence was expressed from intergenic regions: one mechanism is 'cryptic promoter capturing', in which the LUC ORF captured pre-existing promoter-like chromatin marked by H3K4me3 and H2A.Z, and the other is 'promoter de novo origination', in which the promoter chromatin was newly formed near the 5' end of the inserted LUC ORF. The latter finding raises a question as to how the inserted LUC ORF sequence is involved in this phenomenon. To examine this, we performed a model experiment with chimeric LUC genes in transgenic plants. Using Arabidopsis psaH1 promoter-LUC constructs, we found that the functional core promoter region, where transcription start sites (TSSs) occur, cannot simply be determined by the upstream nor core promoter sequences; rather, its positioning proximal to the inserted LUC ORF sequence was more critical. This result suggests that the insertion of the coding sequence alters the local distribution of TSSs in the plant genome. The possible impact of the two types of cryptic promoter activation mechanisms on plant genome evolution and endosymbiotic gene transfer is discussed.

Cytomegalovirus late transcription factor target sequence diversity orchestrates viral early to late transcription.

Beta- and gammaherpesviruses late transcription factors (LTFs) target viral promoters containing a TATT sequence to drive transcription after viral DNA replication has begun. Human cytomegalovirus (HCMV), a betaherpesvirus, uses the UL87 LTF to bind both TATT and host RNA polymerase II (Pol II), whereas the UL79 LTF has been suggested to drive productive elongation. Here we apply integrated functional genomics (dTag system, PRO-Seq, ChIP-Seq, and promoter function assays) to uncover the contribution of diversity in LTF target sequences in determining degree and scope to which LTFs drive viral transcription. We characterize the DNA sequence patterns in LTF-responsive and -unresponsive promoter populations, determine where and when Pol II initiates transcription, identify sites of LTF binding genome-wide, and quantify change in nascent transcripts from individual promoters in relation to core promoter sequences, LTF loss, stage of infection, and viral DNA replication. We find that HCMV UL79 and UL87 LTFs function concordantly to initiate transcription from over half of all active viral promoters in late infection, while not appreciably affecting host transcription. Both LTFs act on and bind to viral early-late and late kinetic-class promoters. Over one-third of these core promoters lack the TATT and instead have a TATAT, TGTT, or YRYT. The TATT and non-TATT motifs are part of a sequence block with a sequence code that correlates with promoter transcription level. LTF occupancy of a TATATA palindrome shared by back-to-back promoters is linked to bidirectional transcription. We conclude that diversity in LTF target sequences shapes the LTF-transformative program that drives the viral early-to-late transcription switch.

Novel S. cerevisiae Hybrid Synthetic Promoters Based on Foreign Core Promoter Sequences.

Promoters are fundamental components of synthetic gene circuits. They are DNA segments where transcription initiation takes place. New constitutive and regulated promoters are constantly engineered in order to meet the requirements for protein and RNA expression into different genetic networks. In this work, we constructed and optimized new synthetic constitutive promoters for the yeast Saccharomyces cerevisiae. We started from foreign (e.g., viral) core promoters as templates. They are, usually, unfunctional in yeast but can be activated by extending them with a short sequence, from the CYC1 promoter, containing various transcription start sites (TSSs). Transcription was modulated by mutating the TATA box composition and varying its distance from the TSS. We found that gene expression is maximized when the TATA box has the form TATAAAA or TATATAA and lies between 30 and 70 nucleotides upstream of the TSS. Core promoters were turned into stronger promoters via the addition of a short UAS. In particular, the 40 nt bipartite UAS from the GPD promoter can enhance protein synthesis considerably when placed 150 nt upstream of the TATA box. Overall, we extended the pool of S. cerevisiae promoters with 59 new samples, the strongest overcoming the native TEF2 promoter.

In Silco Study of MIR-124-1 Transcription Factors in Glioblastoma

MIR-124-1 is a brain-abundant MIRNA, whose expression is important for neuronal tissue division, growth and actions. However, expression of miR-124-1 regulatory mechanisms controlling its actions in neuronal cells in health and diseases still poorly addressed. To understand mechanism for transcriptional and functional regulation of miR-124 in neuronal and glioblastoma cells, this study combined gene expression profiling data and computational transcription factor and microRNA target predictions. The present research focuses on transcription factors and DNA methylation, which are central to miR-124-1 expression regulation. A core promoter sequence of miR-124-1 was predicted to be 500 bp and 100 bp, upstream and downstream of its transcription start sites. Seventy three binding sites of fifty transcription factors in promoter region were found, using MatInspector software. Among these transcription factors, MEIS1, POU3F2, SALL2, ETV1, and MAZ, are known to be brain-enriched transcriptional activators. By using omics data analysis, expression of MAZ, PLAG1 KLF2 as well as a transcriptional repressor ZNF239 showed significant correlation with decline in miR-124-1 expression in glioblastoma cells. Furthermore, a potential CpG island was reported in the promoter, providing another mechanism for transcriptional inhibition of miR-124. As miR-124-1 regulates a number of neuronal physiological and pathological processes, we made an attempt to define its potential targets. A computational prediction of miR-124-1 targets suggested 265 targets with two or more conserved seed sites. Pathway-based analysis of these target genes revealed a significant enrichment for axonal guidance and cancer signaling pathways. At least ten of these targets, SRGAP1, GNAI3, PLXNA3, SEMA5A, SEMA6A, CEBPA, CBL, RASSF5, MITF, and RPS6KB1, showed expected inverse correlation between their expression values and miR-124-1 suppression in glioblastoma cells. Taken together, our data form foundation of subsequent future validation researches for miR-124-1 expression regulation including transcription factors and CpG Island within its promoter as well as functional regulation comprising biological pathways controlled by its target genes.

PPARγ regulates fabp4 expression to increase DHA content in golden pompano (Trachinotus ovatus) hepatocytes.

N-3 long-chain (≥C20) PUFA (LC-PUFA) are vital fatty acids for fish and humans. As a main source of n-3 LC-PUFA for human consumers, the n-3 LC-PUFA content of farmed fish is important. Previously, we identified fatty acid-binding protein (fabp)-4 as a candidate gene for regulating the n-3 LC-PUFA content. Herein, we further assessed the role of fabp4 in this process. First, a 2059 bp promoter sequence of fabp4 in Trachinotus ovatus was cloned and, using progressive deletion, determined -2006 bp to -1521 bp to be the core promoter sequence. The PPAR-γ binding sites were predicted to occur in this region. A luciferase reporter assay showed that the promoter activity of fabp4 decreased following mutation of the PPARγ binding site and that PPARγ increased the fabp4 promoter activity in a dose-dependent manner, implying that T. ovatus fabp4 is a target of PPARγ. The overexpression of fabp4 or PPARγ increased the DHA content in hepatocytes, whereas suppression of their expression diminished this effect, suggesting that both fabp4 and PPARγ play an active role in regulating DHA content. Moreover, the inhibition of fabp4 attenuated the increase in PPARγ-mediated DHA content, and the overexpression of fabp4 alleviated this effect. Collectively, our findings indicated that fabp4, which is controlled by PPARγ, plays an important role in DHA content regulation. The new regulation axis can be considered a promising novel target for increasing the n-3 LC-PUFA content in T. ovatus.

Preliminary evidence for conserved transcriptional response to adversity in adults with temporomandibular disorder.

In the current study, we investigated whether individuals with TMD would exhibit differential activity of 3 specific transcription factors involved in inflammatory (nuclear factor-kappa B, NF-kB), antiviral (interferon-regulatory factors, IRF), and sympathetic (cAMP response element-binding protein, CREB) processes using a promoter-based bioinformatics analysis, which is characterized as the "Conserved Transcriptional Response to Adversity." Adults with TMD (n = 19) and without (n = 17) underwent a standardized clinical examination for TMD. A blood sample was collected for genome-wide transcriptional RNA profiling. Bioinformatic analyses tested for differential prevalence of proinflammatory and antiviral transcription factor activity in core promoter sequences from all genes showing >1.2-fold differential expression in TMD vs controls. Promoter-based bioinformatic analyses of genome-wide transcriptome profiles confirmed upregulation of genes bearing response elements for proinflammatory transcription factor (NF-kB, P = 0.002) and downregulation of genes with response elements for IRF (P = 0.037) in patients with TMD relative to controls. Results also indicated upregulated activity of CREB in patients with TMD (P = 0.08), consistent with increased activity of the sympathetic nervous system. These results provide initial support that the regulation of immune pathways is altered in individuals with TMD. A shift of transcriptional resources to a proinflammatory state may be driven by psychosocial stress and contributes to symptoms associated with TMD.

Using a Design of Experiments Approach to Inform the Design of Hybrid Synthetic Yeast Promoters.

Hybrid promoter engineering takes advantage of the modular nature of eukaryotic promoters by combining discrete promoter motifs to confer novel regulatory function. By combinatorially screeningsequence libraries for trans-acting transcriptional operators, activators, repressors and core promoter sequences, it is possible to derive constitutive or inducible promotercollections covering a broad range of expression strengths. However, combinatorial approaches to promoter design can result in highly complex, multidimensional design spaces, which can be experimentally costly to thoroughly explore in vivo. Here, we describe an in silico pipeline for the design of hybrid promoter libraries that employs a Design of Experiments (DoE) approach to reduce experimental burden and efficiently explore the promoter fitness landscape. We also describe a software pipeline to ensure that the designed promoter sequences are compatible with the YTK assembly standard.

Transcription imparts architecture, function and logic to enhancer units.

Distal enhancers play pivotal roles in development and disease yet remain one of the least understood regulatory elements. We used massively parallel reporter assays to perform functional comparisons of two leading enhancer models and find that gene-distal transcription start sites (TSSs) are robust predictors of active enhancers with higher resolution than histone modifications. We show active enhancer units are precisely delineated by active TSSs, validate that these boundaries are sufficient for capturing enhancer function, and confirm that core promoter sequences are necessary for this activity. We assay adjacent enhancers and find that their joint activity is often driven by the stronger unit within the cluster. Finally, we validate these results through functional dissection of a distal enhancer cluster using CRISPR-Cas9 deletions. In summary, definition of high-resolution enhancer boundaries enables deconvolution of complex regulatory loci into modular units.