cDNA Expression Library Research Articles

An Eimeria maxima Antigen: Its Functions on Stimulating Th1 Cytokines and Protective Efficacy Against Coccidiosis

A consensus is that the Th1 immune response plays a predominant role against avian coccidiosis. Therefore, an antigen with the ability to induce Th1 cytokine responses is an ideal candidate for the development of coccidiosis vaccines. In our previous study, EmARM-β, a Th1 cytokines-stimulating antigen, was screened from the cDNA expression library of Eimeria maxima (E. maxima). Herein, we verified its stimulative effects on Th1 cytokine productions and evaluated its protective efficacy against E. maxima infection. Recombinant EmARM-β protein was expressed, and eukaryotic expression plasmid pVAX1-EmARM-β was also constructed for the immunization of birds. An immunofluorescence assay was performed to detect the native form of EmARM-β protein in the stage of sporozoites. Expressions of specific transcription factors and cytokines in immunized chickens were measured using qPCR and ELISA to verify its stimulating function on Th1 cytokines. Specific IgG antibody levels and T lymphocyte subpopulation in the immunized chickens were detected using ELISA and indirect flow cytometry to determine induced immune responses. The results showed that EmARM-β native protein is massively expressed in the sporozoites stage of E. maxima. Effective stimulation from the EmARM-β antigen to T-bet and Th1 cytokines (IL-2 and IFN-γ) was observed in vivo. After being immunized with rEmARM-β or pVAX1-EmARM-β, significant promotion to the proportion of CD4+ and CD8+ T cells and the level of antigen-specific IgG antibodies in immunized chickens was also observed. Furthermore, vaccination with rEmARM-β antigen or pVAX1-EmARM-β resulted in alleviated weight loss and enteric lesion, reduced oocyst output, and higher anticoccidial index (ACI) in challenged birds. These results indicate that EmARM-β antigen can effectively stimulate the expression of Th1 cytokines and initiate host immune responses, providing moderate protective efficacy against E. maxima. Notably, EmARM-β protein is a promising candidate for developing a novel anticoccidial vaccine.

De Novo assembly and annotation of the Pacific calico scallop (Argopecten ventricosus) transcriptome for immune-related gene discovery

Invertebrates' immune defense mechanisms play a critical role in pathogen recognition and elimination. De novo assembly and annotation of the Argopecten ventricosus transcriptome were performed for the immune-related gene identification. Scallops (height: 4.4 cm) were challenged with inactivated Vibrio parahaemolyticus IPNGS16. The RNA from different tissues was pooled for a single cDNA library construction sequenced by NextSeq 500 platform 2×75 paired‐end chemistry. Before de novo assembling with Trinity, reads were analyzed with FastQC, Trimmomatic, and Prinseq. Assembled sequences were analyzed by CD-HIT-EST and TransDecoder. The corresponding annotation was performed against NCBI-nr, RefSeq protein, and KAAS (KEGG) databases. The Trinity assembly yielded 107,516 contigs. TransDecoder yielded 25,285 sequences as CDSs of which, 16,123 were annotated against the NCBI-nr protein, most of them scored with Crassostrea gigas data. Gene ontology mapped sequences (15,262) were classified in molecular functions (~13,000), cellular components (~11,000), and biological processes (~13,000). The KAAS analysis showed biological categories for metabolism (13%), cellular processes (12%), genetic information processing (10%), organismal systems (19%), environmental information (13%), and human diseases (33 %). Within the organismal systems, 467 immune-related genes (KO) were identified. Sixty-four immune-related genes were annotated/blasted against the NCBI-nr and RefSeq protein databases. An RT-qPCR was performed to analyze the expression level of immune-related genes obtained in the transcriptome analysis in scallops (height 4.5 cm) treated with probiotic bacilli added to culture water. Bacilli significantly increased the expression of the HSP70 and PGRP genes. The gene transcripts analysis of A. ventricosus will better understand its immune response against pathogens in culture systems.

Ferritin Light Chain: A Candidate Autoantigen in Immuno-Related Pancytopenia.

The characteristic feature of immune-related pancytopenia (IRP) is autoantibody-mediated bone marrow (BM) damage and peripheral blood cytopenia. We found that the potential antigen of IRP was Ferritin light chain (FTL) by SEREX (serological analysis of recombinant cDNA expression libraries) in the previous study. In this study, we tried to explore the antigenic epitopes of FTL and verify its antigenicity in IRP. We found the possible FTL epitope: VNLYLQASYTYLSLG by phage random peptide library. Through ELISPOT, it was found that peptide VNLYLQASYTYLSLG can significantly stimulate the production of interleukin-4 and cannot stimulate the production of interferon-γ, which suggested that the peptide can obviously activate Th2 cells. Peptide–major histocompatibility complex tetramer elicited antigen-specific T cell responses. The expression levels of FTL were significantly increased in the patients with untreated IRP (P < 0.05). In conclusion, we found that FTL is the target antigen for some patients with IRP. The peptide of VNLYLQASYTYLSLG is an epitope of the target antigen. The target antigen is abnormally overexpressed on the membrane of BM cells, especially on the surface of CD34+ BM cells of patients with IRP. In addition, it is related to the severity of disease. These results provide a possible new target for the treatment of IRP in the future.

A new strategy based on duplex-specific nuclease and DNA aptamer with modified hairpin structure for various analytes detection

Duplex-specific nuclease (DSN) is a promising tool for bioanalysis due to its unique capability to cleave DNA within duplexes. There is prevalent use of DSN in both biomedical and life science applications including microRNA detection, cDNA library construction, and SNP recognition. The past studies and applications of DSN mainly focused on nucleic acid detection, which limits its application for broader biomedical analysis. To couple the capability of DSN with aptamer, we proposed a new sensing strategy to involve DNA aptamer sequence in the DSN based analytical system for diverse analytes detection with signal amplification and cycling. By particular design of the probe structure, the method can exhibit satisfactory performance for the detection of adenosine triphosphate, thrombin and α-fetoprotein with comparable LODs. Considering the superior sensitivity and specificity as well as the universal design, this DSN based strategy promises a great potential of developing a routine platform for quantitative and diverse biomedical analysis and clinical early diagnosis beyond microRNA detection.

NBS-LRR-WRKY genes and protease inhibitors (PIs) seem essential for cowpea resistance to root-knot nematode

Cowpea (Vigna unguiculata L. Walp) is a legume of great economic importance, however it is highly affected by nematodes. The present work aimed to identify proteins and genes involved in nematode resistance by proteomic and transcriptomic analysis. Plants of a genotype resistant (CE31) to root-knot nematode (Meloidogyne spp.) were collected 12 days after inoculation with Meloidogyne incognita and the total proteins and RNA were extracted from the root samples. Shotgun proteomic analysis was performed using an Orbitrap Elite mass spectrometer and the construction and sequencing of cDNA libraries were carried out in a Hi-Seq 2000 sequencing system. The proteomic and transcriptomic analyses revealed key processes involved in cowpea defense and some interesting candidates were further analyzed by RT-qPCR. Proteins and genes involved in essential biological processes were differentially accumulated such as, regulation of transcription, cell wall stiffening and microtubule-based process. However, the main defense strategies of Vigna unguiculata seem to be focused on the interaction of NBS-LRR and WRKY genes for the activation of R genes, production of protease inhibitors and maintenance of actin cytoskeleton. These are key processes that can culminate in the suppression of giant cell formation and consequently in the development of Meloidogyne incognita. SignificanceIn this study, we identified proteins and transcripts regulated in cowpea resistant to the nematode Meloidogyne spp. upon inoculation. The results revealed key candidate genes involved in the activation of R genes, the production of protease inhibitors and maintenance of the actin cytoskeleton. These processes might be essential for cowpea resistance, as they can impede nematode nutrition, giant cell formation and consequently the development of Meloidogyne incognita.

First Report of Blackcurrant-Associated Rhabdovirus in Blackcurrants in Latvia.

Blackcurrants (Ribes nigrum) are among the most important commercial berry crops in Latvia and, together with redcurrants and gooseberries, have a long history of local cultivation and breeding (Zuļģe et al. 2018). So far at least 20 viruses were reported to infect Ribes plants (Špak et al. 2021). Blackcurrant-associated rhabdovirus (BCaRV) was previously identified in USA by high throughput sequencing (HTS) of blackcurrant germplasm accession introduced from Russia (isolate Veloy) and now serves as an exemplar isolate for BCaRV (Wu et al. 2018). Presence of BCaRV was also confirmed by RT-PCR in blackcurrant germplasm accession of cv. Burga from France during the same study by Wu et al. (2018). Currently Blackcurrant betanucleorhabdovirus is one of the nine species recognized by ICTV in genus Betanucleorhabdovirus of family Rhabdoviridae, but the impact of BCaRV on the host still remains unknown. Leaf tissue from twelve asymptomatic blackcurrant cv. Mara Eglite plants that negatively tested for blackcurrant reversion virus from Dobele, Latvia (56°36'31.9"N, 23°18'13.6"E) was collected on May 17, 2019 and used for HTS study of local Ribes resistance genes. Total RNA from the leaf tissue of sampled plants was isolated following a method described by Kalinowska et al. (2012) with minor modifications. Briefly, RNeasy Plant Mini Kit (QIAGEN) was used with RLC lysis buffer being supplemented with 2% PVP and 1% β-mercaptoethanol. Plant rRNA was subsequently removed by a RiboMinus Plant Kit for RNA-Seq (Thermo Fisher Scientific (TFS)) prior to cDNA library construction. HTS libraries were prepared using MGIEasy RNA Directional Library Prep Set for 16 reactions (MGI), following a protocol for 150 bp pair-end reads. According to the manufacturers guidelines libraries were pooled, circularized and cleaned before being subjected to sequencing on DNBSEQ-G400 (MGI) using PE150 flow cell (MGI). The sequencing run yielded a total of 393660492 150 bp long read pairs. Reads were assembled into transcripts using rnaSPAdes v 3.13.1 (Bushmanova et al. 2019) and a 14424 base long contig with an average coverage of 684x was found to be 99.5% identical (14358/14432 identities and 8 gaps in the pairwise alignment) to the previously reported first complete genome of BCaRV (MF543022.1) using EMBOSS Needle (Madeira et al., 2019). This contig representing the genome of BCaRV isolate Mara Eglite, onto which 66768 of the raw reads could be mapped, was subsequently deposited at European Nucleotide Archive under accession number OU015520. All of the twelve individual samples were also tested for the presence of BCaRV by RT-PCR, using Verso cDNA Synthesis Kit with random hexamer primers (TFS) for first strand cDNA synthesis followed by PCR with N protein nested primers BCaRV-N-F (5' AGATGTGCTTCATCGATGGCTAGTTCTGCT 3') and BCaRV-N-R (5' TGCATTCCCACGGGTTAGGAATACATTGGTACT 3') resulting in a 243 bp long fragment for six of the samples. RT-PCR products from six BCaRV positive samples were directly sequenced by Sanger-based method using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) with BCaRV-N-F and BCaRV-N-R primers. Acquired RT-PCR product sequences matched the corresponding region of BCaRV isolate Mara Eglite genome assembled from HTS data. In this report, we have documented the natural occurrence of BCaRV in Latvia, which makes it a second evidence on the presence of BCaRV in Europe.

Discovery of Targets for Cancer Immunoprevention.

Antibodies against autologous tumor-associated antigens have been demonstrated as being useful biomarkers for early cancer diagnosis and prognosis. They have several advantages such as long half-life (7-30days depending on subtiter of Ig), inherent stability in patients' blood due to not being subjected to proteolysis, well-studied biochemical properties, and their easy detections via secondary antibodies or antigens. Moreover, they can be easily screened in the serum using a noninvasive approach. Consequently, many technical approaches have been developed to study autoantibodies. We used serological proteome analysis (SERPA) for analyzing antibodies in pancreatic cancer patients' sera, and the technique will be discussed in detail. SERPA has several advantages over other approaches currently used such as SEREX (serological analysis of tumor antigens by recombinant cDNA expression cloning) and phage display. SEREX involves the construction of a lambda phage cDNA library from tumor samples to infect bacteria. While library construction is a quite laborious and time-consuming procedure in SEREX, detection of posttranslational modifications that could be fundamental for antibody recognition is a major limitation of both SEREX and phage display techniques. SERPA avoids the time-consuming construction of cDNA libraries. In addition, since it does not rely on bacterial expression of antigens, antigens will have their usual posttranslational modifications preventing false-positive or -negative results in autoantibody profiling.

Screening Tumor-Related Genes of Gallbladder Cancer Based on AR-Based Tumor Expression Profile Gene Chip.

The rapid development of molecular biology and gene chip technology has produced a large amount of gene expression profile data. The main research in this article is to screen the tumor-related genes of gallbladder cancer based on AR-based tumor expression profile gene chip. First, convert the chip data into an expression matrix pattern that can be analyzed, and then standardize and normalize all the data. Run ReliefF, GA, and IReliefF-GA on the data set, record the size of the feature subset, and use the tenfold cross-validation method to obtain the classification accuracy, specificity, and sensitivity of each method on the classifier. The target genes used in the chip were amplified by PCR with the universal primers used in cDNA library construction, and the quality of PCR was monitored by agarose gel electrophoresis. The gene chip data of gallbladder cancer was processed with missing values, singular values, and so forth, and 22294 transcripts were obtained. After statistical testing, there were 9483 transcripts with statistically significant differences. The results show that as the number of clusters increases, the network can be better reconstructed through decomposition modeling.

Construction and Analysis of a Yeast cDNA Library from &lt;i&gt;Medicago truncatula&lt;/i&gt;

Yeast two-hybrid and one-hybrid technologies are an efficient molecular biology technique for screening protein interactions or protein and DNA interactions, and are an important means for the interaction and regulation of biological macromolecules.&nbsp;In order to&nbsp;obtain a&nbsp;high-capacity &nbsp;Medicago truncatula&nbsp; gene library, it provides a basis for further digging the related genes of&nbsp; Medicago truncatula&nbsp; and improving the quality of&nbsp; Medicago truncatula . In&nbsp;this study,&nbsp; Medicago truncatula &nbsp;from different tissue sources was selected, and different hormone induction or stress treatments were performed on&nbsp; Medicago truncatula , using SMART technology to successfully construct a high-capacity&nbsp; Medicago truncatula &nbsp;yeast hybrid cDNA library.&nbsp;The library quality test results showed that the library titration number was 5&times;10 7 &nbsp;CFU/mL, the library capacity was 1.28&times;10 7 &nbsp;CFU, and the average insert fragment length was greater than 1&nbsp;000&nbsp;bp. All 24 clones were able to amplify bands, and the cDNA fragment recombination rate was 100%.&nbsp;The library has high quality and complete genetic information, which meets the requirements of yeast hybrid screening test, and can be applied to the research of gene expression regulation of&nbsp; Medicago truncatula&nbsp; and the screening test of interaction protein.

First Report of Papaya ring spot virus (PRSV) Infecting Jute (Corchorus olitorius) in India.

Jute is the most important bast fibre crop of the world, which is mainly cultivated in India, Nepal, Bangladesh, China, Indonesia and South American countries. The fibre is utilized for making apparels, ropes, bags, carpets etc (Biswas et al. 2014). This bio-fibre is gaining importance due to growing environmental consciousness worldwide. In June 2019, we noticed jute plants (less than 2%) showing virus like symptoms viz., downward curling, puckering, angular brownish to yellowish spots etc in a farmer's field at Amdanga Block, North 24 Paraganas, West Bengal, India. To identify the virus, five symptomatic leaves from five different plants were used for high throughput sequencing (HTS). We extracted total RNA from each leaf which was subjected to construction of cDNA libraries. Sequencing was done on Illumina Hiseq 4000 (CytoScan, Thermo Fisher). Approximately 46 million 105 nt paired end reads were generated. Raw reads were trimmed and filtered to perform de novo assembly as described previously by (Grabherr et al. 2013). The obtained contig was 10,326 bp nucleotides (nt) long and in BLASTn against GenBank showed highest identity with papaya ring spot virus (PRSV) with the contig covering 99.6% of the viral genome. The obtained contig shared 99.33% sequence similarity with PRSV strain P (Accession No. MT470188). The selected leaf samples were also tested by double-antibody sandwich (DAS)- enzyme linked immunosorbent assay (ELISA) for papaya ring spot virus (PRSV) along with some common viruses, viz., Potato leaf roll virus (PLRV), Watermelon mosaic virus, Cowpea mosaic virus and Cucumber mosaic virus with the help of commercial diagnostic kits (Agdia). However, only the test with PRSV gave positive reaction for the symptomatic samples. The major symptoms of PRSV on papaya are severe mosaic, chlorosis, reduced lamina with curling and puckering (Gonsalves et al. 2010). To confirm PRSV infection, five symptomatic leaf samples (used for HTS) were collected and whole RNA was extracted from the samples using RNeasy plant minikit (Qiagen, USA). Reverse transcriptase polymerase chain reaction (RT-PCR) was conducted by using isolated RNA. One pair of PRSV specific primer (PSRV1F: 5' TTAAATCTGATTCGTC 3' PRSV 1R: 5'GAAATTCACGCAAAGTCGA3') was developed by using primer BLAST software and was used in RT-PCR assays. Amplified fragments were cloned and sequenced and all the fragments shared 98% sequence identity with PRSV. One of the amplicons was deposited in NCBI (Accession No. MN615832). Crude sap was prepared by homogenizing PRSV-infected jute leaf tissues in 0.1 M sodium phosphate buffer and 2% carborundum dust was added as abrasive (Holkar et al. 2018). The sap was then gently rubbed on to the healthy papaya leaves for inoculation. Typical PRSV like symptoms appeared in inoculated leaves 10 days post inoculation which confirmed the presence of PRSV-P. PRSV was detected by RT-PCR as well as (DAS)-ELISA from all inoculated infected papaya leaf tissues, but could not be detected from uninoculated healthy papaya tissues. To the best of our knowledge, this is the first report of PRSV-P infecting jute in India.

Omnipresence of Partitiviruses in Rice Aggregate Sheath Spot Symptom-Associated Fungal Isolates from Paddies in Thailand.

Partitiviruses are one of the most prevalent double-stranded RNA viruses that have been identified mostly in filamentous fungi and plants. Partitiviruses generally infect host fungi asymptomatically but infrequently exert significant effect(s) on morphology and virulence, thus being considered a potential source of biological control agents against pathogenic fungi. In this study, we performed a screening for mycoviruses of a collection of Thai isolates of rice fungal pathogen Rhizoctonia oryzae-sativae, a causal agent of rice aggregated sheath spot disease. As a result, 36% of tested isolates carried potentially viral double-stranded RNAs with sizes ranging from 2 to 3 kbp. By conventional cDNA library construction and RNA-seq, we determined six new alphapartitiviruses that infected three isolates: tentatively named Rhizoctonia oryzae-sativae partitivirus 1 to 6 (RosPV1-6). Furthermore, RT-PCR detection of each virus revealed their omnipresent nature in different R. oryzae-sativae isolates. Although virus-curing of basidiomycetous fungi is generally difficult, our repeated attempts successfully obtained virus-free (for RosPV1, RosPV2, and uncharacterized partitiviruses), isogenic strain of R. oryzae-sativae TSS190442. The virus-cured strain showed slightly faster colony growth on the synthetic media and severe symptom development on the rice sheath compared to its virus-infected counterpart. Overall, this study shed light on the distribution of partitiviruses in R. oryzae-sativae in a paddy environment and exemplified a virus-curing protocol that may be applicable for other basidiomycetous fungi.

Construction of yeast two-hybrid cDNA library induced by &amp;lt;italic&amp;gt;Ralstonia solanacearum&amp;lt;/italic&amp;gt; and interaction protein screening for AhRRS5 in peanut

Construction of yeast two-hybrid cDNA library induced by &amp;lt;italic&amp;gt;Ralstonia solanacearum&amp;lt;/italic&amp;gt; and interaction protein screening for AhRRS5 in peanut

Anti-osteosarcoma effect of antiserum against cross antigen TPD52 between osteosarcoma and Trichinella spiralis

BackgroundTrichinella spiralis (T. spiralis) is a parasite occurring worldwide that has been proven to have antitumour ability. However, studies on the antitumour effects of cross antigens between the tumour and T. spiralis or antibodies against cross antigens between tumours and T. spiralis are rare.MethodsTo study the role of cross antigens between osteosarcoma and T. spiralis, we first screened the cDNA expression library of T. spiralis muscle larvae to obtain the cross antigen gene tumour protein D52 (TPD52), and prepared fusion protein TPD52 and its antiserum. The anti-osteosarcoma effect of the anti-TPD52 antiserum was studied using cell proliferation and cytotoxicity assays as well as in vivo animal models; preliminary data on the mechanism were obtained using western blot and immunohistochemistry analyses.ResultsOur results indicated that TPD52 was mainly localized in the cytoplasm of MG-63 cells. Anti-TPD52 antiserum inhibited the proliferation of MG-63 cells and the growth of osteosarcoma in a dose-dependent manner. The tumour inhibition rate in the 100 μg treatment group was 61.95%. Enzyme-linked immunosorbent assay showed that injection of anti-TPD52 antiserum increased the serum levels of IFN-γ, TNF-α, and IL-12 in nude mice. Haematoxylin and eosin staining showed that anti-TPD52 antiserum did not cause significant pathological damage. Apoptosis of osteosarcoma cells was induced by anti-TPD52 antiserum in vivo and in vitro.ConclusionsAnti-TPD52 antiserum exerts an anti-osteosarcoma effect by inducing apoptosis without causing histopathological damage.Graphical abstract

Abstract 2424: Screen for actionable ERBB3 mutations

Abstract Activating mutations and copy number variations in ERBB genes have been identified in several cancer types, and a number of cancer drugs targeting ERBB receptors have been approved for clinical use. These drugs include monoclonal antibodies (mAb) that selectively target either EGFR (ERBB1) or ERBB2 (HER2), and tyrosine kinase inhibitors (TKI) that block the kinase activity of all three kinase-competent ERBBs, i. e. EGFR, ERBB2, and ERBB4. ERBB3 is a unique member of the ERBB family in that it does not possess potent intrinsic kinase activity, and thus cannot be directly targeted with TKIs. However, it is still able to dimerize and activate the other three ERBB family members, and as a result, critically mediate oncogenic signaling as a member of heterodimeric complexes, such as the ERBB2/ERBB3 heterodimer. Thus, changes in ERBB3 structure and function may still affect responsiveness of cancer cells to ERBB TKIs. Moreover, several mAbs directly targeting ERBB3 in cancer are currently in preclinical and clinical development. To address whether ERBB3 mutations can affect the potential of ERBB3 to promote growth or affect sensitivity to ERBB inhibitors, we set up a screen for functional effects of all possible random ERBB3 missense or nonsense mutations in the context of ERBB2/ERBB3 heterodimers. To this end, the iSCREAM (in vitro screen of activating mutations) model of somatic evolution, recently developed in our laboratory, was chosen. This platform exploits randomly mutated cDNA libraries of the gene of interest created with error-prone PCR and allows the assessment of growth-advantage conferred by thousands of mutations in parallel. To set up the model for ERBB3 mutation screen, interleukin-3 (IL-3)-dependent Ba/F3 cells were engineered to express a homodimerization-incompetent ERBB2 V956R mutant together with ERBB3 constructs. The model was validated to serve as a readout for ERBB3's ability in activating ERBB2 kinase by demonstrating that cells expressing the two known transforming ERBB3 mutations, E928G and G284R, together with ERBB2 V956R survived and expanded in the absence of IL-3. However, control cells expressing ERBB2 V956R together with wild-type ERBB3 rapidly died in the absence of IL-3. The cell background with ERBB2 V956R expression will subsequently be used as a target for retroviral expression of cDNA library of randomly mutated ERBB constructs. After infection, the cell clones with activating ERBB3 mutations will be allowed to evolve and the activating mutations will be identified by ERBB3-targeted next generation sequencing. The goal is to identify activating ERBB3 mutations that are directly actionable or that provide predictive value for the use of drugs targeting ERBB signaling. Citation Format: Marika K. Koivu, Deepankar Chakroborty, Kari J. Kurppa, Klaus Elenius. Screen for actionable ERBB3 mutations [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2021; 2021 Apr 10-15 and May 17-21. Philadelphia (PA): AACR; Cancer Res 2021;81(13_Suppl):Abstract nr 2424.

First report of watermelon crinkle leaf-associated virus 1 (WCLaV-1) and WCLaV-2 infecting watermelon (Citrullus lanatus) in the United States.

Watermelon (Citrullus lanatus) and other cucurbits are cultivated globally, and Texas ranks among its top 5 producers in the U.S. In July 2020, plants with virus-like disease symptoms consisting of mild leaf crinkling and yellow mosaic patterns were observed in a 174-ha watermelon field in Burleson Co., TX; disease incidence was visually estimated at 5%. Total nucleic acids were extracted from leaf tissues of 5 randomly sampled plants (Dellaporta 1983) and their equimolar amounts were made into a composite sample that was used for cDNA library construction with TruSeq Stranded Total RNA with Ribo-Zero Plant Kit (Illumina). The cDNA library was sequenced on the Illumina NextSeq 500 platform, generating ~37M single-end reads (each 75 nt), which were analyzed as per Al Rwahnih et al. (2018). Of these, 58,200 and 27,500 reads mapped to the genomes of watermelon crinkle leaf-associated virus 1 (WCLaV-1) and WCLaV-2 (Xin et al. 2017), respectively, along with 4 other virus-specific reads (data not shown). The near complete RNA1-RNA3 segments of WCLaV-1 (354-652X) and WCLaV-2 (144-258X) were generated from the mapped reads and they shared ≥96% nt identities with published RNA segments of both viruses. The results were verified by RT-PCR using newly designed primers WCLaV-1vRP: 5'-GGTGAGTTAGTGTGTCTGAAGG/WCLaV-1cRP: 5'-GAGGTTGCCTGAGGTGATAAG to target 881 bp of the RNA1-encoded RNA-dependent RNA polymerase (RdRP), WCLaV-1vMP: 5'-GAAGGTTTGCTCCCTTGAAATG/WCLaV-1cMP: 5'-GACTGTGGCTGAAGAGTCTATG target 538 bp of the RNA2-encoded movement protein (MP), and WCLaV-1vNP: 5'-CGAATAGACTCTGGAGGGTAGA/WCLaV-1cMP: 5'-GAAAGCAAGAAAGCTGGCTAAA target 786 bp of the RNA3-encoded nucleoprotein (NP). Similarly, the WWCLaV-2-specific primers WCLaV-2vRP: 5'-GTCTCACATTCCTGCACTAACT/WCLaV-2cRP: 5'-ATCGGTCCTGGGTTATTTGTATC target 968 bp of the RdRP, WCLaV-2vMP: 5'-GACTTCAGAACCTCAACATCCA/WCLaV-2cMP: 5'-CAAGGGAGAGTGCTGACAAA target 562 bp of the MP, and WCLaV-2vNP: 5'-ATTCCCAGTGAGAGCAACAA/WCLaV-2cMP: 5'-GAGGTGGAGGTAGGAAAGAAAG target 449 bp of the NP. Fresh cDNA synthesized from the 5 samples with PrimeScript First Strand cDNA synthesis kit (Takara Bio) were tested by PCR with all 6 primer pairs using the PrimeSTAR GXL DNA Polymerase kit (Takara Bio). Three of the 5 samples were positive for both viruses and one sample was positive for each virus. The obtained products from 4 samples were cloned individually into pJET1.2/Blunt vector (Thermo Scientific, USA), followed by bidirectional Sanger-sequencing of the plasmids with the GenElute Five-Minute Plasmid Miniprep kit (Sigma-Aldrich). In pairwise comparisons, the partial RNA1-RNA3 sequences of WCLaV-1 (GenBank accession nos. MW559074-82) shared 100% nt/aa identities with each other and with corresponding sequences of WCLaV-1 isolate KF-1 from China (KY781184-86). The partial RNA1-RNA3 sequences of WCLaV-2 (MW559083-91) shared 97-100% nt/96-100% aa identities with each other and with corresponding sequences of WCLaV-2 isolate KF-15 from China (KY781187-89). This is the first report of WCLaV-1 and WCLaV-2 in Texas and the first record of both viruses in the U.S. and elsewhere outside of China. Both negative-sense, single-stranded RNA viruses represent a novel taxon in the family Phenuiviridae (order Bunyavirales) (Xin et al. 2017). While aspects of the biology of both viruses are yet to be elucidated, our results expand their geographical range. The detection primers developed here will be useful for screening cucurbits germplasm to avert their spread.

Serum anti-DIDO1, anti-CPSF2, and anti-FOXJ2 antibodies as predictive risk markers for acute ischemic stroke

BackgroundAcute ischemic stroke (AIS) is a serious cause of mortality and disability. AIS is a serious cause of mortality and disability. Early diagnosis of atherosclerosis, which is the major cause of AIS, allows therapeutic intervention before the onset, leading to prevention of AIS.MethodsSerological identification by cDNA expression cDNA libraries and the protein array method were used for the screening of antigens recognized by serum IgG antibodies in patients with atherosclerosis. Recombinant proteins or synthetic peptides derived from candidate antigens were used as antigens to compare serum IgG levels between healthy donors (HDs) and patients with atherosclerosis-related disease using the amplified luminescent proximity homogeneous assay-linked immunosorbent assay.ResultsThe first screening using the protein array method identified death-inducer obliterator 1 (DIDO1), forkhead box J2 (FOXJ2), and cleavage and polyadenylation specificity factor (CPSF2) as the target antigens of serum IgG antibodies in patients with AIS. Then, we prepared various antigens including glutathione S-transferase-fused DIDO1 protein as well as peptides of the amino acids 297–311 of DIDO1, 426–440 of FOXJ2, and 607–621 of CPSF2 to examine serum antibody levels. Compared with HDs, a significant increase in antibody levels of the DIDO1 protein and peptide in patients with AIS, transient ischemic attack (TIA), and chronic kidney disease (CKD) but not in those with acute myocardial infarction and diabetes mellitus (DM). Serum anti-FOXJ2 antibody levels were elevated in most patients with atherosclerosis-related diseases, whereas serum anti-CPSF2 antibody levels were associated with AIS, TIA, and DM. Receiver operating characteristic curves showed that serum DIDO1 antibody levels were highly associated with CKD, and correlation analysis revealed that serum anti-FOXJ2 antibody levels were associated with hypertension. A prospective case–control study on ischemic stroke verified that the serum antibody levels of the DIDO1 protein and DIDO1, FOXJ2, and CPSF2 peptides showed significantly higher odds ratios with a risk of AIS in patients with the highest quartile than in those with the lowest quartile, indicating that these antibody markers are useful as risk factors for AIS.ConclusionsSerum antibody levels of DIDO1, FOXJ2, and CPSF2 are useful in predicting the onset of atherosclerosis-related AIS caused by kidney failure, hypertension, and DM, respectively.

Small RNA-Sequencing: Approaches and Considerations for miRNA Analysis.

MicroRNAs (miRNAs) are a class of small RNA molecules that have an important regulatory role in multiple physiological and pathological processes. Their disease-specific profiles and presence in biofluids are properties that enable miRNAs to be employed as non-invasive biomarkers. In the past decades, several methods have been developed for miRNA analysis, including small RNA sequencing (RNA-seq). Small RNA-seq enables genome-wide profiling and analysis of known, as well as novel, miRNA variants. Moreover, its high sensitivity allows for profiling of low input samples such as liquid biopsies, which have now found applications in diagnostics and prognostics. Still, due to technical bias and the limited ability to capture the true miRNA representation, its potential remains unfulfilled. The introduction of many new small RNA-seq approaches that tried to minimize this bias, has led to the existence of the many small RNA-seq protocols seen today. Here, we review all current approaches to cDNA library construction used during the small RNA-seq workflow, with particular focus on their implementation in commercially available protocols. We provide an overview of each protocol and discuss their applicability. We also review recent benchmarking studies comparing each protocol’s performance and summarize the major conclusions that can be gathered from their usage. The result documents variable performance of the protocols and highlights their different applications in miRNA research. Taken together, our review provides a comprehensive overview of all the current small RNA-seq approaches, summarizes their strengths and weaknesses, and provides guidelines for their applications in miRNA research.

Cadmium hyperaccumulating mushroom Cystoderma carcharias has two metallothionein isoforms usable for cadmium and copper storage

Cystoderma carcharias is one of the few macrofungal species that can hyperaccumulate Cd. As we have previously documented in C. carcharias collected from a smelter-polluted area, it stores 40% of Cd and nearly 90% of Cu in sporocarps in complex(es) of identical size. In this paper we examined whether metallothionein (MT) peptides that bind Cd and Cu through cysteinyl-thiolate bonds were associated with the metals in these complexes. Screening of a sporocarp cDNA expression library in yeasts allowed the identification of two transcripts, CcMT1 and CcMT2, encoding functional 34-amino acid (AA) MTs sharing 56% identity and appearing to be encoded by duplicate genes. CcMT1 conferred reasonable tolerance to Cu and a substantially higher tolerance to Cd than CcMT2, while CcMT2 clearly protected the yeasts better against Cu toxicity. While size-exclusion chromatography revealed that CcMT1 was contained in all Cd/Cu complexes isolated from wild grown sporocarps, CcMT2 was detected in a much narrower subset of the fractions. The striking difference between the CcMTs is that CcMT1 lacks the third metal-biding cysteinyl (C) within an otherwise highly conserved-in-agaricomycetes-MTs C-AA4-C-AA-C-AA3-C-AA-C-AA4-C-AA-C motif. The elimination of the corresponding cysteinyl in CcMT2 only reduced the Cu-tolerant phenotype in yeasts to the levels observed with CcMT1. Altogether, these results indicate that CcMT2 is rather adjusted to perform Cu-related tasks and point to CcMT1 as the ligand for the storage of both Cd and Cu in C.carcharias, which is the first macrofungal species in which the potential of MT in Cd handling can be seen.

Sequence and Properties of Cagein, a Coiled-Coil Scaffold Protein Linking Basal Bodies in the Polykinetids of the Ciliate Euplotes aediculatus.

In the hypotrich ciliate Euplotes, many individual basal bodies are grouped together in tightly packed clusters, forming ventral polykinetids. These groups of basal bodies (which produce compound ciliary organelles such as cirri and oral membranelles) are cross-linked into ordered arrays by scaffold structures known as "basal-body cages." The major protein comprising Euplotes cages has been previously identified and termed "cagein." Screening a E.aediculatus cDNA expression library with anti-cagein antisera identified a DNA insert containing most of a putative cagein gene; standard PCR techniques were used to complete the sequence. Probes designed from this gene identified a macronuclear "nanochromosome" of ca. 1.5kb in Southern blots against whole-cell DNA. The protein derived from this sequence (463 residues) is predicted to be hydrophilic and highly charged; however, the native cage structures are highly resistant to salt/detergent extraction. This insolubility could be explained by the coiled-coil regions predicted to extend over much of the length of the derived cagein polypeptide. One frameshift sequence is found within the gene, as well as a short intron. BLAST searches find many ciliates with evident homologues to cagein within their derived genomic sequences.

Novel serum autoantibodies against ß-actin (ACTB) in amyotrophic lateral sclerosis

To identify novel biomarkers using the serological analysis of recombinant cDNA expression libraries (SEREX) method and to evaluate their clinical significance in amyotrophic lateral sclerosis (ALS). Serum of ALS patients were screened for autoantibodies using the SEREX method. The identified autoantibodies were validated by measuring their serum levels in 70 ALS patients, 60 normal controls (NC), and 62 Parkinson disease (PD) patients using the amplified luminescent proximity homogeneous assay-linked immunosorbent assay (AlphaLISA). The clinical relevance of these autoantibodies was investigated in ALS patients. SEREX identified 16 candidate antigens including β-actin (ACTB) in addition to proteasome subunit alpha type 7 (PSMA7) that we previously reported, and serum levels of antibodies against ACTB, were significantly higher in ALS patients than in NC (p < 0.001) and PD patients (p = 0.001). Moreover, serum levels of anti-ACTB antibody were higher in advanced stage ALS patients (Stage 4 on the King’s ALS clinical staging) and in those with more severe disability (ALS Functional Rating Scale revised [ALSFRS-R] score < 40.5) compared to early stage (Stage 2 [2nd region involved)]) patients and those with less severe disability (ALSFRS-R score ≥ 40.5) (p = 0.003, p = 0.014). Anti-ACTB antibody levels were also negatively correlated with ALSFRS-R score (ρ = −0.409, p = 0.001), but positively correlated with clinical disease stage (ρ = 0.355, p = 0.003), and showed a weak positive correlation with disease duration (ρ = 0.294, p = 0.014). Anti-ACTB antibodies may be a potential biomarker of ALS could indicate disease severity.