Brugmansia Suaveolens Research Articles

Evaluating the influence of extraction method on phytochemical profile, in vitro biological activity, and in silico validation of Brugmansia suaveolens

Evaluating the influence of extraction method on phytochemical profile, in vitro biological activity, and in silico validation of Brugmansia suaveolens

EVALUATION OF ANALGESIC PROPERTY OF BIOSYNTHESIZED AGNPS USING LEAF METHANOL EXTRACT OF Brugmansia suaveolens

The plant Brugmansia suaveolens (Bercht. & Presl) belongs to the family Solanaceae and is endemic to the Malnad region (Shimoga) of the Western Ghats. Traditionally leaf extract has been applied externally to treat cut wounds, pain-killer swellings, scalds, inflammations, skin rashes, and hemorrhoids. The objective is to synthesize silver nanoparticles (AgNPs) conjugated Leaf methanol extract of B. suaveolens analyzed and characterized based on multiple (X-ray diffraction (XRD); Scanning electron microscopy (SEM); Fourier transform infrared (FTIR) spectroscopy and ultraviolet–visible (UV–Vis) spectroscopy) analytical methods. After characterization, the analgesic activity of extract bio-synthesized with silver nanoparticles was evaluated and compared with different concentrations of leaf methanol extract alone. Analgesic activity was examined by writhing and tail-flick testing. Reduction in the writhing and tail withdrawal time after administration of 250 mg/kg b.w./d of leaf methanol extract bio-synthesized with silver nanoparticle is more significant than 250, 500, and 750 mg/kg b.w./d extracts alone and is slightly less significant when compared to the standard drug. This has proved that the bio-synthesized silver nanoparticles may have played a fundamental role as drug delivery vehicles to target tissues more conveniently and efficiently compared to nascent extract.

Preliminary Phytochemical Analysis of Brugmansia suaveolens and Study of its Antimicrobial Activities

Abstract: Brugmansia suaveolens (family:solanaceae) is a medicinal semi-woody shrub which is known as angel's tears and snowy angel's trumpet. Every part of Brugmansia suaveolens is poisonous as well as exhibit curative activity against several ailments like headache, reduce inflammatory swellings of joints in rheumatic attacks etc. In the present study, the bioactive compounds present in the flower of Brugmansia suaveolens were investigated for antimicrobial activity against some pathogenic bacteria (Staphylococcus aureus, Escherichia coli) and fungus(Penicillium atramentosum).dried flower samples were used to obtain various extracts viz.Chloroform, Acetone,Ethanol, and water. The phytochemical analyses showed the presence of phenol, steroids, saponins, Tannins flavonoids glycosides terpenoids alkaloids phlabatannins extracts used in this study.under the well diffusion method had a considerable antimicrobial activities increased with higher concentration. The Ethanol extract from dry flower Brugmansia suaveolens shows more effective against Escherichia coli, The Chloroform extract from dry flower Brugmansia suaveolens shows more effective against Staphylococcus aureus. In case of fungi Chloroform extract from dry flower Brugmansia suaveolens showed the highest inhibition zone against Penicillium atramentosum.

SEQUESTRATION OF TROPANE ALKALOIDS FROM <i>Brugmansia suaveolens</i> (SOLANACEAE): NEW RECORDS FOR ORTHOPTERA AND COLEOPTERA

Tropane alkaloids (TAs) are the main secondary metabolites found in Datureae (Solanaceae). These compounds are neurotoxic to many organisms. However, some insect species can sequester and accumulate TAs in their bodies. Brugmansia suaveolens (Humb. and Bonpl. ex Willd.) Bercht. and J.Presl, a Neotropical shrub, is known to produce TAs. In this study, we report the sequestration of TAs from B. suaveolens by Chromacris speciosa (Thunberg, 1824) (Orthoptera: Rhomaleidae) and Lema daturaphila Kogan & Goeden (Coleoptera: Chrysomelidae). Both of these insects have been observed feeding on leaves from various species of Solanaceae in the study site. We analyzed extracts from insects and the host plant using gas chromatography and mass spectrometry (GC-MS). In B. suaveolens, we identified five TAs, while in the insect bodies, we found four. Scopolamine was the most abundant alkaloid in all the samples. This is the first report of TAs in these insects. While TAS may play a role in defense against generalist herbivores, further investigation is needed to understand the association between TAs and predators since both insects exhibit moderately aposematic features

Therapeutic Potential of Bioactive Compounds from Brugmansia suaveolens Bercht. & J. Presl.

Brugmansia suaveolens Bercht. & J. Presl has been widely used due to the presence of different bioactive compounds. This review summarizes the latest advances and perspectives of the B. suaveolens plant species; it is a systematic literature review on aspects of botany, traditional uses, phytochemistry, pharmacology, and toxicology as therapeutic potential. In addition, 120 compounds are described, including alkaloids, flavonoids, terpenoids, steroids, amino acids, aromatics, and aliphatics. As for the therapeutic potential, it is described in extracts and compounds in the antitumor, anti-inflammatory, antioxidant, antimicrobial, antispasmodic, anticoagulant, and analgesic aspects, as well as the effects on the central nervous system. The toxicity of the genus stands out, especially the potential for organ toxicity. Therefore, this review evidenced the knowledge related to the traditional use based on the scientific research of Brugmansia suaveolens, highlighting an overview of bioactive compounds and biological and toxicological activities in order to provide a scientific basis for future studies on the value of this species for the development of new natural products.

Methyl benzoate and nerolidol attract the cyclocephaline beetle Cyclocephala paraguayensis to trumpet flowers

Cyclocephaline beetles are flower visitors attracted primarily by major floral volatiles. Addressing the identity of these volatile compounds is pivotal for understanding the evolution of plant-beetle interactions. We report the identification and field testing of the attractant volatiles from trumpet flowers,Brugmansia suaveolens(Willd.) Sweet (Solanaceae), for the beetleCyclocephala paraguayensisArrow (Melolonthidae: Dynastinae). Analysis of headspace floral volatiles revealed 19 compounds, from which eucalyptol (57%), methyl benzoate (16%), and β-myrcene (6%) were present in the largest amounts, whereas E-nerolidol in much lesser amounts (1.8%). During a first-field assay, traps baited with Mebe alone or blended with the other two major compounds attracted more beetles than myrcene and eucalyptol alone, which did not differ from the negative controls. In a second assay, Mebe and nerolidol attracted more beetles as a blend than individually. Nerolidol was more attractive than Mebe, and all treatments attracted more beetles than negative controls. The number of attracted beetles in the Mebe-nerolidol blend was greater than the combined sum of beetles attracted to these compounds alone, suggesting a synergistic interaction.The attraction ofC. paraguayensisby trumpet-flower volatiles supports the beetle's extended preference for sphingophilous plants, especially when cantharophilous (beetle-pollinated) flowers are lacking. This phenomenon, thus, might have contributed to the widespread occurrence of this beetle throughout the Brazilian biomes.

The assistance of Pesanggem in the Prevention of Coffee Pests through Vegetable Pesticides Coffee from Amethyst Mountain (Brugmansia Suaveolens Bercht. & J. Presl) at Taman Kehati Sapen Nusantara Mount Arjuno Pasuruan

Pesanggem Taman Kehati Sapen Nusantara (TKSN) is a farming community in the Sapen Forest Area of ​​Mount Arjuno, Pasuruan. Coffee agroforestry is the main commodity for forest farmers in the TKSN area. For pest prevention, they have been using chemical pesticides to prevent the Coffee Fruit Borer. Through the Community Based Research approach, the companion team together with the community have succeeded in innovating vegetable pesticides coffee by utilizing Brugmansia Suaveolens Bercht. & J. Presl and Swietenia macrophylla King. as the main ingredients that are easily found in Taman Kehati Sapen Nusantara into environmentally friendly coffee pesticide products.

In vitro production of tropane alkaloids from Brugmansia suaveolens

For thousands of years, secondary metabolites have been utilized as medications, flavors, pesticides, and dyes. For the generation of valuable secondary metabolites, in vitro plant culture techniques have been viewed as beneficial alternatives to whole plants. Brugmansia suaveolens is an ornamental plant including anticholinergic agents which are employed in medicine. Callus induction was performed from leaf and internode explants cultured on Murashige and Skoog’s medium supplemented with different concentrations and combinations of plant growth regulators (PGRs) with 6 treatments. The highest callus induction response was obtained from the leaf-originated explants (73%) on the medium supplemented with 0.4 mg/L KIN and 0.2 mg/L NAA which produced friable callus in 4 weeks. The cell suspension culture of B. suaveolens was established in shake flasks using friable calli. The extraction protocol of tropane alkaloids was optimized, atropine and scopolamine were obtained efficiently. The data could provide technical support for the large-scale production of valuable alkaloids of B. suaveolens in vitro systems with improved strategies.

Brugmansia suaveolens as a New Host for Root-Knot Nematode, Meloidogyne incognita, in Goiás State, Brazil.

Brugmansia suaveolens (Humb. and Bonpl. ex Willd.) Bercht. and J. Presl, also called White Angel's Trumpet is an ornamental plant known, for its medicinal properties and as an invasive weed (Kwak et al., 2021; Petricevich et al., 2020). It belongs to the Solanaceae family, with a center of origin in South America, and it is currently found all over the world (Petricevich et al., 2020). In February 2020, B. suaveolens plants cultivated in a single garden in Vianópolis region (16°56'60.0"S 48°29'16.0"W), Goiás state, Brazil were observed presenting yellowing symptoms, with descending branches death. When the roots were inspected, a large number of galls were found, typical of root-knot nematodes. Samples of soil and root were sent to a Nematology Laboratory (LabNema) at São Paulo State University, Jaboticabal Campus. Forty-one thousand six hundred eggs and second-stage juveniles (J2s) were extracted from 100 cm³ of soil and 7,600 eggs and J2s of Meloidogyne sp. per gram of root. Morphological, enzymatic, and molecular techniques were used to identify the species. The perineal pattern of the females (n = 15) had a high dorsal arch, with thick streaks and a trapezoidal shape. The male labial region (n = 15) had a trapezoidal shape with apparent annulations (Eisenback and Hirschmann, 1981; Nascimento et al., 2021; Taylor and Netscher, 1974). The morphological characteristics of adults were similar to those originally described for M. incognita (Kofoid and White, 1919) Chitwood 1949. The profile of the isoenzyme esterase was studied (n = 16) and the phenotype I1, characteristic of M. incognita, was found (Esbenshade and Triantaphyllou, 1985). Genomic DNA (N = 20) was obtained through DNA of females, extracted by Worm Lysis Buffer (WLB) (Carvalho et al., 2019). Two sets of primers were used, Finc-1: GGGATGTGTAAATGCTCCTG, Rinc-1: CCCGCTACACCCTCAACTTC (Randig et al., 2002) and Finc-4: GTGAGGATTCAGCTCCCCAG, Rinc-4: ACGAGGAACATACTTCTCCGTCC (Meng et al., 2004), specific for M. incognita, which amplified fragments of 399 and 955 bp, respectively, confirming the species. A pathogenicity test was conducted under greenhouse conditions. Six newly formed seedlings were transplanted individually into 10-liter pots containing autoclaved soil and, subsequently, each plant was inoculated with 3,000 eggs and J2s from the original population of M. incognita. After 120 days, White Angel's Trumpet plants showed reduced development, yellow leaves, and many root galls with abundant egg masses on the roots, unlike the non-inoculated plants. Nematodes were extracted from roots. The average recovered reached 78,458 eggs and J2s per plant, corresponding to a reproductive factor (RF) of 26.15. A high RF provides an alert for B. suaveolens cultivation in areas with a history of root-knot nematode infestation. Moreover, this disease outbreak might serve as a source of inoculum for large-scale cultivated plants near the farm, which are generally good hosts for M. incognita. This is the first report presenting Angel's Trumpet as host of root-knot nematode, M. incognita, in Brazil and the world.

Brugmansia suaveolens mottle virus

This datasheet on Brugmansia suaveolens mottle virus covers Identity, Distribution.

A system for reporting and evaluating adverse drug reactions of herbal medicine in Taiwan from 1998 to 2016

The Taiwan Adverse Drug Reaction Reporting System for Herbal Medicine (TADRRS-HM) has systematically documented suspected adverse events from adverse drug reaction (ADR) reports from 1998 (prior to its formal establishment in 2001) and evaluates safety profiles of herbal medicines. This article describes findings from 2079 ADR reports filed between 1998 and 2016: 941 reports involved single herbs and 87 involved folk herbals; 842 were generated from clinical trials, while 209 ADR reports involving foods, health foods, dietary supplement foods and herbal cuisine were grouped as Other. Severity assessments using the Modified Hartwig and Siegel scale classified 72.4% of ADRs as mild, 17.4% as moderate and 6.5% as severe. System Organ Class classification of the ADRs identified gastrointestinal system disorders as the most common (33.4%), followed by skin and subcutaneous tissue disorders (21.2%). The TADRRS-HM records indicate that herbal medicines may cause a wide range of ADRs. Aconiti Radix, Xiao-Qing-Long-Tang, and Datura suaveolens were the most commonly reported single herb, herbal formula, and folk herbal, respectively. The data indicate that herbal medicines may cause a wide range of ADRs. This system will confer long-term benefits for the development of Taiwan’s herbal medicines adverse reaction database and facilitate epidemiological analysis.

First report of Colombian datura virus in Brugmansia suaveolens in Korea.

Brugmansia suaveolens, known as angel's trumpet, is a perennial ornamental shrub in the Solanaceae with large fragrant flowers. In June 2018, a leaf sample of B. suaveolens that showed virus-like symptoms including chlorotic spots, yellowing and mottle on leaves was collected from a greenhouse in Seongnam, South Korea for disease diagnosis (Supplementary Figure S1a, b). Disease incidence in the greenhouse was greater than 80% for about 2,000 B. suaveolens plants. To identify a causal virus, transmission electron microscopy (TEM) was used to analyze symptomatic leaf samples using leaf dips and thin section methods. Filamentous virus particles and pinwheel structures were observed, indicating the presence of a potyvirus (Supplementary Figure S1c, d). To confirm the TEM results, a symptomatic leaf sample was further analyzed by reverse-transcription polymerase chain reaction (RT-PCR) using species-specific detection primers for three potyviruses that infect Brugmansia spp.: Colombian datura virus (CDV), Brugmansia mosaic virus (BruMV), and Brugmansia suaveolens mottle virus (BsMoV) (Lucinda et al, 2008; Park et al., 2014; Verma et al., 2014). The sample was positive only for CDV. CDV is transmitted by aphids in a nonpersistent manner and mechanical inoculation and can infect plants in the Solanaceae family including tomato and tobacco (Kahn and Bartels 1968; Schubert et al. 2006; Verhoeven et al. 1996) and has been designated a quarantine virus in Korea. Additional analysis of 13 symptomatic B. suaveolens plants from the infected greenhouse found that all samples except one were infected with CDV. To isolate CDV from B. suaveolens, leaf extracts from symptomatic samples were mechanically inoculated on an assay host, Nicotiana tabacum cv. BY via three single-lesion passages followed by propagation in N. benthamiana. For the bioassay of the CDV isolate (CDV-AT-Kr), sap from infected N. benthamiana was mechanically inoculated on 31 indicator plants, including B. suaveolens (Supplementary Table S2). CDV-AT-Kr induced chlorotic local lesions, necrotic local lesions, mottle, and/or mosaic systemically in 10 Nicotiana spp., and mottle and yellowing in tomato. On inoculated B. suaveolens, te mild mottle symptom was reproduced. No symptoms were observed in pepper or Datura stramonium. These results were confirmed by RT-PCR. To characterize CDV-AT-Kr genetically, the complete genome sequence of CDV-AT-Kr was obtained by RT-PCR using specific primers (Supplementary Table S3) and deposited in GenBank (accession no. MW075268). The CDV-AT-Kr RNA consists of 9,620 nt, encoding a polyprotein of 3,076 aa. BLASTn analysis showed that CDV-AT had maximum nucleotide identities of 98.9% at the complete genome level with a CDV isolate (accession no. JQ801448) from N. tabacum in the UK. To our knowledge, this is the first report of CDV infection in B. suaveolens in Korea and the second report in the world of the complete genome sequence. As B. suaveolens is cultivated by vegetative propagation, production and maintenance of virus-free, healthy B. suaveolens is needed. In addition, as new CDV hosts have been repeatedly reported (Pacifico et al., 2016; Salamon et al., 2015; Tomitaka et al., 2014; Verma et al., 2014), we are monitoring nationwide occurrence to prevent the spread of the virus to other crops.

Pharmacognostic characterization and antibacterial activity of Brugmansia suaveolens (Humb. & Bonpl. ex Willd.) Bercht. & J. Presl leaves

BACKGROUND: Brugmansia suaveolens (Humb. & Bonpl. ex Willd.) Bercht. & J. Presl (synonym Brugmansia arborea; family Solanaceae) is one of the total seven species of Brugmansia which is commonly known as angel’s trumpet. It has analgesic, antinociceptive, anticancer, anti-inflammatory, antiasthmatic, and various other activities. Despite its numerous medicinal properties, it has never been explored for its potential against bacterial species; also, no publication has been made on pharmacognostical characterization and high-performance thin layer chromatography (HPTLC) investigation of its leaves. OBJECTIVE: The aim of this article is to evaluate the pharmacognostical, physicochemical, HPTLC profiles of B. suaveolens leaves along with the assessment of in-vitro antibacterial activity of its various fractions. MATERIALS AND METHODS: B. suaveolens collected from sub-Himalayan region of Himachal Pradesh, India was authenticated and then studied for various pharmacognostic and physicochemical parameters employing proper quality control methods for medicinal plant materials designed by the WHO. Extracts and fractions of air-dried coarse plant powder were prepared and were identified for the presence of various classes of compounds using preliminary phytochemical screening. HPTLC profile for quantitative evaluation of atropine in leaves of B. suaveolens was carried out and lastly, fractions were assessed for antibacterial activity by using disc diffusion method against chloramphenicol as standard. RESULTS: Transverse section, powder microscopy, leaf constants, and physicochemical parameters revealed valuable data to set up standards for the plant. Alkaloids, glycosides, flavonoids, steroids, triterpenoids, and carbohydrates were found to be present. HPTLC showed 7.79–13.20%w/w of atropine in the plant. Chloroform and ethyl acetate fraction showed encouraging results against four strains of Gram-negative bacteria with good zone of inhibitions. CONCLUSION: The present study provides referential information for identification, authentication, and standardization of this highly important crude drug.

Angelandrsquo;s Trumpet (Brugmansia suaveolens) Poisoning Presenting with Anticholinergic Toxidrome

Accidental poisoning with Angel’s trumpet (Brugmansia suaveolens) is an uncommon plant poisoning reported in Sri Lanka. Toxic substances like atropine and scopolamine give rise to clinical manifestation of toxicity which is mainly anticholinergic effects. We report a rare case of accidental poisoning of Angel’s trumpet of 73-year-old patient who had clinical manifestations of anticholinergic effects. The patient started his symptoms following consuming leaves of angel’s trumpet accidentally. He developed anticholinergic symptoms such as delirium, altered level of consciousness, dilated pupils and tachycardia. Patient successfully recovered with symptomatic management. We recommend to be aware about uncommon types of plant poisoning and different presentations of their toxic effects, not only for timely diagnosis and treatment of such patients, but also to educate the public about the toxicity of plants in order to prevent morbidity and mortality related to accidental poisoning.

Bronchus Histology of Wistar Rats (Rattus norvegicus L) that are exposed to the cigarette smokes given with Angel's Tears leaves (Brugmansia suaveolens) smoke treatment

Bronchus Histology of Wistar Rats (Rattus norvegicus L) that are exposed to the cigarette smokes given with Angel's Tears leaves (Brugmansia suaveolens) smoke treatment

P.109 Altered maternal care induces sex specific behavioural phenotypes in the offspring: the role of corticotropin-releasing factor in the bed nucleus

The mechanisms which promote divergence in populations of phytophagous insects using alternative hosts depend on the characterization of hosts as different selective scenarios and the modeling of the demographic dynamics of the insect on those hosts. In the Bolivian Yungas forests, the treehopper Alchisme grossa (Hemiptera: Membracidae) utilizes two sympatric Solanaceae hosts, Brugmansia suaveolens and Solanum ursinum. On both hosts, females take care of nymphs during their development and adults use almost exclusively their natal host species. We characterized: 1) the performance of families (mother and nymphs) on both hosts, 2) maternal care across families and hosts, 3) biotic (herbivory, predators and parasites) and abiotic (temperature, relative humidity and luminosity) conditions across hosts and 4) demographic parameters of cohorts living under natural conditions on both hosts using matrix population modelling. The life cycle was longer on B. suaveolens than on S. ursinum. Microenvironmental abiotic and biotic traits differed between hosts. Nevertheless, performance did not differ between hosts and no differences between hosts were found in demographic parameters. None of the environmental variables explained the demographic parameters. Females performed maternal care with the same intensity on both hosts. Taken together with published data on the system, these results suggest that individuals of A. grossa in this study belong to a single population. Colonization of one of these hosts might be a recent event and evolutionary processes that promote ecological adaptation and hence demographic or performance differences have not yet become noticeable.

Chemical Compounds, Pharmacological and Toxicological Activity of Brugmansia suaveolens: A Review

This study investigates updated information in different search engines on the distribution, phytochemistry, pharmacology, and toxicology of Brugmansia suaveolens (Solanaceae) using the extracts or chemical compounds at present. This plant has been used in traditional medicine in different cultures as a hallucinatory, analgesic, aphrodisiac, nematicide, sleep inducer, and muscle relaxant, as well as a treatment for rheumatism, asthma, and inflammation. The flowers, fruits, stems, and roots of the plant are used, and different chemical compounds have been identified, such as alkaloids, volatile compounds (mainly terpenes), coumarins, flavonoids, steroids, and hydrocarbons. The concentration of the different compounds varies according to the biotic and abiotic factors to which the plant is exposed. The toxic effect of the plant is mainly attributed to atropine and scopolamine, their averages in the flowers are 0.79 ± 0.03 and 0.72 ± 0.05 mg/g of dry plant, respectively. Pharmacological studies have shown that an aqueous extract exhibits the antinociceptive effect, at doses of 100 and 300 mg/kg i.p. in mice. On the other hand, the ethanolic extract at 1000 mg/L, showed a nematocidal activity in vitro of 64% against Meloidogyne incognita in 72 h. Likewise, it showed a 100% larvicidal activity at 12.5 mg/L against Ancylostoma spp. In another study, the lethal activity of shrimp in brine from an ethanolic extract showed an LC50 of 106 µg/mL at double serial concentrations of 1000–0 (µg/mL). Although there are pharmacological and phytochemical studies in the plant, they are still scarce, which has potential for the examination of the biological activity of the more than one hundred compounds that have been reported, many of which have not been evaluated.

Anatomical and genetic bases underlying the convergent evolution of fleshy and dry dehiscent fruits in Cestrum and Brugmansia (Solanaceae).

The mechanisms controlling evolutionary shifts between dry and fleshy fruits in angiosperms are poorly understood. In Solanaceae, Cestrum and Brugmansia represent cases of convergent evolution of fleshy and dry fruits, respectively. Here we study the anatomical and genetic bases of the independent origin of fleshy fruits in Cestrum and the reversion to dry dehiscent fruits in Brugmansia. We also characterize the expression of candidate fruit development genes, including ALCATRAZ/SPATULA, FRUITFULL, HECATE1/2/3, REPLUMLESS and SHATTERPROOF. We identify anatomical changes to establish developmental stages in the ovary-to-fruit transition in Cestrum nocturnum and Brugmansia suaveolens. We generate reference transcriptomes for both species, isolate homologs for all genes in the fruit genetic regulatory network (GRN) and perform gene expression analyses for ALC/SPT, FUL, HEC1/2/3, RPL and SHP throughout fruit development. Finally, we compare our results to expression patterns found in typical capsules of Nicotiana tabacum and berries of Solanum lycopersicum available in public repositories. We have identified homologous, homoplasious and unique anatomical features in C. nocturnum and B. suaveolens fruits, resulting in their final appearance. Expression patterns suggest that FUL, SHP and SPT might control homologous characteristics, while ALC and RPL likely contribute to homoplasious anatomical features. The fruit GRN changes considerably in these genera when compared to typical capsules and berries of Solanaceae, particularly in B. suaveolens, where expression of FUL2 and RPL1 is lacking.

Immunomodulation-mediated anticancer activity of a novel compound from Brugmansia suaveolens leaves

Immunomodulation activity-guided fractionation of ethanol extract of Brugmansia suaveolens leaves was carried out to isolate a novel compound SUPH036-022A (1) by co-culturing the test fraction/compound activated PBMC with MCF7 and A549 cancer cell lines. Assessment of immune markers in PBMC, and analysis of apoptosis markers and cell cycle was carried out for cancer cells. The structure of the isolated compound was elucidated by spectral analysis. Compound 1 enhanced the secretion of immune markers, IL-2 and IFN-γ, from PBMC. Further, compound 1 treated PBMC increased cell death in MCF7 and A549 cell lines and induced ROS production and mitochondrial membrane perturbation, leading to apoptosis. Flow cytometry analysis revealed; compound 1 stimulated PBMC to cause a five-fold increase in cell cycle perturbations in the sub-G1 stage of cancer cells as compared to the negative control. The compound, in the absence of PBMC, only had a weak cytotoxic activity against these cell lines. Thus, compound 1 is a novel lead for immunomodulation-mediated anticancer activity.

Response to selected ecological parameters by Leptus hringuri Haitlinger, 2000 larvae (Trombidiformes: Erythraeidae) parasitizing treehoppers (Hemiptera: Membracidae) from Bolivia on two host-plant species

ABSTRACTLarvae of Leptus hringuri parasitizing families (adult female + offspring) of the treehopper Alchisme grossa on two host-plants, Brugmansia suaveolens (BS) and Solanum ursinum (SU), were studied. The effect of microenvironmental abiotic conditions (luminosity, temperature and relative humidity) and biotic conditions (distance from the soil to a treehopper host and host-plant phenological stage) on this tritrophic interaction was examined. Overall, the results suggest i) intensity of mite infestation (mean number of mites per infested female or family) of treehoppers (insect hosts) was twice on SU than on BS, ii) a preference of L. hringuri larvae for places with more luminosity (on both host-plants) and relative humidity (on SU), iii) a negative correlation between larval infestation and distance of the host colony to the ground, and iv) that larvae of L. hringuri could detect cues (i.e. chemical) emitted by their insect hosts or the host-plant of the insect host. Results indicate that luminosity, humidity and distance to the ground of the insect-host microenvironment affect both parasitization and prevalence of Leptus larvae mites; however, further research will be needed to understand the ecological mechanisms and consequences of these interactions and to test the hypotheses proposed herein under a chemical ecology perspective.