Clinical Multiple Endocrine Neoplasia Type 1 Research Articles

Screening and surveillance practices for Multiple Endocrine Neoplasia type 1-related Neuroendocrine Tumours in European Neuroendocrine Tumor Society Centers of Excellence (ENETS CoE)-An ENETS MEN1 task force questionnaire study.

Multiple Endocrine Neoplasia type 1 (MEN1) Clinical Practice Guidelines (2012) are predominantly based on expert opinion due to limited available evidence at the time, leaving room for interpretation and variation in practices. Evidence on the natural course of MEN1-related neuroendocrine tumours (NET) and the value of screening programs has increased and new imaging techniques have emerged. The aim of this study is to provide insight in the current practices of screening and surveillance for MEN1-related NETs in ENETS Centers of Excellence (CoEs). A clinical practice questionnaire was distributed among all 65 ENETS CoEs. Response rate was 91% (59/65). In 14% of CoEs <10 patients, in 50% 10-49, in 31% 50-100 and in 3 centres (5%) >100 patients with MEN1 are seen. Practices with regard to screening and surveillance of NETs were markedly heterogeneous. Differences between countries were noted in the use of gut hormones for biochemical screening and the choice for imaging modality for screening/surveillance of pancreatic NETs (PanNETs). Magnetic resonance imaging (MRI) is the preferred modality for screening and surveillance of PanNETs, whereas this is computed tomography (CT) for thoracic NETs. Practices regarding screening for thoracic NETs were more homogeneous among larger volume CoEs, with longer screening intervals. The majority of CoEs tailored the surveillance of small pancreatic and lung NETs to observed growth rate. 68% of CoEs advise patients with clinical MEN1 with negative genetic testing to undergo periodic screening like mutation-positive patients. In conclusion, there is still marked heterogeneity in practice, although there are also common trends. Differences were sometimes associated with volume or country, but often no association was found. This underscores the need for clear and evidence-based practice recommendations.

Whole-Exome Screening and Analysis of Signaling Pathways in Multiple Endocrine Neoplasia Type 1 Patients with Different Outcomes: Insights into Cellular Mechanisms and Possible Functional Implications.

Multiple endocrine neoplasia type 1 (MEN1) is a syndrome characterized by tumors in multiple organs. Although being a dominantly inherited monogenic disease, disease phenotypes are unpredictable and differ even among members of the same family. There is growing evidence for the role of modifier genes in the alteration of the course of this disease. However, genome-wide screening data are still lacking. In our study, we addressed the different outcomes of the disease, focusing on pituitary and adrenocortical tumors. By means of exome sequencing we identified the affected signaling pathways that segregated with those symptoms. Most significantly, we identified damaging alterations in numerous structural genes responsible for cell adhesion and migration. Additionally, in the case of pituitary tumors, genes related to neuronal function, survival, and morphogenesis were repeatedly identified, while in patients with adrenocortical tumors, TLR10, which is involved in the regulation of the innate immunity, was commonly modified. Our data show that using exome screening, it is possible to find signatures which correlate with the given clinical MEN1 outcomes, providing evidence that studies addressing modifier effects in MEN1 are reasonable.

Dutch founder SDHB exon 3 deletion in patients with pheochromocytoma-paraganglioma in South Africa.

ObjectiveScreening studies have established genetic risk profiles for diseases such as multiple endocrine neoplasia type 1 (MEN1) and pheochromocytoma–paraganglioma (PPGL). Founder effects play an important role in the regional/national epidemiology of endocrine cancers, particularly PPGL. Founder effects in the Netherlands have been described for various diseases, some of which established themselves in South Africa due to Dutch emigration. The role of Dutch founder effects in South Africa has not been explored in PPGL.DesignWe performed a single-center study in South Africa of the germline genetic causes of isolated/syndromic neuroendocrine tumors.MethodsNext-generation panel, Sanger sequencing and multiplex ligand-dependent probe amplification for endocrine neoplasia risk genes.ResultsFrom a group of 13 patients, we identified 6 with PPGL, 4 with sporadic or familial isolated pituitary adenomas, and 3 with clinical MEN1; genetic variants were identified in 9/13 cases. We identified the Dutch founder exon 3 deletion in SDHB in two apparently unrelated individuals with distinct ethnic backgrounds that had metastatic PPGL. Asymptomatic carriers with this Dutch founder SDHBexon 3 deletion were also identified. Other PPGL patients had variants in SDHB, and SDHD and three MEN1variants were identified among MEN1 and young-onset pituitary adenoma patients.ConclusionsThis is the first identification of a Dutch founder effect for PPGL in South Africa. Awareness of the presence of this exon 3 SDHB deletion could promote targeted screening at a local level. Insights into PPGL genetics in South Africa could be achieved by studying existing patient databases for Dutch founder mutations in SDHx genes.

Clinical MEN-1 Among a Large Cohort of Patients With Acromegaly.

ContextClinical multiple endocrine neoplasia type 1 (MEN-1) is diagnosed by the presence of at least 2 MEN-1–associated tumors. Many patients with acromegaly and clinical MEN-1 yield negative testing for MEN1 mutations. While cases of acromegaly and primary hyperparathyroidism (PHP) with negative genetic testing have been reported, its prevalence among patients with acromegaly is undetermined, and the clinical presentation has not been well characterized.ObjectivesThe main goals of this study are: (1) To determine the prevalence of clinical MEN-1 with PHP in patients with acromegaly and characterize their clinical features; and (2) to evaluate the genetic basis for the coexistence of acromegaly and PHP.DesignRetrospective record review and genetic analysis.SettingClinical Research Centers.Participants414 patients with acromegaly.InterventionsClinical evaluation and DNA sequencing for MEN1, CDKN1A, CDKN1B, CDKN2B, CDKN2C, and AIP genes.Main outcome measurementsClinical and genetic analysis.ResultsAmong patients with acromegaly, clinical MEN-1, as defined by the presence of at least one other MEN-1-associated tumor, was present in 6.6%. PHP occurred in 6.1%; more than half had parathyroid hyperplasia. DNA sequencing was unrevealing for genetic mutations, except for 1 case of a CDC73 mutation. Acromegaly was diagnosed at an older age with a higher prevalence of malignancies (specifically breast and thyroid) in patients with coexisting PHP than those with isolated acromegaly.ConclusionsA distinct phenotype is described in patients with clinical MEN-1 and negative genetic testing for mutations previously associated with this syndrome. Further studies are needed to identify other genes that may explain the association between PHP and acromegaly.

Total and Subtotal Parathyroidectomy in Young Patients With Multiple Endocrine Neoplasia Type 1-Related Primary Hyperparathyroidism: Potential Post-surgical Benefits and Complications.

Background: The choice of surgical treatment for patients with Multiple Endocrine Neoplasia type 1 (MEN1)-related primary hyperparathyroidism (PHPT) remains controversial and it has not been specifically addressed in young patients.Methods: This is a retrospective case series study. The study includes the surgical data and the follow-up of 38 patients younger than 30 years of age, all diagnosed with MEN1, collected and followed-up between 1991 and 2017 at the Regional Referral Center for Inherited Endocrine Tumors of the Tuscany Region, and operated by parathyroidectomy. Genetic and/or clinical MEN1 diagnosis was made before surgery in all patients. Subtotal (9/38 patients) or total parathyroidectomy with auto-transplantation (28/38 patients) were performed in all patients but one, in whom a single mediastinal adenoma was excised from the aorto-pulmonary window. All patients but one, who was operated in 2017, had a post-operatory follow-up of at least 12 months.Results: Total parathyroidectomy (TPTX), with auto-transplantation, was the most frequently adopted operation both as primary (20/38 patients) and secondary (8/38 patients) surgery, followed by subtotal parathyroidectomy (SPTX; 9/38 patients) and limited parathyroidectomy (1/38 patient). At follow-up, lasting a mean of 11.8 ± 6.6 years (range 0–23 years), no persistent PHPT was observed. PHPT recurred in 4/28 TPTX (14%) and in 2/9 SPTX (22%). Permanent hypoparathyroidism showed no statistically significant difference between the procedures (2/9 in SPTX and 5/28 in TPTX).Conclusions: Data from this retrospective study showed the efficacy of TPTX for the treatment of MEN1-PHPT, also in adolescent and young patients, showing, in our series, no risk of PHPT permanence and a longer disease-free period and, subsequently, the possibility to postpone re-intervention with respect to both limited PTX and SPTX. The risk of permanent hypoparathyroidism in TPTX was comparable to STPX, and could be mitigated over the years.

Deletion of exons 1–3 of the MEN1 gene in a large Italian family causes the loss of menin expression

Multiple endocrine neoplasia type 1 (MEN1) syndrome is an autosomal dominant disease, characterized by parathyroid adenomas, endocrine gastroenteropancreatic tumors and pituitary adenomas, due to inactivating mutations of the MEN1 gene (chromosome 11q13). MEN1 mutations are mainly represented by nonsense, deletions/insertions, splice site or missense mutations that can be detected by direct sequencing of genomic DNA. However, MEN1 patients with large heterozygous deletions may escape classical genetic screening and may be misidentified as phenocopies, thereby hindering proper clinical surveillance. We employed a real-time polymerase chain reaction application, the TaqMan copy number variation assay, to evaluate a family in which we failed to identify an MEN1 mutation by direct sequencing, despite a clear clinical diagnosis of MEN1 syndrome. Using the TaqMan copy number variation assay we identified a large deletion of the MEN1 gene involving exons 1 and 2, in three affected family members, but not in the other nine family members that were to date clinically unaffected. The same genetic alteration was not found in a group of ten unaffected subjects, without family history of endocrine tumors. The MEN1 deletion was further confirmed by multiplex ligation-dependent probe amplification, which showed the deletion extended from exon 1 to exon 3. This new approach allowed us to correctly genetically diagnose three clinical MEN1 patients that were previously considered as MEN1 phenocopies. More importantly, we excluded the presence of genetic alterations in the unaffected family members. These results underline the importance of using a variety of available biotechnology approaches when pursuing a genetic diagnosis in a clinically suggestive setting of inherited endocrine cancer.

Novel mutations in MEN1, CDKN1B and AIP genes in patients with multiple endocrine neoplasia type 1 syndrome in Spain

Multiple endocrine neoplasia type 1 (MEN1) is a rare autosomal dominant disorder mostly owing to a genetic defect in MEN1 gene. Not all patients with MEN1 phenotype present a defect in this gene. Thus, other genes like CDKN and AIP have been showed to be involved in MEN1-like patients. The aim of this study was to perform a genetic screening in our cohort or patients with suspected MEN1 syndrome by direct sequencing analysis of MEN1, CDKN1B and AIP, and dosage analysis of MEN1 and AIP. A total of 79 different sporadic and familial cases with the MEN1 phenotype have been studied, in which 34 of them (48%) present a mutation in MEN1 gene. In two patients without a detectable mutation in MEN1 gene, we have identified a novel missense mutation (c.163G>A/p.Ala55Thr) in CDKN1B gene and a novel frameshift mutation (c.825_845delCGCGGCCGTGTGGAATGCCCA/p. His275GlnfsX49) in AIP gene, respectively. Our data support that MEN1 gene is the main target for genetic analysis in clinical MEN1 syndrome. We confirm that in those patients without MEN1 gene mutation, other genes such as CDKN1B/p27Kip, or AIP in those including pituitary tumours should also be tested.

Multiple endocrine neoplasia type 1 (MEN1): its manifestations and effect of genetic screening on clinical outcome

Effect of genetic screening on outcome in multiple endocrine neoplasia type 1 (MEN1) remains unclear. Expression of MEN1 is described using currently available diagnostic techniques. Manifestations and outcome are compared in patients diagnosed because of clinical expression with those diagnosed by genetic screening. Retrospective cohort study. Patients are divided into two groups: patients with a (i) clinical MEN1 diagnosis and (ii) MEN1 diagnosis by genetic screening. Demographic and clinical data were collected on MEN1 patients treated in the UMCU up to 1 January 2008. Results of mutation analysis were obtained from the Department of Medical Genetics. A total of 74 patients was included (median follow-up 5.5 year); 78% had hyperparathyroidism, 46% a pancreatic neuro-endocrine tumour (NET), 38% a pituitary abnormality, 8% a NET of other origin and 16% an adrenal adenoma at the end of follow-up. Of the patients 18% had no manifestation. All five MEN1-related tumours were seen as first manifestation. Compared with patients identified by genetic screening, patients with a clinical MEN1 diagnosis had significantly more manifestations at diagnosis (P < 0.001) and at end of follow-up (P = 0.002). Eleven of 30 patients with a genetic MEN1 diagnosis (mean age at diagnosis 30.0 years) already had manifestations at diagnosis. No malignancy or death was seen in genetically diagnosed patients. MEN1 is a syndrome with high morbidity. Genetic diagnosis is associated with less morbidity at diagnosis and at follow-up. Early genetic diagnosis might therefore lead to improvement of long-term outcome.

Clinical Testing for Mutations in theMEN1Gene in Sweden: A Report on 200 Unrelated Cases

Multiple endocrine neoplasia type 1 (MEN1) is a tumor syndrome of the parathyroid, endocrine pancreas, and anterior pituitary caused by mutations in the MEN1 gene on 11q13. The goal of this study was to determine the MEN1 mutation spectrum and detection rate among Swedish patients and identify which patient categories should be tested for MEN1 mutations. DNA sequences and referral forms from patients referred to the Department of Clinical Genetics at Karolinska University Hospital, Sweden, for clinical MEN1 mutation screening were analyzed. The mutation status of 371 patients (including 200 probands) was ascertained, and the multiplex ligation-dependent probe amplification (MLPA) assay was evaluated for the detection of large deletions. The main outcome measure was MEN1 genotypes. Forty-eight of 200 index cases (24%) shared 40 different mutations (18 novel). A total of 69% of all mutations resulted in a truncated protein. Two large deletions were detected by MLPA. A total of 94% of all MEN1 families had a mutation in the coding region of the MEN1 gene. A total of 6% of sporadic cases had MEN1 mutations. There was no correlation between severe disease and mutation type or location. A total of 4% of all mutations were large deletions, and MLPA is now included in our standard MEN1 mutation screening. Individuals with at least one typical endocrine tumour and at least one of the following: 1) a first-degree relative with a major endocrine tumor; 2) an age of onset less than 30 yr; and/or 3) multiple pancreatic tumors/parathyroid hyperplasia were most likely to harbor a mutation; thus these patients should be screened for MEN1 mutations.

Germline CDKN1B/p27Kip1 Mutation in Multiple Endocrine Neoplasia

Germline mutations in the MEN1 gene predispose to multiple endocrine neoplasia type 1 (MEN1) syndrome, but in up to 20-25% of clinical MEN1 cases, no MEN1 mutations can be found. Recently, a germline mutation in the CDKN1B gene, encoding p27(Kip1), was reported in one suspected MEN1 family with two acromegalic patients. Our objective was to evaluate the role of CDKN1B/p27(Kip1) in human tumor predisposition in patients clinically suspected of MEN1 but testing negative for MEN1 germline mutation as well as in familial and sporadic acromegaly/pituitary adenoma patients. Genomic DNA was analyzed for germline mutations in the CDKN1B/p27(Kip1) gene by PCR amplification and direct sequencing. The study was conducted at nonprofit academic research and medical centers. Thirty-six Dutch and one German suspected MEN1 patient, who previously tested negative for germline MEN1 gene mutations, were analyzed. In addition, 19 familial and 50 sporadic acromegaly/pituitary adenoma patients from Europe and the United States were included in the study. We analyzed germline CDKN1B/p27(Kip1) mutations in individuals with pituitary adenoma and MEN1-like features. A heterozygous 19-bp duplication (c.59_77dup19) leading to a truncated protein product was identified in one Dutch patient with suspected MEN1 phenotype, pituitary adenoma, carcinoid tumor, and hyperparathyroidism (one of 36, 2.8%). No mutations were detected in either familial or sporadic acromegaly/pituitary adenoma patients. Our results support the previous finding that germline CDKN1B/p27(Kip1) mutations predispose to a human MEN1-like condition. However, such mutations appear uncommon in suspected MEN1 cases and rare or nonexistent in familial or sporadic acromegaly/pituitary adenoma patients.

Multiple endocrine neoplasia type 1: fresh perspective on clinical features and penetrance

Multiple endocrine neoplasia type 1 (MEN-1) is an interesting genetic syndrome of polyendocrinopathies. Clinical knowledge about MEN-1 is essential as it appears to be significantly under-diagnosed. New data from several prospective series shows not only that as a many as 40% of patients manifest a first feature of MEN-1 after age 40, but also that as many as a third of gene carriers do not present with hyperparathyroidism as the first feature, as previously believed. Mutational analysis for frequently involved exons of the gene menin on chromosome 11 is now available, but negative results should be interpreted with caution in patients with clinical MEN-1. Disease-specific mortality is significant, arises largely from pancreatic islet carcinoma and malignant thymic carcinoid, and renders this disorder worthy of careful and early prospective diagnosis and treatment.

Loss of wild-type MEN1 gene expression in multiple endocrine neoplasia type 1-associated parathyroid adenoma.

Multiple endocrine neoplasia type 1 (MEN1) is a human hereditary tumor syndrome characterized by the development of endocrine adenomas of the parathyroid, anterior pituitary, and enteropancreatic tissue. Several lines of evidence have implicated the recently identified MEN1 gene located on chromosome 11q13 as a recessive tumor suppressor gene. Here, we analyzed MEN1 wild-type gene expression in tumors from a large MEN1 kindred. A deletion of codons 227-228 (678del6) located in exon 4 was found in tumor and peripheral blood complementary DNA using a simplified single-strand conformational polymorphism (SSCP) approach well suited for clinical MEN1 mutation screening. The identified 678del6 cDNA mutation deletes a potential phosphorylation site (Tyr227) and corresponds to a germ line mutation co-segregating with disease phenotype in this MEN1 family. Loss of heterozygosity analysis by fluorescent microsatellite PCR showed an exclusive loss of the MEN1 wild-type (and retention of the mutated) allele detectable in DNA from microdissected parathyroid and pancreatic, but not in adrenal, adenomas. Our findings confirm the synergism between MEN1 gene mutations and subsequent MEN1 allelic losses in the tumorigenesis of MEN1-associated adenomas.