Conidial Morphology Research Articles

Taxonomic revision of Pseudolachnea and Pseudolachnella and establishment of Neopseudolachnella and Pseudodinemasporium gen. nov.

The taxonomy of Pseudolachnea and Pseudolachnella is controversial. Some authors have regarded them as congeneric, whereas others have considered them to be distinct genera differentiated merely on the number of conidial septa. A total of 26 isolates of Pseudolachnea-like fungi were subjected to morphological examination and phylogenetic analyses of nuc rDNA internal transcribed spacers 1 and 2 and partial 28S sequences and partial sequence of the translation elongation factor 1α gene. The results indicated that our materials should be classified in four genera: Pseudolachnea, Pseudolachnella, and two new genera, Neopseudolachnella and Pseudodinemasporium. Although the monophyly of both Pseudolachnea and Pseudolachnella was confirmed, it was concluded that differences observed in the conidiomatal structure, such as thickness of basal stroma and the excipulum, were more reliable for their circumscription, instead of conidial septation. Neopseudolachnella was similar to Pseudolachnea and Pseudolachnella in conidial morphology but was characterized by the conidiomata lacking an excipulum, unlike members of the latter two genera. Pseudodinemasporium bore conidia morphologically similar to those of Dinemasporium but was differentiated from the latter by the conidiomata, which was composed of a well developed peridial structure. A total of 12 new species, namely three in Neopseudolachnella (N. acutispora, N. magnispora, N. uniseptata), one in Pseudodinemasporium (P. fabiforme) and eight in Pseudolachnella (P. asymmetrica, P. botulispora, P. brevicoronata, P. campylospora, P. complanata, P. falcatispora, P. fusiformis and P. pachyderma) are described and illustrated.

Fgk3 glycogen synthase kinase is important for development, pathogenesis, and stress responses in Fusarium graminearum.

Wheat scab caused by Fusarium graminearum is an important disease. In a previous study, the FGK3 glycogen synthase kinase gene orthologous to mammalian GSK3 was identified as an important virulence factor. Although GSK3 orthologs are well-conserved, none of them have been functionally characterized in fungal pathogens. In this study, we further characterized the roles of FGK3 gene. The Δfgk3 mutant had pleiotropic defects in growth rate, conidium morphology, germination, and perithecium formation. It was non-pathogenic in infection assays and blocked in DON production. Glycogen accumulation was increased in the Δfgk3 mutant, confirming the inhibitory role of Fgk3 on glycogen synthase. In FGK3-GFP transformants, GFP signals mainly localized to the cytoplasm in conidia but to the cytoplasm and nucleus in hyphae. Moreover, the expression level of FGK3 increased in response to cold, H2O2, and SDS stresses. In the Δfgk3 mutant, cold, heat, and salt stresses failed to induce the expression of the stress response-related genes FgGRE2, FgGPD1, FgCTT1, and FgMSN2. In the presence of 80 mM LiCl, a GSK3 kinase inhibitor, the wild type displayed similar defects to the Δfgk3 mutant. Overall, our results indicate that FGK3 is important for growth, conidiogenesis, DON production, pathogenicity, and stress responses in F. graminearum.

Studies on variability in Alternaria alternata (Kessler) causing leaf blight of Isabgol (Plantago ovata)

All the five isolates of Alternaria alternata isolated from different agro climate zone of Rajasthan were tested for their variability in terms of cultural, conidial, pathogenic characteristics and toxin production. All the five isolates differed in cultural characters i.e. dark black colored and very fast mycelial growth with smooth margins (90.00 mm), light black with white at centre and fast growing (80.00 mm), dark brown and medium mycelium growth with smooth margins (75.00 mm), black colored, medium flat mycelial growth with smooth margins (68.00 mm) and white with slightly black in colour with slow mycelial growth (65.00 mm) were observed in Aa-1, Aa-2, Aa-3, Aa-4 and Aa-5 respectively. The variability in conidial morphology of five different isolates was simple, septate, pale to dark brown in colour, often geniculate with one conidial scar. In respect of pathogenic variability, showed significant variations in terms of disease intensity and incubation periods. The isolates Aa-1 was highly pathogenic on Isabgol cv. RI-89 under artificial inoculation conditions showing 52.12% disease intensity followed by Aa- 3 ,Aa-2, Aa-4 and Aa-5 isolates. The variability in toxin production was reflected in terms of time taken in inducing wilting symptoms of Isabgol cuttings. Isolate Aa-1 was highly toxic followed by isolates Aa-2, Aa-3, Aa-4 and Aa-5. DOI: http://dx.doi.org/10.3329/sja.v12i2.21918 SAARC J. Agri., 12(2): 63-70 (2014)

First Report of Alternaria alternata Causing Leaf Spot on Bruguiera gymnorrhiza in China.

Bruguiera gymnorrhiza (L.) Savigny is an important mangrove tree species that grows in the intertidal regions of the tropical and subtropical coastlines. In a survey conducted in March 2014, a leaf spot disease on this plant was observed in Sea View Promenade in Zhanjiang, Guangdong Province, China. Symptoms on leaves initially appeared as small circular to irregular, dark brown, necrotic, sunken spots with an average diameter of 4 to 7 mm. The spots gradually enlarged in size, becoming irregular, or remained circular with concentric rings or zones. In the latter, the spots coalesced, and the leaves withered, dried, and fell from the plants. Leaf tissues (3 × 5 mm), cut from the margins of lesions, were surface-disinfected, placed on potato dextrose agar (PDA), and incubated at 28°C with a 12-h photoperiod. Five fungi (MLL1 to MLL5) with different morphological characteristics were obtained. To fulfill Koch's postulates, wounded and nonwounded leaves were inoculated. Fresh wounds were made with a sterile needle on 10 detached leaves and 10 leaves on five living plants for fungi MLL1 to MLL5 independently. Mycelial plugs of each fungus were applied to wounded and nonwounded leaves. For the control, 10 leaves on five living plants were inoculated with agar plugs in a similar manner, to both wounded and nonwounded leaves. All treatments were incubated in a humid chamber in the dark at 28°C. Leaf spots identical to those observed in the field were observed on the wounded leaves inoculated with fungus MLL3 after 3 to 4 days, while the other four fungi and the control remained symptomless. The 10 nonwounded leaves inoculated with fungus MLL3 were also infected after 5 days. The fungus, with the same colony and conidial morphology as MLL3, was re-isolated from the affected leaves. The pathogenic test was repeated three times under the same conditions. Hyphal tips of MLL3 were transferred to PDA for morphological observation. Colonies of white-to-dark-gray mycelia, black on the underside, formed on PDA. The colonies were further identified as Alternaria sp., based on the dark brown, obclavate to obpyriform catenulate conidia with longitudinal and transverse septa tapering to a prominent beak attached in chains on a simple and short conidiophore (3). Conidia varied from 22.5 × 40.26 to 3.95 × 5.79 μm and had three to eight transverse and zero to four longitudinal septa, with a beak length of 0 to 7.25 μm. For molecular identification, PCR was carried out using internal transcribed spacer (ITS) region primers ITS1/ITS4, partial sequences of the beta tubulin gene primers Bt1a-Bt1b (1), and A. alternata species-specific primers AAF2/AAR3 (2). The PCR products were subjected to direct sequencing. The resulting sequences were compared against the GenBank nucleotide database by using a BLAST alignment, which revealed that MLL3 had 99 to 100% identity with A. alternata for the ITS, Bt1a-Bt1b, and AAF2/AAR3 regions (GenBank Accession Nos. KF669893, GQ240308, and KJ716876, respectively). Sequences for MLL3 were deposited in GenBank under accession numbers KJ767515, KJ921779, and KJ921778. According to both morphological and sequence analyses, the pathogen of the leaf spot of B. gymnorrhiza was identified as A. alternata. To our knowledge, this is the first report of A. alternata on leaves of B. gymnorrhiza in China. This pathogen could cause serious foliar damage and threaten the survival, growth, and fitness of the local B. gymnorrhiza community.

Combined morphological and molecular approach for identification of Stemphylium vesicarium inoculum in pear orchards

Stemphylium vesicarium is the causal agent of brown spot of pear, an important disease reported in pear-growing areas of Europe. The pathogen is able to colonize pear leaf debris and dead tissues of herbaceous plants and produce abundant ascospores and conidia that are capable of infecting pear trees. Inoculum monitoring in pear orchards is mainly achieved through spore traps and species identification is based on conidial morphology, but the similarities on conidial traits among species of Stemphylium make correct identification difficult. In this work a total of thirty-seven Stemphylium isolates from pear orchards were characterized at the morphological, pathogenic, and molecular level. Correspondence among ITS and gpd sequences and morphological traits were evaluated. Species identification based exclusively on morphological data was not feasible. Combined morphological and molecular data were necessary for unambiguous identification of isolates in the S. vesicarium species group. Only isolates identified as S. vesicarium were pathogenic on pear. The study revealed that several species of Stemphylium coexist in pear orchards with S. vesicarium, the causal agent of BSP, and that combined morphological and molecular data are needed to differentiate them. Consequently, direct measurements of the airborne inoculum using volumetric spore traps may overestimate the actual pathogen population.

First Record of Dothistroma pini on Pinus nigra in Switzerland.

The mitosporic ascomycetes Dothistroma septosporum s.s. (Dorog.) Morelet and D. pini Hulbary are closely related species (1) causing red band needle blight on Pinus spp. D. septosporum (teleomorph Mycosphaerella pini Rostr.) is considered as a cosmopolitan species, whereas D. pini (no teleomorph known) seems to have a more restricted distribution area. Detected in the United States on Pinus nigra for the first time, it was later found in Russia, Ukraine, Hungary, and France on different pine species (P. radiata, P. mugo, P. pallasiana) (3). In Switzerland, Dothistroma sp. (species not further determined) was recorded in 1989 for the first time and since then only damages on planted pines (mainly P. mugo and P. nigra) in urban areas were reported (R. Engesser, personal communication). In September 2012 and in April 2013, several planted mature trees and naturally regenerated young trees of P. nigra with Dothistroma needle blight were detected on a climatically mild forest site on limestone at the shore of Lake Walensee (47°07'48.0″ N, 9°13'54.4″ E, 420 m asl). In 2012, symptomatic needles were collected from the litter under one planted mature P. nigra tree and in 2013, symptomatic needles were collected from green twigs from a 2 m tall naturally regenerated P. nigra specimen. Conidiomata were frequently observed in the red bands but no conidia were detected. For fungal isolation, the surface of infected needles was shortly disinfected with 95% ethanol. The epi- and hypo-dermis covering the still closed conidiomata was removed and small tissue samples from the mesophyll (less than 0.5 mm length) were placed on malt extract agar (15 g/liter agar, 20 g/liter malt extract) amended by 50 mg/liter oxytetracycline. Conidia were observed after one year at 4°C in the resulting pure colonies (3 to 4 cm diameter on malt extract agar medium). The conidia formed by strain OH_120923_2_1_1 (KJ878557 = D. pini) were hyaline, smooth, thin-walled, 2- to 4-celled, and 31.6 (22 to 37) × 2.8 (2 to 3.5) μm. While conidial morphology of both Dothistroma species overlap, DNA was extracted and the internal transcribed spacer (ITS) region (primers ITS 1 and ITS 4) sequenced (KJ878557 to 81). From the 25 obtained ITS sequences, seven were identical with AY808275 (D. septosporum from P. radiata, South Africa, CMW 684), three were identical with AY808302 (D. pini from P. nigra, Michigan, CMW 10951), and 15 were identical with DQ926964 (D. pini from P. pallasiana, Ukraine, CMW 23767). The North American and Ukrainian D. pini sequences (AY808302 and DQ926964) showed only 1 bp difference. In addition, mating type genes were amplified using the method described by Groenewald et al. (2) for D. pini and scored using gel electrophoresis. Analyses showed that both D. pini ITS-sequence variants (e.g., KJ878557 and KJ878558) and both mating types were sometimes present in the same needle. In two cases, both mating types and ITS-sequence variants were also present within the same lesion. Interestingly, D. pini and D. septosporum were found on the same tree but not on the same needles. This is the first report of D. pini in Switzerland. Although symptoms of red band needle blight (species not determined) were repeatedly observed on this site during the last 20 years, the disease level always remained low and no tree mortality was noted. However, due to the presence of two ITS-sequence variants and both mating types, the incidence of D. pini in Switzerland deserves attention.

FIRST REPORT OF LASIODIPLODIA THEOBROMAE CAUSING CANKER AND COLLAR ROT DISEASES OF PHYSIC NUT (JATROPHA CURCAS ) IN EGYPT

In February 2012, several plants of physic nut (Jatropha curcas) growing in Assiut Governorate (Egypt) showed shedding of the leaves, blackening and decaying of the collar region of the stem and necrotic lesions on branches. A fungus was consistently isolated on potato dextrose agar (PDA) from symptomatic branches. Single-spore fungal cultures produced white, aerial mycelium that became dull gray after a week in culture. The mycelium was fast spreading, branched and septate. Pycnidia from 30-day-old pure cultures produced dark brown, oval conidia that were two celled, thin walled, and oval with longitudinal striations. The average size of the conidia was 23.64×12.73 μm with a length/width ratio of 1.86. Conidia were initially unicellular, hyaline, thick-walled with granular content. Based on conidial morphology, the fungus was identified as Lasiodiplodia theobromae. To confirm the identity of the mycete the internal transcribed spacer (ITS) region was amplified with ITS1/ITS4 primers and sequenced. Sequences of the isolates were 99% identical to two L. theobromae accession from GenBank (HM008598 and HM999905). Five 1-year-old healthy plants of J. curcas were inoculated inserting a 10-mm PDA plug of mycelium into the wound and wrapping the inoculation site with wetted cotton wool and Parafilm. Ten non-inoculated plants served as control. After 6 days, all inoculated plants produced the same symptoms. while controls remained symptomless. The pathogen was reisolated from inoculated branches, fulfilling Koch's postulates. L. theobromae has been reported to cause cankers and dieback in Malaysia (Sulaiman and Thanarajoo, 2012) and India (Latha et al., 2009). To our knowledge, this is the first report of stem canker associated with L. theobromae of physic nut in Egypt.

High incidence of preharvest colonization of huanglongbing-symptomatic citrus sinensis fruit by Lasiodiplodia theobromae (Diplodia natalensis) and exacerbation of postharvest fruit decay by that fungus.

Huanglongbing (HLB), presumably caused by the bacterium "Candidatus Liberibacter asiaticus," is a devastating citrus disease associated with excessive preharvest fruit drop. Lasiodiplodia theobromae (diplodia) is the causal organism of citrus stem end rot (SER). The pathogen infects citrus fruit under the calyx abscission zone (AZ-C) and is associated with cell wall hydrolytic enzymes similar to plant enzymes involved in abscission. By means of DNA sequencing, diplodia was found in "Ca. Liberibacter asiaticus"-positive juice from HLB-symptomatic fruit (S) but not in "Ca. Liberibacter asiaticus"-negative juice. Therefore, the incidence of diplodia in fruit tissues, the impact on HLB-related postharvest decay, and the implications for HLB-related preharvest fruit drop were investigated in Hamlin and Valencia oranges. Quantitative PCR results (qPCR) revealed a significantly (P < 0.001) greater incidence of diplodia in the AZ-C of HLB-symptomatic (S; "Ca. Liberibacter asiaticus" threshold cycle [CT] of <30) than in the AZ-C of in asymptomatic (AS; "Ca. Liberibacter asiaticus" CT of ≥30) fruit. In agreement with the qPCR results, 2 weeks after exposure to ethylene, the incidences of SER in S fruit were 66.7% (Hamlin) and 58.7% (Valencia), whereas for AS fruit the decay rates were 6.7% (Hamlin) and 5.3% (Valencia). Diplodia colonization of S fruit AZ-C was observed by scanning electron microscopy and confirmed by PCR test and morphology of conidia in isolates from the AZ-C after surface sterilization. Diplodia CT values were negatively correlated with ethylene production (R = -0.838 for Hamlin; R = -0.858 for Valencia) in S fruit, and positively correlated with fruit detachment force (R = 0.855 for Hamlin; R = 0.850 for Valencia), suggesting that diplodia colonization in AZ-C may exacerbate HLB-associated preharvest fruit drop.

Threonine deaminase MoIlv1 is important for conidiogenesis and pathogenesis in the rice blast fungus Magnaporthe oryzae

Threonine deaminase is the first critical enzyme in the biosynthesis of branched-chain amino acids (BCAAs), which catalyzes threonine into NH2 and ketobutyrate acid. Previously, we identified and characterized two acetolactate synthases MoIlv2 and MoIlv6 that are involved in the second step of BCAA biosynthesis. Deletion of MoILV2 and MoILV6 resulted in auxotrophy for leucine, isoleucine, and valine and defects in conidiation, appressorial penetration, and pathogenicity. Here, we identified a threonine dehydratase, named MoIlv1, from Magnaporthe oryzae. MoIlv1 is a homolog of Saccharomyces cerevisiae Ilv1p, which has an important role in the biosynthesis of isoleucine. To characterize the function of MoIlv1, a ΔMoilv1 knock-out mutant was generated and analyzed. Disruption of MoILV1 resulted in abnormal conidial morphology, reduced conidiation, limited appressorium-mediated penetration, and attenuated virulence on both barley and rice seedlings. Further analysis by domain-specific deletion revealed that the PALP domain is indispensable for MoIlv1 function. Our study indicates that MoIlv1 is a protein involved in isoleucine biosynthesis that underlies the complex process governing morphogenesis, appressorium formation, invasive hyphae growth, and pathogenicity.

First Report of Resistance to QoI Fungicides in Alternaria alternata Isolates from Potato in South Africa.

Since the first report of brown spot of potatoes (Solanum tuberosum) caused by Alternaria alternata (Fr.) Keissl in South Africa (3), disease intensity has steadily increased. No fungicides are registered for control of brown spot of potatoes in South Africa but growers attempt to control the disease with products registered for early blight, which include various QoI fungicides. Failure to control brown spot with QoI fungicides led to an investigation on putative development of resistance among A. alternata populations. In the summer of 2012, diseased leaves were collected from five potato growing regions. Isolations were made from the margin of brown spot lesions by plating surface disinfested tissue on V8 agar medium (200 ml V8 juice, 3 g CaCO3, 20 g agar). Plates were incubated at 25°C in darkness for 7 days, purified, and single-spore cultures transferred to fresh potato dextrose agar (PDA) plates. Identity of isolates was confirmed using conidial morphology and PCR amplification using species-specific primers AAF2 and AAR3 (1). Eight A. alternata isolates (PPRI 13607, 13608, 13609, 13610, 13611, 13612, 13613, and 13614) were obtained and screened for sensitivity to azoxystrobin in vitro by evaluating relative conidial germination on media amended with 0, 1.0, 2.5, 5.0, 10, 25, 50, 75, 85, and 100 μg of azoxystrobin per ml of media. The dose effect of the fungicide on germination and the EC50 of each isolate were computed using the probit analysis. Isolates were subjected to DNA extraction and the partial cytochrome b (cyt b) was amplified using primer pair CBF1 and CBR2 (2). PCR products were transformed into DH5α competent cells using a pGEM-T Easy vector. Both strands of the cloned fragments were sequenced using primers T7 and SP6 (4). Isolates PPRI 13611 and 13614 had low EC50 values of 0.11 and 0.23 μg/ml, respectively, and a mean EC50 of 0.17 μg/ml, showing their relative sensitivity to azoxystrobin. The other six isolates had EC50 values ranging from 51.88 to 114.92 μg/ml, and a mean EC50 of 71.60 μg/ml, showing their resistance to azoxystrobin. Sequence analysis of the partial cyt b gene showed strong association of resistance in isolates PPRI 13607, 13608, 13609, 13610, 13612, and 13613 to a base substitution resulting in an amino acid substitution at position 143 (G143A). Isolates PPRI 13611 and 13614 did not exhibit this mutation. Although resistance has been reported on other crops where QoI fungicides, including azoxystrobin, have been used to control different pathogens, this is the first report of resistance to a QoI fungicide in field isolates of A. alternata from potatoes in South Africa. Identification of resistance will help to explain failure to control this disease using QoI fungicides. Further monitoring of resistance to azoxystrobin and other QoI fungicides is warranted.

First Report of Brown Culm Streak of Phyllostachys praecox Caused by Arthrinium arundinis in Nanjing, China.

Early spring shoot bamboo (Phyllostachys praecox) is profitable for the production of bamboo shoots and is widely cultivated in Jiangsu and Zhejiang provinces in China. In recent years, a new disease named brown culm streak has commonly occurred in bamboo plantations. During initial stages, small yellow or sandy beige spots (1 to 2 mm diameter) develop on the culm. Spots expand and develop into fine brown streaks (10 to 15 × 1 to 2 mm), and the quantity of spots increases greatly at the mid-stage of the disease. The streaks continue to expand (10 to 30 × 2 to 3 mm) and may coalesce into brown patches that cover 70% of the culm surface in late stages of disease. Color of the internal bamboo cavity gradually changes from white to brown without an alcoholic odor, and plants eventually die. Diseased tissues (1 × 1.5 cm) were taken from the edges of brown streaks, surface disinfected in 0.1% HgCl2 for 3 min, rinsed in distilled water three times, and incubated on potato dextrose agar (PDA) at 25°C. Based on colony and conidial morphology, six different fungi (ZBY01, ZBY02, ZBY03, ZBY04, ZBY05, and ZBY06) were isolated. A suspension of hyphal fragments (106 pieces/ml) of each of the fungi was used to inoculate plants in the field. Healthy bamboo culms were stabbed with alcohol-sterilized needles after surface disinfection and wounds of each bamboo were inoculated with 3 ml hypha fragment suspensions by paintbrush, then covered with a piece of sterile plastic film. A control treatment was inoculated with sterile water. Each treatment had two replicates. Twenty days after inoculation, only fungus ZBY01 caused similar symptoms with the diseased bamboo in the field and was re-isolated from necrotic tissue of inoculated plants, thus fulfilling Koch's postulates. Mycelium of fungus ZBY01 covered entire PDA plates (90 mm diameter) after incubating for 6 days at 25°C and was white, flat, and floccose with moderate aerial mycelium. Mycelium consisted of smooth, hyaline, branched, septate hyphae, 2 to 3 μm diameter. Conidiophores were erect, septate, pale brown, smooth, and reduced to conidiogenous cells. Conidiogenous cells were pale brown, smooth, ampulliform, 6 to 9 μm long; the apical neck was 1 to 3 μm long, basal part 5 to 6 μm long. Conidia were 1-celled, dark brown to black, smooth, lenticular, 5 to 7 μm in diameter, 2 to 4 μm wide, lemon-shaped in side view, and spherical from top view with an equatorial ring. Based on morphological characteristics, it was identified as Arthrinium arundinis (Corda) Dyko & B. Sutton (1). The internal transcribed spacer (ITS) region from the isolate ZBY01 was amplified with PCR using ITS1-ITS4 primer pairs and the amplicon sequenced. Size of the sequenced region was 540 bp and had 99% identity with A. arundinis, which was in accord with morphological identification. The sequence was deposited in Gen Bank under accession number KF850624. To our knowledge, brown culm streak of P. praecox is a new disease of bamboo that has not been reported in other countries; however, A. arundinis has been reported as a pathogen on barley in Fairfield, Montana. Reference: (1) P. W. Crous and J. Z. Groenewald. A phylogenetic re-evaluation of Arthrinium. IMA Fungus. 4:133, 2013.

Resolving the polyphyletic nature of Pyricularia (Pyriculariaceae)

Species of Pyricularia (magnaporthe-like sexual morphs) are responsible for major diseases on grasses. Pyricularia oryzae (sexual morph Magnaporthe oryzae) is responsible for the major disease of rice called rice blast disease, and foliar diseases of wheat and millet, while Pyricularia grisea (sexual morph Magnaporthe grisea) is responsible for foliar diseases of Digitaria. Magnaporthe salvinii, M. poae and M. rhizophila produce asexual spores that differ from those of Pyricularia sensu stricto that has pyriform, 2-septate conidia produced on conidiophores with sympodial proliferation. Magnaporthe salvinii was recently allocated to Nakataea, while M. poae and M. rhizophila were placed in Magnaporthiopsis. To clarify the taxonomic relationships among species that are magnaporthe- or pyricularia-like in morphology, we analysed phylogenetic relationships among isolates representing a wide range of host plants by using partial DNA sequences of multiple genes such as LSU, ITS, RPB1, actin and calmodulin. Species of Pyricularia s. str. belong to a monophyletic clade that includes all P. oryzae/P. grisea isolates tested, defining the Pyriculariaceae, which is sister to the Ophioceraceae, representing two novel families. These clades are clearly distinct from species belonging to the Gaeumannomyces pro parte/Magnaporthiopsis/Nakataea generic complex that are monophyletic and define the Magnaporthaceae. A few magnaporthe- and pyricularia-like species are unrelated to Magnaporthaceae and Pyriculariaceae. Pyricularia oryzae/P. grisea isolates cluster into two related clades. Host plants such as Eleusine, Oryza, Setaria or Triticum were exclusively infected by isolates from P. oryzae, while some host plant such as Cenchrus, Echinochloa, Lolium, Pennisetum or Zingiber were infected by different Pyricularia species. This demonstrates that host range cannot be used as taxonomic criterion without extensive pathotyping. Our results also show that the typical pyriform, 2-septate conidium morphology of P. grisea/P. oryzae is restricted to Pyricularia and Neopyricularia, while most other genera have obclavate to more ellipsoid 2-septate conidia. Some related genera (Deightoniella, Macgarvieomyces) have evolved 1-septate conidia. Therefore, conidium morphology cannot be used as taxonomic criterion at generic level without phylogenetic data. We also identified 10 novel genera, and seven novel species. A re-evaluation of generic and species concepts within Pyriculariaceae is presented, and novelties are proposed based on morphological and phylogenetic data.

The Sch9 kinase regulates conidium size, stress responses, and pathogenesis in Fusarium graminearum.

Fusarium head blight caused by Fusarium graminearum is an important disease of wheat and barley worldwide. In a previous study on functional characterization of the F. graminearum kinome, one protein kinase gene important for virulence is orthologous to SCH9 that is functionally related to the cAMP-PKA and TOR pathways in the budding yeast. In this study, we further characterized the functions of FgSCH9 in F. graminearum and its ortholog in Magnaporthe oryzae. The ΔFgsch9 mutant was slightly reduced in growth rate but significantly reduced in conidiation, DON production, and virulence on wheat heads and corn silks. It had increased tolerance to elevated temperatures but became hypersensitive to oxidative, hyperosmotic, cell wall, and membrane stresses. The ΔFgsch9 deletion also had conidium morphology defects and produced smaller conidia. These results suggest that FgSCH9 is important for stress responses, DON production, conidiogenesis, and pathogenesis in F. graminearum. In the rice blast fungus Magnaporthe oryzae, the ΔMosch9 mutant also was defective in conidiogenesis and pathogenesis. Interestingly, it also produced smaller conidia and appressoria. Taken together, our data indicate that the SCH9 kinase gene may have a conserved role in regulating conidium size and plant infection in phytopathogenic ascomycetes.

Histidine kinases mediate differentiation, stress response, and pathogenicity in Magnaporthe oryzae.

The aim of this study is a functional characterization of 10 putative histidine kinases (HIKs)-encoding genes in the phytopathogenic fungus Magnaporthe oryzae. Two HIKs were found to be required for pathogenicity in the fungus. It was found that the mutant strains ΔMohik5 and ΔMohik8 show abnormal conidial morphology and furthermore ΔMohik5 is unable to form appressoria. Both HIKs MoHik5p and MoHik8p appear to be essential for pathogenicity since the mutants fail to infect rice plants. MoSln1p and MoHik1p were previously reported to be components of the HOG pathway in M. oryzae. The ΔMosln1 mutant is more susceptible to salt stress compared to ΔMohik1, whereas ΔMohik1 appears to be stronger affected by osmotic or sugar stress. In contrast to yeast, the HOG signaling cascade in phytopathogenic fungi apparently comprises more elements. Furthermore, vegetative growth of the mutants ΔMohik5 and ΔMohik9 was found to be sensitive to hypoxia-inducing NaNO2-treatment. Additionally, it was monitored that NaNO2-treatment resulted in MoHog1p phosphorylation. As a consequence we assume a first simplified model for hypoxia signaling in M. oryzae including the HOG pathway and the HIKs MoHik5p and MoHik9p.

First Report of Alternaria heveae Causing Black Leaf Spot of Rubber Tree in China.

Rubber tree (Hevea brasiliensis Muell. Arg.) is an important industrial crop of tropical areas for natural rubber production. In October 2013, foliar spots (0.1 to 0.4 mm in diameter), black surrounded by a yellow halo, and with lesions slightly sunken were observed on the rubber tree leaf in a growing area in Heikou County of Yunnan Province. Lesion tissues removed from the border between symptomatic and healthy tissue were surface sterilized in 75% ethanol and air-dried, plated on PDA plates, and incubated at 28°C with alternating day/night cycles of light. The pathogen was observed growing out of many of the leaf pieces, and produced abundant conidia. Colonies 6.1 cm in diameter developed on potato carrot agar (PCA) after 7 days, with well-defined concentric rings of growth. Colonies on PCA were composed of fine, dark, radiating, surface and subsurface hyphae. Conidia produced in PCA culture were mostly solitary or in short chains of 2 to 5 spores, long ovoid to clavate, and light brown, 40 to 81.25 × 8 to 20 μm (200 colonies were measured), with 3 to 6 transverse septa and 0 to 2 longitudinal or oblique septa. Morphological characteristics were similar to those described for Alternaria heveae (3,4). A disease of rubber tree caused by Alternaria sp. had been reported in Mexico in 1947 (2). DNA of Ah01HK13 isolate was extracted for PCR and sequencing of the ITS region with ITS1 and ITS4 primers was completed. From the BLAST analysis, the sequence of Ah01HK13 (GenBank Accession No. KF953884), had 97% similarity to A. dauci, 96% identical to A. macrospora (AY154701.1 and DQ156342.1, respectively), indicating the pathogen belonged to Alternaria genus. According to morphological characteristics, this pathogen was identified as A. heveae. Pathogenicity of representative isolate, Ah01HK13 was confirmed using a field rubber tree inoculation method. Three rubber plants (the clone of rubber tree Yunyan77-4) were grown to the copper-colored leaf stage and inoculated by spraying spore suspension (concentration = 104 conidia/ml) to the copper-colored leaves until drops were equally distributed on it using manual pressure sprayer. Three rubber plants sprayed with sterile distilled water were used as controls. After inoculation, the plants were covered with plastic bags. The plastic bags were removed after 2 days post-inoculation (dpi) and monitored daily for symptom development (1). The experiment was repeated three times. The typical 0.1 to 0.4 mm black leaf spots were observed 7 dpi. No symptoms were observed on control plants. A fungus with the same colony and conidial morphology as A. heveae were re-isolated from leaf lesions on inoculated rubber plants, but not from asymptomatic leaves of control plants, fulfilling Koch's postulates. Based on these results, the disease was identified as black spot of rubber tree caused by A. heveae. To our knowledge, this is the first report of A. heveae on rubber tree in China.

First Report of Leaf Blotch Caused by Pestalotiopsis clavispora on Rosa chinensis in China.

Rosa chinensis Jacq, a traditional Chinese ornamental flower, is an important landscaping plant in northern China. Since July 2013, leaf blotch symptoms were observed in the Tianjin flower nursery (117°09' E 39°17' N). The garden exhibited 40% disease incidence with observable symptoms on basal leaves that were yellowed from the edge to the inside area on infected leaves, in the shape of a V. Yellow lesions covered one third to one half of the leaf. Yellow halos were observed at the junction of the healthy and diseased tissues. Small tissue pieces from the edges of lesions were disinfected in 70% ethyl alcohol for 30 s and 1% hypochlorite for 1 min, rinsed thrice in sterile water, plated on potato dextrose agar (PDA), and incubated at 25°C in lighted incubator for 4 days. Fungal colonies that developed on PDA were white and cottony with concentric rings. Black and globular acervuli appeared after 10 days at 25°C. Conidia (n = 20), which were fusiform, were 9.20 to 31.31 (avg. 26.5) × 4.83 to 9.11 (avg. 6.9) μm. Conidia of all isolates were five celled. Apical and basal cells were colorless, while the three median cells were dark brown. The single basal appendage of conidia was 2.85 to 16.05 μm in length and the two to three apical appendages were 5.93 to 36.23 μm in length. According to colony and conidia morphology (number of cells, number of appendages), the isolates were initially identified as Pestalotiopsis spp (2). A 525-bp band was produced in a conventional PCR assay. Primers ITS1 (5'TCCGTAGGTGAACCTGCGC3') and ITS4 (5'TCCTCCGCTTATTGATATGC3') were used to amplify and sequence the internal transcribed spacer region of rDNA. A BLAST search of the NCBI databases showed that isolate YJYK-1 had 99% homology with Pestalotiopsis clavispora isolate hz-067 (Accession No. FJ517545.1). Pathogenicity tests of the novel isolate YJYK-1 were conducted by placing agar plugs (5 mm in diameter) from an actively growing colony on PDA on surface-disinfected (70% ethyl alcohol, 30 s) leaves (1). Control leaves were inoculated with sterile PDA plugs. Plants with inoculated leaves (five per treatment) were placed in lighted growth chambers at 25°C for 10 days and watered as needed. Symptoms on inoculated leaves were similar to those previously described in the nursery. Black acervuli were easily found on the necrotic tissues. Control plants did not show any symptoms. Cultures isolated from the lesions were similar to those isolated previously from leaves in the nursery. Koch's postulates were confirmed after re-isolation. Although the diversity of endophytic Pestalotiopsis species and its distribution was investigated and the host plants were also listed in China (3), to our knowledge, this is the first report of P. clavispora causing leaf blotch on rose R. chinensis in China.

First Report of Fusarium proliferatum Causing Dry Rot in Michigan Commercial Potato (Solanum tuberosum) Production

Fusarium dry rot of potato (Solanum tuberosum L.) is a postharvest disease caused by several Fusarium spp. Thirteen Fusarium spp. have been implicated in dry rot of potatoes worldwide. Among them, 11 species have been reported causing potato dry rot of seed tubers in the northern United States (1). Historically, Fusarium sambucinum was the predominant species in Michigan potato production (3). Dry rot symptomatic tubers (n = 972) were collected from Michigan commercial potato storage facilities in 2011 and 2012 to determine the composition of Fusarium spp. Sections were cut from the margins of necrotic tissue with a sterile scalpel and surface disinfested in 0.6% sodium hypochlorite for 10 s, rinsed twice in sterile distilled water, and dried on sterile filter paper. The tissue sections were plated on half-strength potato dextrose agar (PDA) amended with 0.5 g/liter of streptomycin sulfate. Dishes were incubated at 23°C in the dark for 7 days. Putative Fusarium isolates were transferred onto water agar and hyphal tips from the margin of actively growing cultures were removed with a sterile scalpel and plated to carnation leaf agar (CLA) and half-strength PDA to generate pure cultures. Seven hundred and thirty Fusarium isolates were collected using these techniques. Preliminary identification of the 730 isolates was based on colony and conidial morphology on PDA and CLA, respectively. While F. oxysporum and F. sambucinum were isolated as expected from prior reports (3), three isolates of F. proliferatum were also identified. On CLA, macroconidia of F. proliferatum were sparse, slender, and mostly straight, with three to five septae (4). Microconidia were abundant, usually single celled, oval or club-shaped in short chains or false heads on monophialides and polyphialides (4), and chlamydospores were absent. On PDA, abundant white mycelium was produced and turned violet with age. Koch's postulates were confirmed through pathogenicity testing on disease-free potato tubers cvs. Atlantic and Russet Norkotah. Tubers were surface disinfested for 10 min in 0.6% sodium hypochlorite and rinsed twice in distilled water. Three tubers of each cultivar per isolate were wounded at the apical end of the tuber to a depth of 4 to 10 mm with a 4 mm diameter cork-borer. Tubers were inoculated by inserting a mycelial plug from a 7-day-old culture grown on PDA into the wound and incubating the tubers at 20°C for 21 days. All Fusarium isolates were tested. Control tubers were inoculated by inserting a water agar plug. Pathogenicity and virulence testing were replicated three times and repeated. Tubers inoculated with F. proliferatum developed typical potato dry rot symptoms but no dry rot symptoms were observed on control tubers. Fusarium proliferatum was re-isolated from symptomatic tubers, confirming Koch's postulates. To our knowledge, this is the first report of F. proliferatum causing potato dry rot in Michigan.

The cAMP-PKA Pathway Regulates Growth, Sexual and Asexual Differentiation, and Pathogenesis in Fusarium graminearum

Like many other filamentous ascomycetes, Fusarium graminearum contains two genes named CPK1 and CPK2 that encode the catalytic subunits of cyclic AMP (cAMP)-dependent protein kinase A (PKA). To determine the role of cAMP signaling in pathogenesis and development in F. graminearum, we functionally characterized these two genes. In addition, we generated and characterized the cpk1 cpk2 double and fac1 adenylate cyclase gene deletion mutants. The cpk1 mutant was significantly reduced in vegetative growth, conidiation, and deoxynivalenol production but it had increased tolerance to elevated temperatures. It was defective in the production of penetration branches on plant surfaces, colonization of wheat rachises, and spreading in flowering wheat heads. Deletion of CPK1 had no effect on perithecium development but the cpk1 mutant was defective in ascospore maturation and releasing. In contrast, the cpk2 mutant had no detectable phenotypes, suggesting that CPK2 contributes minimally to PKA activities in F. graminearum. Nevertheless, the cpk1 cpk2 double mutant had more severe defects in vegetative growth and rarely produced morphologically abnormal conidia. The double mutant, unlike the cpk1 or cpk2 mutant, was nonpathogenic and failed to form perithecia on self-mating plates. Therefore, CPK1 and CPK2 must have overlapping functions in vegetative growth, differentiation, and plant infection in F. graminearum. The fac1 mutant was also nonpathogenic and had growth defects similar to those of the cpk1 cpk2 mutant. However, deletion of FAC1 had no effect on conidium morphology. These results indicated that CPK1 is the major PKA catalytic subunit gene and that the cAMP-PKA pathway plays critical roles in hyphal growth, conidiation, ascosporogenesis, and plant infection in F. graminearum.

A spindle pole antigen gene MoSPA2 is important for polar cell growth of vegetative hyphae and conidia, but is dispensable for pathogenicity in Magnaporthe oryzae.

Spa2 is an important component of the multiprotein complex polarisome, which is involved in the establishment, maintenance, termination of polarized cell growth and is important for defining tip growth of filamentous fungi. In this study, we isolated an insertional mutant of the rice blast fungus Magnaporthe oryzae that formed smaller colony and conidia compared with the wild type. In the mutant, a spindle pole antigen gene MoSPA2 was disrupted by the integration of an exogenous plasmid. Targeted gene deletion and complementation assays demonstrated the gene disruption was responsible for the defects of the insertional mutant. Interestingly, the MoSpa2-GFP fusion protein was found to accumulate as a spot at hyphal tips, septa of hyphae and conidial tip cells where germ tubes are usually produced, but not in appressoria, infection hyphae or at the septa of conidia. Furthermore, the deletion mutants of MoSPA2 exhibited slower hyphal tip growth, more hyphal branches, and smaller size of conidial tip cells. However, MoSPA2 is not required for plant infection. These results indicate that MoSPA2 is required for vegetative hyphal growth and maintaining conidium morphology and that spotted accumulation of MoSpa2 is important for its functions during cell polar growth.

Incidence of Gremmeniella abietina in planted seedlings of Picea abies and Pinus sylvestris in northern Finland

SummaryThe ascomycete Gremmeniella abietina causes a disease (scleroderris canker) on conifers. The pathogen kills terminal shoots and branches of Pinus sylvestris and Picea abies, sporulates on host shoots and causes leader changes (i.e. dieback). Damage caused by G. abietina was investigated in young P. abies and P. sylvestris plantations in northern Finland. Side branches from seedlings of both species and the main stems of P. sylvestris were collected from three sites in two locations (Poksa 1 and 2, Kivalo) in northern Finland. The number of cankers and leader changes was counted in branches of each age (i.e. year) in a total of ca. 6300 shoots of P. abies and 1200 shoots of P. sylvestris. Cankers were common on both P. abies and P. sylvestris in Poksa 1 (2002–2008) and on P. abies in Poksa 2 (1998–2001). In Kivalo, cankers occurred only sporadically on P. sylvestris. Leader changes were most frequent in 1999–2009 in Poksa 1, in 2001–2009 in Poksa 2 and in 2003 in Kivalo. Cankers and other symptoms of infection were more obscure on P. abies than on P. sylvestris. According to both conidial morphology and molecular analysis, the strain of G. abietina infecting both P. abies and P. sylvestris was small‐tree type (STT). This is the first report of G. abietina, STT or B type, injuring P. abies in plantations.