Chlorotic Spot Virus Research Articles

Multigenic Hairpin Transgenes in Tomato Confer Resistance to Multiple Orthotospoviruses Including Sw-5 Resistance-Breaking Tomato Spotted Wilt Virus.

Tomato spotted wilt virus (TSWV) and related thrips-borne orthotospoviruses are a threat to food and ornamental crops. Orthotospoviruses have the capacity for rapid genetic change by genome segment reassortment and mutation. Genetic resistance is one of the most effective strategies for managing orthotospoviruses, but there are multiple examples of resistance gene breakdown. Our goal was to develop effective multigenic, broad-spectrum resistance to TSWV and other orthotospoviruses. The most conserved sequences for each open reading frame (ORF) of the TSWV genome were identified, and comparison with other orthotospoviruses revealed sequence conservation within virus clades; some overlapped with domains with well-documented biological functions. We made six hairpin constructs, each of which incorporated sequences matching portions of all five ORFs. Tomato plants expressing the hairpin transgene were challenged with TSWV by thrips and leaf-rub inoculation, and four constructs provided strong protection against TSWV in foliage and fruit. To determine if the hairpin constructs provided protection against other emerging orthotospoviruses, we challenged the plants with tomato chlorotic spot virus and resistance-breaking TSWV and found that the same constructs also provided resistance to these related viruses. Antiviral hairpin constructs are an effective way to protect plants from multiple orthotospoviruses and are an important strategy in the fight against resistance-breaking TSWV and emerging viruses. Targeting of all five viral ORFs is expected to increase the durability of resistance, and combining them with other resistance genes could further extend the utility of this disease control strategy. [Formula: see text] Copyright © 2024 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license.

The complete genome sequence of tomato necrotic ringspot virus in chilli in Thailand derived from next-generation sequencing.

Tomato necrotic ringspot virus (TNRV) was first reported in Thailand in 2011, where it continues to reduce the yield and quality of pepper and tomato crops. Here, we report the complete genome sequence of TNRV isolate chilli-CR derived from next-generation sequencing. The TNRV genome comprises 16,595 nucleotides (nt) on three RNA segments. The L RNA is 8,858 nt, the M RNA is 4,724 nt, and the S RNA is 3,013 nt in length. The genome structure and organization are typical of orthotospoviruses, encoding five proteins, named L, NSm, GNGC, NSs, and N. Pairwise comparison of each genomic RNA segment and its deduced amino acid (aa) sequence showed that TNRV chilli-CR shares 73.6-82.3% nt sequence identity and 81.1-91.9% aa sequence identity with pepper chlorotic spot virus (PCSV). Similar phylogenetic groupings were observed based on each genomic RNA or deduced aa sequence, and with concatenated genomic RNA sequences. The clustering of TNRV and PCSV in all phylogenetic analyses, and the 78.9% overall nt sequence identity observed using the concatenated genomic RNAs suggest that TNRV is a distinct orthotospovirus and that analysis of concatenated orthotospovirus genome sequences will be of value in future phylogenetic studies of this virus group.

First Report of Melon Chlorotic Spot Virus in Cultivated Sorrel (Rumex acetosa) in Belgium

In 2020, symptoms of putative viral origin were observed on 7% of tomatoes in an organic vegetable farm in Belgium (deformed uneven ripened fruits, vein clearing, mosaic and purple leaves, stunted plants). The leaves of twenty symptomatic plants were collected, pooled and screened for viruses using high throughput sequencing technologies (HTS) on Illumina NextSeq500 following a virion-associated nucleic acid (VANA) protocol (Temple et al., 2021, Be_SL1). In total, 3,665,498 reads (PE150) were generated. Bioinformatic analyses (denovo assembly, tblastx search on NCBI and mapping) using Geneious Prime® 2020.1.2 revealed the presence of three viruses known to infect tomatoes: Physostegia chlorotic mottle virus (PhCMoV), 547,142 reads map on NC_055466, potato virus Y (PVY), 4056 reads map on MW595184, and melon chlorotic spot virus (MeCSV), 55 reads mapped to six out of the eight different MeCSV segments (NC_040448-55). Tomato plants have already been artificially inoculated by MeCSV (Lecoq et al., 2019) but this detection (confirmed by independent RT-PCR on the pooled sample) is the first one in natural condition on farm. The high prevalence of symptoms triggered the research of alternative perennial hosts that can serve as a reservoir during inter-cropping season. One plant of Rumex acetosa showing vein clearing (CT-122) was collected in the same greenhouse the year after. Total RNA was extracted, followed by ribodepletion, and Illumina HTS using the protocol described in Temple et al., (2021) for Be_GP1. In total, 4,549,721 PE150 reads were obtained and bioinformatic analyses confirmed the presence of MeCSV (8,816 reads mapped on eight RNA segments NC_040448-55 with an average 96,52% coverage of the reference sequences, supplementary table 1) and suggested the presence of an unclassified partitivirus. Consensus sequences were extracted for each segment of MeCSV (OQ818038-45) and showed between 83% and 87% of nucleotide identity with the reference sequences NC_040448-55. RNA1 segment was used to design MeCSV-specific RT-PCR primers for detection (MeCSV-125F 5’-TTTAAGGCCAGATCCAGAGGTTC-3’/ MeCSV-498R 5’-TGGATGTGACAACCTGGTAGTAC-3’). Thereafter, in July 2022, 42 R. acetosa plants were collected in the same greenhouse. Among them, seven plants showed vein clearing, two showed yellowing with necrosis, two exhibited yellowing and vein clearing (Supplementary figure 1), and one showed mosaic. The 42 plants were subjected to RNA extraction and RT-PCR for MeCSV (Supplementary figure 2) and PhCMoV detection. MeCSV was detected in 13 plants (two asymptomatic plants and all the symptomatic plants except the one exhibiting mosaic where PhCMoV was detected). PhCMoV was also detected in three plants with vein clearing, one with yellowing and one of the two asymptomatic plants infected by MeCSV. Our results report the first detection of MeCSV in R. acetosa and the first detection of MeCSV in Belgium. In addition, according to the hierarchical approach for assessing causal relationships in plant virology (Fox et al., 2020), a preliminary association was observed between symptoms and MeCSV detection [6% prevalence on asymptomatic plants and 92% prevalence on diseased plants (from which seven symptomatic samples were not co-infected by PhCMoV)]. Symptom causality should be further investigated but this results are important for disease management because they suggested that cultivated perennial R. acetosa may serve as a reservoir for two emergent plant viruses (PhCMoV and MeCSV) (Lecoq et al., 2019, Temple et al., 2021).

Viruses and viroids in tomato (Solanum lycopersicum) and plant growth promoting rhizobacteria as a management alternative

Viruses and viroids cause several diseases in tomato (Solanum lycopersicum) worldwide, generating important economic losses. About 312 viruses and seven viroids have been associated, of which more than 28 are present in Mexico. Therefore, the use of Plant Growth-Promoting Rhizobacteria (PGPR) can be an effective alternative for the management of viruses and viroids. The genera Pseudomonas, Bacillus, Azospirillum, Anabena and Stenotrophomonas have been implemented against main viruses reported in tomato: Cucumber mosaic virus (CMV), Tobacco mosaic virus (TMV), Tomato chlorotic spot virus (TCSV), Tomato mottle virus (ToMoV), Tomato spotted wilt virus (TSWV), Tomato yellow leaf curl virus (TYLCV), Potato virus Y (PVY), Groundnut bud necrosis virus (GBNV), with benefits in decreased incidence and severity up to 80 % and yield increase over 40 %. In Mexico, only Bacillus has been used. The use of PGPR is a strategy that could mitigate the impact of viral and viroid diseases and can be integrated into integrated management.

Survey of viruses and vectors in tomato plants, alternative hosts and weeds in the state of Santa Catarina, Brazil

AbstractSanta Catarina is an important tomato‐producing state in Brazil, but there is little data regarding the prevalence and characterization of viruses and insect vectors in tomato plants in this state. This study surveyed viruses and their vectors in commercial tomato‐producing areas, as well as alternative hosts and weeds in the surrounding areas. Sixty‐five samples of young leaves were collected between 2019 and 2023, and viruses were detected with generic or specific PCR primers targeting several virus genera. In addition, 397 virus vector insect samples were collected and identified. The orthotospoviruses tomato chlorotic spot virus (TCSV) and groundnut ringspot virus (GRSV) were the most prevalent and distributed in several regions, whilst the crinivirus tomato chlorosis virus (ToCV) and begomovirus tomato severe rugose virus (ToSRV) were restricted to the metropolitan region of Florianópolis. This is the first report of ToSRV in Solanum americanum in Brazil and of TCSV in zucchini and cucumbers worldwide. A survey of insect vectors found whiteflies, Mediterranean cryptic species of Bemisia tabaci (MED) and Trialeurodes vaporariorum were predominant, while Frankliniella occidentalis and F. schultzei thrips were often found cohabiting in the sampled crops. These results highlight the need to adapt management strategies in Santa Catarina, especially in the Santo Amaro da Imperatriz region, where a greater frequency and diversity of viral species and vectors were found. In addition, both the thrips and whitefly species (especially MED) found are a cause for concern, as they readily transmit viruses that infest crops in the open fields of Santa Catarina.

Integrated Effect of Plastic Mulches and Biorational Insecticides in Managing Tomato Chlorotic Spot Virus (TCSV) and Its Vector Thrips in Tomatoes.

In the USA, tomato chlorotic spot virus (TCSV) was first identified in Miami-Dade County of Florida in 2012. This viral disease is transmitted by thrips (Thysanoptera: Thripidae) of different species, imposing a serious threat to the entire tomato production in the state. Both cultural and chemical control techniques could be essential tools to combat this vector-borne disease. In the present two-year-long study, we determined the effect of different types of plastic mulches and biorational insecticides on managing thrips and TCSV. Results from the leaf and flower samples showed a significantly lower adult thrips population in Entrust®SC treated tomatoes than in other treated and untreated tomatoes in 2018. Silver on black and silver on white reflective plastic mulches significantly reduced the adult thrips population in 2018. In both study years, marketable yield was significantly higher in tomatoes treated with Entrust®SC and reflective plastic mulches than in other treatments. The incidence of TCSV was significantly reduced in tomatoes treated with Entrust®SC and reflective plastic mulches than the untreated control in 2018. Marketable yield was negatively correlated with the thrips population, as observed from the Pearson correlation coefficient analysis. This research describes a potentially viable management program for thrips and thrips-transmitted TCSV.

First Report of Resistance-Breaking Variants of Tomato Spotted Wilt Virus (TSWV) Infecting Tomatoes with the Sw-5 Tospovirus-Resistance Gene in North Carolina.

Widespread use of tomato cultivars with the Sw-5 resistance gene has led to the emergence of resistance-breaking (RB) strains of tomato spotted wilt virus across the globe. In June of 2022, tomato spotted wilt (TSW) symptoms were observed at two farms (A and B, within 15 miles of each other) in Rowan County, NC on several commercial TSW resistant tomato cultivars (all heterozygous for the Sw-5 gene). At farm A, ~10% of plants had symptomatic foliage with ~30% of fruit with symptoms, while at farm B, up to 50% of plants had symptomatic foliage with ~80% of fruit with symptoms. Visual symptoms included stunting, severe leaf curling and bronzing, necrotic lesions on leaves, petioles and stems, and concentric ring spots on fruit (Supplementary Fig. 1). TSWV ImmunoStrips (AgDia, Elkhart, IN) and reverse-transcription (RT)-PCR with NSm primers (di Rienzo et al 2018) confirmed the presence of TSWV in 12 symptomatic plants sampled across the two farms. Primers designed to detect Impatiens necrotic spot virus, groundnut ringspot virus, tomato chlorotic spot virus, tomato chlorosis virus, alfalfa mosaic virus, and tomato necrotic streak virus (ilarvirus, Badillo et al., 2016) failed to generate amplicons of the expected size from cDNA generated from these field samples. The amplicons from full-length NSm cDNA were sequenced from independent, single-leaflet isolates from the TSWV-positive plants (three from farm A, nine from farm B) with the expectation of finding an amino acid (aa) substitution associated with the Sw-5 RB phenotype identified previously in CA (C118Y, Batuman et al. 2017) or Spain (C118Y and T120N, Lopez et al. 2011). All three nucleotide sequences from farm A contained the NSm C118Y substitution reported in CA. All three sequences were 99% identical (including the C118Y mutation) to NCBI GenBank accession KU179600.1, a TSWV isolate collected from GA in 2014 with no cultivar information reported. The nine nucleotide sequences from farm B contained neither of the two previously reported aa substitutions associated with the RB phenotype. Instead, all contained a D122G substitution within a conserved region of the TSWV NSm protein reported to be involved in direct interaction with the Sw-5 protein (Zhu et al 2017). Likewise, Huang et al (2021) generated a D122A mutation in TSWV-NSm, resulting in failure to elicit a Sw-5 mediated hypersensitive response. Three NSm sequences retrieved from GenBank contained the D122G substitution (AY848921.1, HM015516.1, KU179582.1), however, this mutation was not implicated directly with RB phenotypes (Ciuffo et al., 2005; Lopez et al., 2011; Marshall, 2016). The RB phenotype was confirmed with the NC variants on 'Mountain Merit' (Sw-5) by two means of virus inoculation: mechanical, rub-inoculation with extracted sap from infected plants, and thrips transmission assays with lab colony-maintained, Frankliniella occidentalis, the western flower thrips. Symptomatic leaf tissue obtained from these inoculation assays tested positive for TSWV by DAS-ELISA (AgDia, Elkhart, IN) and RT-PCR with NSm primers, providing definitive evidence of the occurrence of RB-TSWV at both farms, and subsequent sequencing confirmed the C118Y and D122G substitutions. This report warrants further investigation of the putative origins, prevalence and epidemiological implications of RB-TSWV variants in NC tomato production, and the development of new sources of resistance to TSWV.

Development of a reverse transcription recombinase polymerase amplification combined with lateral flow assay for equipment-free on-site field detection of tomato chlorotic spot virus

BackgroundTomato chlorotic spot virus (TCSV) is an economically important, thrips-transmitted, emerging member of the Orthotospovirus genus that causes significant yield loss mainly in tomatoes, but also in other vegetable and ornamental crops. Disease management of this pathogen is often challenging due to the limited availability of natural host resistance genes, the broad host range of TCSV, and the wide distribution of its thrips vector. Point-of-care detection of TCSV with a rapid, equipment-free, portable, sensitive, and species-specific diagnostic technique can provide prompt response outside the laboratory, which is critical for preventing disease progression and further spread of the pathogen. Current diagnostic techniques require either laboratory-dependent or portable electronic equipment and are relatively time-consuming and costly.ResultsIn this study, we developed a novel technique for reverse-transcription recombinase polymerase amplification combined with lateral flow assay (RT-RPA-LFA) to achieve a faster and equipment-free point-of-care detection of TCSV. The RPA reaction tubes containing crude RNA are incubated in the hand palm to obtain sufficient heat (∼36 °C) for the amplification without the need for equipment. Body-heat mediated RT-RPA-LFA is highly TCSV-specific with a detection limit as low as ∼6 pg/μl of total RNA from TCSV-infected tomato plants. The assay can be performed in 15 min in the field.ConclusionTo the best of our knowledge, this is the first equipment-free, body-heat-mediated RT-RPA-LFA technique developed to detect TCSV. Our new system offers a time-saving advantage for the sensitive and specific diagnostic of TCSV that local growers and small nurseries in low-resource settings can use without skilled personnel.

Interspecies/Intergroup Complementation of Orthotospovirus Replication and Movement through Reverse Genetics Systems.

Orthotospoviruses, the plant-infecting bunyaviruses, cause serious diseases in agronomic crops and pose major threats to global food security. The family of Tospoviridae contains more than 30 members that are classified into two geographic groups, American-type and Euro/Asian-type orthotospovirus. However, the genetic interaction between different species and the possibility, during mixed infections, for transcomplementation of gene functions by orthotospoviruses from different geographic groups remains underexplored. In this study, minireplicon-based reverse genetics (RG) systems have been established for Impatiens necrotic spot virus (INSV) (an American-type orthotospovirus) and for Calla lily chlorotic spot virus and Tomato zonate spot virus (CCSV and TZSV) (two representative Euro/Asian orthotospoviruses). Together with the earlier established RG system for Tomato spotted wilt virus (TSWV), a type species of the Orthotospovirus American-clade, viral replicase/movement proteins were exchanged and analyzed on interspecies transcomplementation. Whereas the homologous RNA-dependent RNA polymerase (RdRp) and nucleocapsid (N) protein supported the replication of orthotospoviruses from both geographic groups, heterologous combinations of RdRp from one group and N from the other group were unable to support the replication of viruses from both groups. Furthermore, the NSm movement protein (MP), from both geographic groups of orthotospoviruses, was able to transcomplement heterologous orthotospoviruses or a positive-strand Cucumber mosaic virus (CMV) in their movement, albeit with varying efficiency. MP from Rice stripe tenuivirus (RSV), a plant-infecting bunyavirus that is distinct from orthotospoviruses, or MP from CMV also moves orthotospoviruses. Our findings gain insights into the genetic interaction/reassortant potentials for the segmented plant orthotospoviruses. IMPORTANCE Orthotospoviruses are agriculturally important negative-strand RNA viruses and cause severe yield-losses on many crops worldwide. Whereas the emergence of new animal-infecting bunyaviruses is frequently associated with genetic reassortants, this issue remains underexposed with the plant-infecting orthotospovirus. With the development of reverse genetics systems for orthotospoviruses from different geographic regions, the interspecies/intergroup replication/movement complementation between American- and Euro/Asian-type orthotospoviruses were investigated. Genomic RNAs from American orthotospoviruses can be replicated by the RdRp and N from those of Euro/Asia-group orthotospoviruses, and vice versa. However, their genomic RNAs cannot be replicated by a heterologous combination of RdRp from one geographic group and N from another geographic group. Cell-to-cell movement of viral entity is supported by NSm from both geographic groups, with highest efficiency by NSm from viruses belonging to the same group. Our findings provide important insights into the genetic interaction and exchange ability of viral gene functions between different species of orthotospovirus.

The role of ornamental plants as hosts of Tomato chlorotic spot virus and its vector thrips affecting tomato production

The tomato industry in South Florida (USA) is seriously affected by recently emerging Tomato chlorotic spot virus (TCSV). Western flower thrips, Frankliniella occidentalis (Pergande), and common blossom thrips, Frankliniella schultzei (Trybom) (Thysanoptera: Thripidae), are the two known vectors of TCSV in Florida. In the present study, the presence of thrips vectors and TCSV in 24 flowering ornamental plant species was observed in South Florida. The two thrips vectors, as well as melon thrips, Thrips palmi Karny (Thysanoptera: Thripidae), were abundant in the area; they were observed with a range from high (83.1 per sample of 10 flowers) in Hibiscus rosa-sinensis L. to low (3.7 per sample of 10 flowers) in Catharanthus roseus (L.) G. Don in a nursery study. In a subsequent greenhouse study, we selected seven species of ornamentals, among which the species with the highest thrips abundance, and planted them next to tomato, to determine their effects on TCSV incidence and thrips abundance in tomatoes. Tomatoes with Portulaca oleracea L. next to them showed a higher number of TCSV-infected plants (4.25 plants per plot in 2017, and 3.25 plants per plot in 2018) compared to tomatoes with some of the other ornamentals next to them. We report the presence of TCSV through reverse transcriptase polymerase chain reaction (RT-PCR) analysis in Lantana camara L., H. rosa-sinensis, Mandevilla spec., Gazania linearis (Thunb.) Druce, Hemerocallis spec., Agastache spec., and P. oleracea. Identification of alternative hosts of TCSV and thrips vectors can be helpful to evaluate the ongoing management programs and develop future programs in local tomato-growing areas.

Field-portable, rapid, and low-cost RT-LAMP assay for the detection of tomato chlorotic spot virus.

Tomato chlorotic spot virus (TCSV) is a highly destructive, thrips-transmitted, emerging orthotospovirus in various vegetable and ornamental crops. It is important to reduce the risk of spreading this virus by limiting the movement of infected plant materials to other geographic areas by utilizing point-of-care diagnostics. Current diagnostic assays for TCSV require costly lab equipment, skilled personnel, and electricity. Here we report the development of a simple rechargeable battery-operated handwarmer-assisted reverse transcription-loop-mediated isothermal amplification (RT-LAMP) assay and demonstrate a step-by-step protocol to achieve in-field detection of TCSV. Under field conditions, handwarmer-assisted RT-LAMP can detect as little as 0.9 pg/μl of total RNA from TCSV-infected tomato plants in <35 minutes. When fully charged, the field-portable device can be used in six consecutive RT-LAMP detection assays, yielding test results for 96 individual samples. Dye-based colorimetric methods, including pH and metal ion indicators, were evaluated to eliminate laboratory-dependent LAMP visualization. Phenol-red combined with hydroxynaphthol blue was adopted in the handwarmer-assisted RT-LAMP detection method to obtain a more robust color difference distinguishable by the naked eye. Overall, handwarmer-assisted RT-LAMP is a rapid, highly sensitive, and cost-effective diagnostic technique that can be used by non-specialist personnel in the field, particularly in rural production areas lacking access to a diagnostic lab or constant electricity.

Pre‐infection of tomato plants carrying the Sw‐5 gene with tomato chlorosis virus did not alter infection with groundnut ringspot virus in the field

AbstractTomato crops are affected by various viral diseases. In Brazil, the most frequent of these diseases are caused by the begomovirus tomato severe rugose virus (ToSRV), the crinivirus tomato chlorosis virus (ToCV) and orthotospoviruses, mainly groundnut ringspot virus (GRSV) and tomato chlorotic spot virus (TCSV). Mixed infections can result in synergistic interactions and, in some cases, the breakdown of resistance, as previously reported for the interaction between ToCV and tomato spotted wilt virus (TSWV) in tomato plants carrying the Sw‐5 orthotospovirus‐resistance gene. This study evaluated the interaction between ToCV and the orthotospoviruses GRSV, TCSV and TSWV in tomato plants carrying the Sw‐5 gene, as well as the attractiveness of ToCV‐infected tomato plants to thrips in the field. Greenhouse assays demonstrated that the resistance to infection with GRSV and TCSV was overcome in 17% of the tomato plants previously infected with ToCV. In contrast, ToCV‐pre‐infected plants remained resistant to TSWV. Under field conditions, the incidence of orthotospoviruses was low in resistant tomato cultivars, even with a high incidence of ToCV‐infected tomato plants, indicating the effectiveness of the Sw‐5 gene. ToCV pre‐infection of tomato plants did not influence their attractiveness to thrips. In conclusion, pre‐infection with ToCV did not influence the effectiveness of the Sw‐5 resistance gene against GRSV under field conditions.

First report of a resistance-breaking strain of tomato spotted wilt orthotospovirus infecting Capsicum annuum with the Tsw resistance gene in Texas.

Since the first report of the 'spotted wilt' disease of tomato published in 1915 in Australia, tomato spotted wilt orthotospovirus (TSWV) has become a pandemic virus with an estimated economic impact of over $1 billion annually (Brittlebank 1919; German et al. 1992). TSWV strains capable of disrupting Tsw-mediated single gene resistance in pepper (i.e., resistance-breaking or RB strains) have been previously reported in multiple countries (Crescenzi et al., 2013; Deligoz et al. 2014; Margaria et al. 2004; Sharman and Persley 2006; Yoon et al. 2021), but only in California (Macedo et al. 2019) and Louisiana (Black et al. 1996) in the US. In August 2021, severe tospovirus-like disease symptoms (stunting; leaf, stem, and petiole necrosis; and concentric rings on leaves and fruits) were documented in TSWV-resistant cultivars of sweet pepper (Capsicum annuum L.) containing the Tsw gene in Bushland, TX. In the next season in August 2022, leaf samples from 214 TSWV-resistant pepper plants (with or without disease symptoms) from seven cultivars were tested with a TaqMan probe-based qPCR assay targeting coat protein (CP) of the TSWV (TSWV-F: AGAGCATAATGAAGGTTATTAAGCAAAGTGA and TSWV-R: GCCTGACCCTGATCAAGCTATC; TaqMan probe: CAGTGGCTCCAATCCT). Across all cultivars, 85 samples tested positive for TSWV. Of these, 39 showed characteristic TSW symptoms with disease incidence ranging from 10-30% depending on the cultivar. The remaining 46 samples were asymptomatic with no apparent hypersensitive response in leaves. To further confirm the RB status of TSWV strain/s in the field samples, leaves from six TSWV resistant plants from three different pepper cultivars were pooled together and used to mechanically inoculate five non-infected three-week-old pepper plants from nine cultivars: seven TSWV resistant (Tsw), one moderately resistant, and one susceptible, with three replications. Tsw expression in two representative plants from each resistant cultivar was confirmed using SYBR Green based one-step qRT-PCR with primers specified in the South Korea Patent # KR102000469B1 were used with two plants from susceptible cultivar as a negative control. Field plants that tested negative for TSWV in PCR analysis were used as a mock inoculation control and tissues from tomato plants infected with wild-type TSWV strain/s (previously isolated from non-resistant tomato plants) were used as a wild-type control. Three weeks post-inoculation, characteristic orthotospovirus symptoms were observed in plants inoculated with the putative RB isolate, in that TSW incidence ranged between 10-50% in seven resistant cultivars, 70% in a moderately resistant cultivar, and 90% in a susceptible cultivar. On the contrary, no disease incidence was observed in resistant and moderately resistant plants, whereas 50% incidence was observed in susceptible plants in the wild-type control. Hypersensitive response was observed in the local leaves of mechanically inoculated resistant plants that tested negative in PCR approximately 5-7 days post inoculation. All symptomatic and 30-100% asymptomatic TSWV-inoculated plants with RB or wild-type strain/s tested positive for TSWV in probe-based qPCR analysis confirming that none of the tested cultivars was immune to TSWV infection. All mock-inoculated plants tested negative in the qPCR analysis. Both nucleotide and amino acid sequences of complete TSWV silencing suppressor protein (NSs) recovered from six plants originally used in the mechanical inoculation (NCBI accession OP548104) and inoculated resistant plants (NCBI accession OP548113) showed 99% homology with the NSs sequences of New Mexico pepper isolates KU179589 and APG79491, respectively. The NSs point mutation T to A at 104 amino acid position responsible for resistance breaking in pepper in Hungarian TSWV isolates (NCBI accessions KJ649609 & KJ649608 (Almasi et al., 2017) was absent in the NSs sequences from all samples. Besides novel point mutations, genetic reassortment as previously reported in S. Korean TSWV RB pepper isolates (Kwon et al., 2021) and in other orthotospoviruses such as tomato chlorotic spot virus and groundnut ringspot virus (Webster et al., 2011) could be a potential RB mechanism in the Bushland TSWV RB isolates. A comprehensive genomic analysis of these isolates is required to determine the fundamental evolutionary mechanisms that enable the disruption of Tsw-mediated gene resistance. Taken together, these results indicate that at least one, but potentially multiple new strains of TSWV capable of disrupting Tsw-mediated resistance and producing moderate to severe symptoms in an array of commercial resistant pepper cultivars have emerged and pose a significant threat to pepper production in Texas.

Natural Infection of Cichorium intybus (Asteraceae) by Groundnut Ringspot Virus (Genus Orthotospovirus) Isolates in Brazil.

Leaf chicory (Cichorium intybus L.) is a nutritionally rich vegetable used in regional cuisine in Brazil. Plants of C. intybus displaying symptoms (viz. chlorotic and necrotic ringspots, mosaic, and leaf deformation) similar to that induced by orthotospoviruses (genus Orthotospovirus, family Tospoviridae) were observed in three fields (≈ 0.2 ha each) in Gama County, in the Federal District, Brazil, from September 2016 to January 2020 in plants of the cultivars 'Folha-Larga' and 'Spadona' (Fig. 1). Incidence of symptomatic plants was nearly 10% in each field. Transmission electron microscopic examination of thin sections from symptomatic leaf samples showed typical membrane-bounded orthotospovirus particles within cisternae of spongy parenchymal cells (Fig 2). Two individual leaf samples per field were collected and submitted to dot enzyme-linked immunosorbent assay with polyclonal antisera against N protein of tomato spotted wilt virus (TSWV), groundnut ringspot virus (GRSV) and tomato chlorotic spot virus (TCSV). Symptomatic samples strongly reacted only against GRSV antibodies. Total RNA was extracted (Trizol®, Sigma) from all six samples and used as template in RT-PCR assays. The primer J13 (5'-CCCGGATCCAGAGCAAT-3') was employed for cDNA synthesis using M-MLV reverse transcriptase. PCR assays were done with the primer pair BR60/BR65 (Eiras et al., 2001) to obtain ≈ 500 bp fragment of untranslated region and partial N gene in the S RNA segment from each sample. Purified RT-PCR products of two randomly selected individual samples were directly sequenced (GenBank MW467981 and MZ126602) and their BLASTn analyses displayed 99 to 100% nucleotide identity to GRSV isolates previously reported infecting C. endivia L. in Brazil (Jorge et al., 2021). Our analyses combining N protein serology and N-gene sequencing (both directed to the S RNA segment) allowed us to confirm the GRSV infection of C. intybus, but the potential reassortant nature of these isolates (Webster et al., 2015; Silva et al., 2019) are unknown since their M RNA segments were not characterized. Individual leaf extracts (in phosphate buffer, pH 7.0) of the sequenced isolates were mechanically inoculated onto ten seedlings of two C. intybus cultivars ('Folha Larga' and 'Pão-de-Açúcar') and three plants each of the indicator hosts Capsicum chinense PI 159236, Nicandra physalodes; Nicotiana rustica; Datura stramonium; and tomato cv. Santa Clara. Systemic chlorotic and necrotic ringspots, mosaic, and leaf deformation developed in the indicator hosts and infection by GRSV was confirmed via serological assays 20 days after inoculation. However, no symptoms and no serological reaction to GRSV antibodies were observed on the C. intybus cultivars even after two successive mechanical inoculations. This transmission failure might be due to factors such as the requirement of the thrips vector(s), physicochemical barriers in the foliage or the presence of non-mechanically transmissible helper agent(s) necessary to ensure GRSV infection of C. intybus. The natural infection of C. intybus by a not fully characterized orthotospovirus (mostly likely TSWV) has been observed since 1938 in Brazil (Kitajima, 2020). Our report of GRSV infecting C. intybus is thus confirming previous speculations that similar symptoms in this vegetable crop were induced by orthotospovirus infection in Brazil.

A Novel Lineage of Cile-Like Viruses Discloses the Phylogenetic Continuum Across the Family Kitaviridae.

An increasing number of plant species have been recognized or considered likely reservoirs of viruses transmitted by Brevipalpus mites. A tiny fraction of these viruses, primarily those causing severe economic burden to prominent crops, have been fully characterized. In this study, based on high-throughput sequencing, transmission electron microscopy analyses of virions in plant-infected tissues, viral transmission experiments, and the morphoanatomical identification of the involved Brevipalpus mites, we describe molecular and biological features of viruses representing three new tentative species of the family Kitaviridae. The genomes of Solanum violifolium ringspot virus (SvRSV, previously partially characterized), Ligustrum chlorotic spot virus (LigCSV), and Ligustrum leprosis virus (LigLV) have five open reading frames (ORFs) > 500 nts, two distributed in RNA1 and three in RNA2. RNA1 of these three viruses display the same genomic organization found in RNA1 of typical cileviruses, while their RNA2 are shorter, possessing only orthologs of genes p61, p32, and p24. LigCSV and LigLV are more closely related to each other than to SvRSV, but the identities between their genomic RNAs were lower than 70%. In gene-by-gene comparisons, ORFs from LigCSV and LigLV had the highest sequence identity values (nt sequences: 70–76% and deduced amino acid sequences: 74–83%). The next higher identity values were with ORFs from typical cileviruses, with values below 66%. Virions of LigLV (≈ 40 nm × 55 nm) and LigCSV (≈ 54 nm × 66 nm) appear almost spherical, contrasting with the bacilliform shape of SvRSV virions (≈ 47 nm × 101 nm). Mites collected from the virus-infected plants were identified as Brevipalpus papayensis, B. tucuman, and B. obovatus. Viruliferous B. papayensis mites successfully transmitted LigCSV to Arabidopsis thaliana. SvRSV, LigCSV, and LigLV seem to represent novel sub-lineages of kitaviruses that descent on parallel evolutionary branches from a common ancestor shared with the tentative cile-like virus hibiscus yellow blotch virus and typical cileviruses. Biological and molecular data, notably, the phylogenetic reconstruction based on the RdRp proteins in which strong support for monophyly of the family Kitaviridae is observed, mark an advance in the understanding of kitavirids.

First Report of a Secovirus Associated with Mountain Celery Chlorotic Spot Disease in Heilongjiang, China.

Mountain celery (Heracleum moellendorffii Hance), an edible perennial herb of Northeast Asia, is sporadically cultivated as a vegetable crop or for medicinal purposes in Northeast China and Korea [1]. In July 2019, a small field of mountain celeries showing chlorotic spots was found in Wangkui, Heilongjiang, China. A small-RNA (sRNA) library was constructed with equal amounts of leaf tissues of a diseased mountain celery and a tomato sample showing mottling symptom from a nearby field using the TruSeq small RNA library preparation kit (Illumina). The library was sequenced by the HiSeq 4000 sequencer at Lianchuan Biotechnology Co., Ltd (Hangzhou, China). After trimming adaptor sequences and discarding low quality reads by Cutadapt [2], the remaining 6,949,946 reads of 17 to 27 nucleotides (nt) were de novo assembled as described [3]. The resulting 395 contigs were searched against the GenBank viral sequence database using the BLASTn and BLASTx algorithms. Twenty-three contigs showed high nt sequence similarities (89-100%) to the genomic sequence of tomato mosaic virus (ToMV). The deduced amino acid (aa) sequences of thirty contigs had 22-96% aa sequence identities to viruses in the family Secoviridae, e.g., surrounding non-legume associated secovirus (snLaSV) and lettuce secovirus 1 (LSV-1). No contig homologous to the genomic sequences of other plant viruses was identified. Total RNAs were extracted from the mountain celery and tomato separately and reverse transcribed into cDNAs by random hexamer plus Oligo-dT(18) using the Super® IV Reverse Transcriptase (Invitrogen, Shanghai, China). Polymerase chain reactions (PCR) showed that the secovirus was derived from the mountain celery, whereas the tomato was infected by ToMV. The genome of this secovirus was determined by reverse transcription (RT)-PCR and rapid amplification of cDNA ends (RACE). Amplicons were cloned and Sanger sequenced with at least three independent clones per amplicon. Sequences were assembled by the SeqMan Pro 7.1.0 in the Lasergene (DNASTAR, Madison, WI). The genome of this virus is composed of two RNAs of 6,616 and 5,356 nt (excluding the polyadenylic acid tails) (GenBank accession nos. MW143070 and MW143071, respectively). The thirty contigs assembled from sRNAs could be mapped to the genome. Pairwise sequence analyses showed that RNA1 and RNA2 and their encoded polyproteins shared the highest nt (82.7% and 82.2%) and aa (93.4% and 91.8%) sequence identities with the respective RNAs (GenBank accession nos. MN412739 and MN412740) and their encoded polyproteins of snLaSV [4]. In the phylogenetic trees, this virus sequence clustered with snLaSV and LSV-1 in a separate branch neighboring viruses of the subgenus Stramovirus or Satsumavirus in the genus Sadwavirus. These results suggest that this virus is an isolate of the unclassified snLaSV and was referred as snLaSV-CHN. RT-PCR with primers SecoR1-3700F and SecoR1-5100R confirmed the presence of snLaSV-CHN in other mountain celeries (11 of 23 tested) showing chlorotic spots symptoms but not in healthy ones from the same field. To the best of our knowledge, this is the first report of snLaSV infecting mountain celery in China and a more orthodox name, mountain celery chlorotic spot virus (MCCSV), is tentatively proposed. Our findings provide a better insight of the distribution and host range of this virus and further surveys are necessary to determine its incidence and damage in mountain celery. Funding: This study is financial supported by the Program for the Scientific Activities of Selected Returned Overseas Professionals in Heilongjiang Province (Grant No. 2018QD0002) and the China National Funds for Excellent Young Scientists (Grant No. 32022071). References Son, H. J. 2020. Food Sci Nutr. 9:514. Martin, M. 2011. EMBnet J. 17:10. Che, X., et al. 2020. Plant Dis. 104: 3085. Gaafar, Y. Z. A., et al. 2020. Front Microbiol. 11: 583242.

First Report of Tomato Brown Rugose Fruit Virus Infecting the Tomato Crop in Saudi Arabia.

Tomato (Solanum lycopersicum L.) is the most economically important member of family Solanaceae and cultivated worldwide and one of the most important crops in Saudi Arabia. The aim of this study is screening of the most common viruses in Riyadh region and identified the presence of tomato brown rugose fruit virus (ToBRFV) in Saudi Arabia. In January 2021, unusual fruit and leaf symptoms were observed in several greenhouses cultivating tomatoes commercially in Riyadh Region, Saudi Arabia. Fruit symptoms showed irregular brown spots, deformation, and yellowing spots which render the fruits non-marketable, while the leaf symptoms included mottling, mosaic with dark green wrinkled and narrowing. These plants presented the symptoms similar to those described in other studies (Salem et al., 2015, Luria et al., 2017). A total 45 Symptomatic leaf samples were collected and tested serologically against suspected important tomato viruses including: tomato chlorosis virus, tomato spotted wilt virus, tomato yellow leaf curl virus, tomato chlorotic spot virus, tomato aspermy virus, tomato bushy stunt virus, tomato black ring virus, tomato ringspot virus, tomato mosaic virus, pepino mosaic virus and ToBRFV using Enzyme linked immunosorbent assay (ELISA) test (LOEWE®, Biochemica, Germany), according to the manufacturers' instructions. The obtained results showed that 84.4% (38/45) of symptomatic tomato samples were infected with at least one of the detected viruses. The obtained results showed that 55.5% (25/45) of symptomatic tomato samples were found positive to ToBRFV, three out of 25 samples (12%) were singly infected, however 22 out of 45 (48.8%) had mixed infection between ToBRFV and with at least one of tested viruses. A sample with a single infection of ToBRFV was mechanically inoculated into different host range including: Chenopodium amaranticolor, C. quinoa, C. album, C. glaucum, Nicotiana glutinosa, N. benthamiana, N. tabacum, N. occidentalis, Gomphrena globosa, Datura stramonium, Solanum lycopersicum, S. nigrum, petunia hybrida and symptoms were observed weekly and the systemic presence of the ToBRFV was confirmed by RT-PCR and partial nucleotide sequence. A Total RNA was extracted from DAS-ELISA positive samples using Thermo Scientific GeneJET Plant RNA Purification Mini Kit. Reverse transcription-Polymerase chain reaction (RT-PCR) was carried out using specific primers F-3666 (5´-ATGGTACGAACGGCGGCAG-3´) and R-4718 (5´-CAATCCTTGATGTG TTTAGCAC-3´) which amplified a fragment of 1052 bp of Open Reading Frame (ORF) encoding the RNA-dependent RNA polymerase (RdRp). (Luria et al. 2017). RT-PCR products were analyzed using 1.5 % agarose gel electrophoresis. RT-PCR products were sequenced in both directions by Macrogen Inc. Seoul, South Korea. Partial nucleotide sequences obtained from selected samples were submitted to GenBank and assigned the following accession numbers: MZ130501, MZ130502, and MZ130503. BLAST analysis of Saudi isolates of ToBRFV showed that the sequence shared nucleotide identities ranged between 98.99 % to 99.50 % among them and 98.87-99.87 % identity with ToBRFV isolates from Palestine (MK881101 and MN013187), Turkey (MK888980, MT118666, MN065184, and MT107885), United Kingdom (MN182533), Egypt (MN882030 and MN882031), Jordan (KT383474), USA (MT002973), Mexico (MK273183 and MK273190), Canada (MN549395) and Netherlands (MN882017, MN882018, MN882042, MN882023, MN882024, and MN882045). To our knowledge, this is the first report of occurrence of ToBRFV infecting tomato in Saudi Arabia which suggests its likely introduction by commercial seeds from countries reported this virus and spread in greenhouses through mechanical means. The author(s) declare no conflict of interest. Keywords: Tomato brown rugose fruit virus, tomato, ELISA, RT-PCR, Saudi Arabia

First Report of Capsicum chlorosis virus Infecting Chromolaena odorata in Yunnan, China.

Capsicum chlorosis virus (CaCV) is a negative sense ssRNA virus belonging to the genus Orthotospovirus in the family Tospoviridae. It was first discovered in Australia, and then reported in other places including Thailand, China, India, Greece, and United States (Zheng et al.2011; Melzer et al.2014; Chrysoula et al. 2018; Abudurexiti et al. 2019). CaCV infects plants of the families Amaranthaceae, Apocynaceae, Chenopodiaceae, Cucurbitaceae, Amaryllidaceae, Fabaceae and Solanaceae (Basavaraj et al. 2017; Basavaraj et al. 2020). Chromolaena odorata L. (commonly known as Feiji cao in China) is an invasive weedy herb that belongs to the genus Eupatorium (family Asteraceae), and is native to Central America. In May 2020, serrated chlorotic ring and chlorotic ringspots resembling symptoms of orthotospovirus infection (Supplementary Figure 1) was observed on the leaves of C. odorata plants in Honghe County, Yunnan. Three symptomatic leaf samples were collected and double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) was performed using antisera targeting Tomato spotted wilt virus (TSWV), Calla lily chlorotic spot virus (CCSV), Capsicum chlorosis virus (CaCV), and Tomato zonate spot virus (TZSV) (Proteintech Group, Inc., China). Buffer solution and healthy leaves were used as a blank and negative controls, respectively. All three symptomatic samples showed positive reactions with only CaCV antiserum (OD450 of 0.315-0.345 relative to 0.078 and 0.076 for healthy plants and the blank control, respectively. The total RNA extracted from the positive samples were further analyzed by reverse transcription-polymerase chain reaction (RT-PCR) using generic primers gL3637 (CCTTTAACAGTDGAAACAT) and gL4435c (CATDGCRCAAGARTGRTARACAGA) which were designed to amplify partial L segment encoding the RNA-dependent RNA polymerase (RdRP) of orthotospoviruses (Chu, et al. 2001). The expected ~800 bp DNA fragment was amplified from all three positive samples by RT-PCR. The amplified DNA was cloned and sequenced. BLAST search of the partial L RNA sequence (GenBank acc. nos. MW964378 to MW964380) revealed that they shared 86.2-97.4% nucleotide (nt) and 97.2-100% amino acid (aa) sequence identities with different isolates of CaCV available in GenBank with CaCV chili isolates (KU941834 to KU941836) from India sharing the highest aa identity of 100%. This confirmed the presence of CaCV in the symptomatic C. odorata plants. The 825 bp complete nucleocapsid protein (NP) of CaCV was also amplified from the samples using primers CaCV-F: ATGTCTAMCGTYAGGCAAC and CaCV-R: TYACACYTCWATAGAWGTACTAG) (Basavaraj et al. 2020), cloned, and sequenced to obtain complete S fragment-nucleocapsid protein (NP) with a size of 825 bp (MW964381 to MW964383). The pairwise comparisons of three fragments showed 85.1-98.3% nt and 87.6-99.6% aa sequence identities with different isolates of CaCV. Maximum-Likelihood phylogenetic trees inferred from the partial RdRP and complete NP aa sequences showed that the C. odorata isolates (CaCV-YN) clustered closely with CaCV tomato isolate from Taiwan and tomato (Yuxi-2013) isolate from China, respectively (Supplementary Figure 1). To our knowledge, this is the first time CaCV has been detected in C. odorata. This study will serve as an important reference for the study of host range of CaCV. Further studies will be required to determine whether thrips could transmit CaCV between C. odorata and other hosts of the virus.

Pepper chlorotic spot virus

This datasheet on Pepper chlorotic spot virus covers Identity, Distribution, Hosts/Species Affected, Further Information.

Temporal landscape of human gut RNA and DNA virome in SARS-CoV-2 infection and severity

BackgroundCoronavirus disease 2019 (COVID-19) caused by the enveloped RNA virus SARS-CoV-2 primarily affects the respiratory and gastrointestinal tracts. SARS-CoV-2 was isolated from fecal samples, and active viral replication was reported in human intestinal cells. The human gut also harbors an enormous amount of resident viruses (collectively known as the virome) that play a role in regulating host immunity and disease pathophysiology. Understanding gut virome perturbation that underlies SARS-CoV-2 infection and severity is an unmet need.MethodsWe enrolled 98 COVID-19 patients with varying disease severity (3 asymptomatic, 53 mild, 34 moderate, 5 severe, 3 critical) and 78 non-COVID-19 controls matched for gender and co-morbidities. All subjects had fecal specimens sampled at inclusion. Blood specimens were collected for COVID-19 patients at admission to test for inflammatory markers and white cell counts. Among COVID-19 cases, 37 (38%) patients had serial fecal samples collected 2 to 3 times per week from time of hospitalization until after discharge. Using shotgun metagenomics sequencing, we sequenced and profiled the fecal RNA and DNA virome. We investigated alterations and longitudinal dynamics of the gut virome in association with disease severity and blood parameters.ResultsPatients with COVID-19 showed underrepresentation of Pepper mild mottle virus (RNA virus) and multiple bacteriophage lineages (DNA viruses) and enrichment of environment-derived eukaryotic DNA viruses in fecal samples, compared to non-COVID-19 subjects. Such gut virome alterations persisted up to 30 days after disease resolution. Fecal virome in SARS-CoV-2 infection harbored more stress-, inflammation-, and virulence-associated gene encoding capacities including those pertaining to bacteriophage integration, DNA repair, and metabolism and virulence associated with their bacterial host. Baseline fecal abundance of 10 virus species (1 RNA virus, pepper chlorotic spot virus, and 9 DNA virus species) inversely correlated with disease COVID-19 severity. These viruses inversely correlated with blood levels of pro-inflammatory proteins, white cells, and neutrophils. Among the 10 COVID-19 severity-associated DNA virus species, 4 showed inverse correlation with age; 5 showed persistent lower abundance both during disease course and after disease resolution relative to non-COVID-19 subjects.ConclusionsBoth enteric RNA and DNA virome in COVID-19 patients were different from non-COVID-19 subjects, which persisted after disease resolution of COVID-19. Gut virome may calibrate host immunity and regulate severity to SARS-CoV-2 infection. Our observation that gut viruses inversely correlated with both severity of COVID-19 and host age may partly explain that older subjects are prone to severe and worse COVID-19 outcomes. Altogether, our data highlight the importance of human gut virome in severity and potentially therapeutics of COVID-19.DSYBHuMJfnq5gtf9T4pKWxVideo .