Blunt Probe Research Articles

The extended wedge method: Atomic force microscope friction calibration for improved tolerance to instrument misalignments, tip offset, and blunt probes

One of the major challenges in understanding and controlling friction is the difficulty in bridging the length and time scales of macroscale contacts and those of the single asperity interactions they comprise. While the atomic force microscope (AFM) offers a unique ability to probe tribological surfaces in a wear-free single-asperity contact, instrument calibration challenges have limited the usefulness of this technique for quantitative nanotribological studies. A number of lateral force calibration techniques have been proposed and used, but none has gained universal acceptance due to practical considerations, configuration limitations, or sensitivities to unknowable error sources. This paper describes a simple extension of the classic wedge method of AFM lateral force calibration which: (1) allows simultaneous calibration and measurement on any substrate, thus eliminating prior tip damage and confounding effects of instrument setup adjustments; (2) is insensitive to adhesion, PSD cross-talk, transducer/piezo-tube axis misalignment, and shear-center offset; (3) is applicable to integrated tips and colloidal probes; and (4) is generally applicable to any reciprocating friction coefficient measurement. The method was applied to AFM measurements of polished carbon (99.999% graphite) and single crystal MoS2 to demonstrate the technique. Carbon and single crystal MoS2 had friction coefficients of μ = 0.20 ± 0.04 and μ = 0.006 ± 0.001, respectively, against an integrated Si probe. Against a glass colloidal sphere, MoS2 had a friction coefficient of μ = 0.005 ± 0.001. Generally, the measurement uncertainties ranged from 10%-20% and were driven by the effect of actual frictional variation on the calibration rather than calibration error itself (i.e., due to misalignment, tip-offset, or probe radius).

Inflammatory Signals Enhance piezo2-Mediated Mechanosensitive Currents

Heightened nociceptor function caused by inflammatory mediators such as bradykinin (BK) contributes to increased pain sensitivity (hyperalgesia) to noxious mechanical and thermal stimuli. Although it is known that sensitization of the heat transducer TRPV1 largely subserves thermal hyperalgesia, the cellular mechanisms underlying mechanical hyperalgesia have been elusive. The role of the mechanically activated (MA) channel piezo2 present in mammalian sensory neurons is unknown. We tested the hypothesis that piezo2 activity is enhanced by BK, an algogenic peptide that induces mechanical hyperalgesia within minutes. We elicited piezo2-mediated currents by poking transiently transfected HEK293T cells with a blunt glass probe. Piezo2 current amplitude increases and inactivation is slowed by activation of exogenous bradykinin receptor B2. The area under the curve was enhanced 6.5-fold by BK compared with vehicle. Inclusion of GDPbetaS in the pipette occluded both effects on amplitude and inactivation. The protein kinase A (PKA) and protein kinase C (PKC) agonists 8-BrcAMP and PMA, respectively, enhanced piezo2 activity. No enhancement of piezo2-mediated currents was observed during exposure to the PLC activator m-3M3FBS (25 microM), suggesting phosphatidylinositol-PLC pathways do not increase piezo2 activity; inhibition of store release by thapsigargin had no effect on BK-induced changes. The PKA inhibitor H-89 and PKC inhibitor BIM I applied together effectively abrogated the BK-induced changes. Finally, piezo2-dependent MA currents in a class of native sensory neurons are enhanced 8-fold by BK via a PKA and PKC dependent mechanism, similarly to that observed in HEK cells. Thus, piezo2 sensitization may contribute to PKA- and PKC-mediated mechanical hyperalgesia. The mechanism described here differs from another model of mechanical hyperalgesia (epinephrine-induced PKCe-mediated) in which the downstream effector of cAMP is EPAC rather than PKA, since the BK effects observed here require PKA activity, and neither PI-PLC nor phospholipase D appears to be involved.

Carpal Tunnel Release Using the MANOS CTR System: Preliminary Results in 52 Patients

To describe a carpal tunnel release technique using the MANOS Carpal Tunnel Release device, with preliminary results in 52 patients. The MANOS Carpal Tunnel Release device is a blade that divides the transverse carpal ligament using wrist and palm skin punctures. The awake patient provides feedback as the surgeon navigates a 2.1-mm-diameter blunt probe across the undersurface of the ligament from a wrist incision with standard disposable nerve stimulator monitoring. The leading tip of the blunt probe is uninsulated and conducts 2 mA. The surgeon converts the blunt insulated probe into an uninsulated blade by advancing a 0.9-mm needle through the palm with a thumb-activated deployment feature. The surgeon saws the ligament through the 2 skin punctures. We used a validated outcome questionnaire to assess postoperative symptoms at 3 months. Symptom severity and functional status scores compare favorably with literature controls for open and endoscopic surgery at 3 months. One patient required reoperation for incomplete release. There were no tendon or nerve injuries. Preliminary results suggest the MANOS Carpal Tunnel Release device to be safe and effective. Therapeutic IV.

Determination of Target Sequence Bound by PapX, Repressor of Bacterial Motility, in flhD Promoter Using Systematic Evolution of Ligands by Exponential Enrichment (SELEX) and High Throughput Sequencing

Most uncomplicated urinary tract infections (UTIs) are caused by uropathogenic Escherichia coli (UPEC). Both motility and adherence are integral to UTI pathogenesis, yet they represent opposing forces. Therefore, it is logical to reciprocally regulate these functions. In UPEC strain CFT073, PapX, a non-structural protein encoded by one of the two pap operons encoding P fimbria adherence factor, represses flagella-mediated motility and is a putative member of the winged helix transcription factor family. The mechanism of this repression, however, is not understood. papX is found preferentially in more virulent UPEC isolates, being significantly more prevalent in pyelonephritis strains (53% of isolates) than in asymptomatic bacteriuria (32%) or fecal/commensal (12.5%) strains. To examine PapX structure-function, we generated papX linker insertion and site-directed mutants, which identified two key residues for PapX function (Lys(54) and Arg(127)) within domains predicted by modeling with I-TASSER software to be important for dimerization and DNA binding, respectively. To determine the PapX binding site in the CFT073 genome, systematic evolution of ligands by exponential enrichment (SELEX) in conjunction with high throughput sequencing was utilized for the first time to determine a novel binding site for a bacterial transcription factor. This method identified a 29-bp binding site within the flhDC promoter (TTACGGTGAGTTATTTTAACTGTGCGCAA), centered 410 bp upstream of the flhD translational start site. Gel shift experiments demonstrated that PapX binds directly to this site to repress transcription of flagellar genes.

Puncture resistance of natural rubber latex unidirectional coated fabrics

A study was conducted on the puncture resistance of high-strength nonwoven natural rubber latex (NRL)-coated fabrics. High strength unidirectional (UD) polyethylene fabrics were coated using single dipping (SD), double dipping (DD), and triple dipping (TD) methods. The puncture resistance of the uncoated and coated fabrics was determined by measuring the force needed to penetrate the fabrics using a blunt probe. The mechanisms and modes of deformation involved during penetration were observed as well. In comparison with the uncoated fabrics, the SD, DD, and TD NRL coated fabrics gave higher puncture resistance of 39%, 47%, and 62%, respectively. The increments of the penetration force were proportional with the increase in the NRL-coated fabric thickness. For the uncoated fabric, the force given by the probe resulted in yarns stretching and yarn slippage upon penetration. However, the NRL-coated fabrics were not severely damaged but resulted in a curvature formed at the frontface of the fabric with minimal backface deformation. From the observations, the modes of failure were similar among the NRL-coated fabrics, that is, fiber stretching, delamination of NRL layer, and stretch marks on the fabric surface. The NRL layer acted as a protective sheath and increases the energy absorption and elasticity characteristics of the UD fabric.

Cervix Stimulation Evokes Predominantly Subthreshold Synaptic Responses in Mouse Thoracolumbar and Lumbosacral Superficial Dorsal Horn Neurons

Sensory input from the female reproductive tract (FRT) plays a pivotal role in coordinating reproductive reflexes. Additionally, a number of disorders, especially chronic pelvic pain, may be due to disturbances in sensory processing of signals from the FRT. Our aim was to record synaptic responses in neurons from lumbar and sacral spinal cord segments during mechanical stimulation of the cervix. We developed an in vivo preparation of the mouse spinal cord to record synaptic potentials from superficial dorsal horn (SDH) neurons under whole-cell patch clamp recording conditions. We analyzed the strength and distribution of excitatory postsynaptic potentials in SDH neurons evoked during mechanical stimulation of the cervix and cutaneous sites. Resting membrane potential and neuronal input resistance was similar in thoracolumbar (TL, T13-L3) and lumbosacral (LS, L6-S2) segments. We elicited activity in 6/21 TL neurons and 15/39 LS neurons using mechanical stimulation of the cervix with a blunt probe. The majority of these neurons responded to cervix stimulation with bursts of subthreshold excitatory postsynaptic potentials (4/6 and 12/15 TL and LS neurons, respectively). The remainder responded with sufficient magnitude to generate action potentials (2/6 and 3/15 TL and LS neurons). Cutaneous synaptic inputs were also elicited in 11/21 TL neurons following stimulation of the flank/leg, 19/39 LS neurons by stimulation of the tail, and three LS neurons by perineal stimulation. Some neurons received convergent synaptic inputs from the cervix and cutaneous sites (4/6 TL and 4/15 LS). These data demonstrate that spinal projections of cervix afferents are widely dispersed in the SDH and considerable convergence exists between neurons innervating the cervix and cutaneous structures. Our results indicate that much of the synaptic activity evoked in SDH neurons following cervix stimulation is subthreshold.

Subaxial cervical pedicle screw placement using limited opening technique: experimental study and preliminary clinical report

Objectives To evaluate the safety and accuracy of limited opening technique for traspedicular screw placement in subaxial cervical spine. Methods Twenty fresh cervical specimens (C_3-C_7) were included in this study and placed with 199 pedicle screws using limited open technique for evaluation of the location of the screws. Forty C_3-C_4 specimens (80 sides) were used to observe architec-ture of the cervical pedicle and measure parameters related with screw placement. Seven patients with cer-vical instability were treated with pedicle screw fixation (29 screws) using this limited open technique.The cancellous bone in the junction of lateral mass and medical wall of pedicle was removed to find the in-let of the pedicle. The pedicle screws were inserted according to the measurement results of CT and X-ray. The patients were then evaluated radiographically for the location of the pedicle screw. Results The key structure safely leading into the pedicle was the junction between deep cortex of C_3、C_4 lateral mass and medial wall of the pedicle, which was located at the lateral upper quadrant of the lateral mass,with hard contour surface but without nutrient foramens. The screw insertion points were distributed at lat-eral upper quadrant of the lateral mass, with mean debouchement diameter of 5.2 mm, mean inlet width of 7.5 mm, medial angle of 42°and upward angle of 10°. The accuracy rate of screw placement was 94.5% in specimens and 100% in patients. Conclusion Limited opening at lateral mass surface combined with single-blade blunt end probe is proved to be a safe and accurate technique for subaxial cer-vical pedicle screw placement. Key words: Cervical vertebrae; Fracture fixation,internal; Limited opening technique

Marginal Bone Stability Using 3 Different Flap Approaches for Alveolar Split Expansion for Dental Implants—A 1-Year Clinical Study

Width augmentation for the alveolar process using alveolar split procedures has not been studied in a comparative study with regard to marginal bone stability. Most research in this regard has used implant osseointegration as an endpoint for the success of the bone grafting procedure. The purpose of the present clinical trial was to retrospectively evaluate the stability of the buccal crestal bone around dental implants placed into alveolar split graft sites using 3 different approaches: a minimal flap, a partial-thickness flap, and a full mucoperiosteal flap. Implants were placed simultaneously or delayed to alveolar split grafting. The aim of the present study was to do a comparative analysis of these 3 techniques by clinical detection for the presence or absence of marginal bone using a periodontal probe 1 year after implant restoration. The working hypothesis was that detachment or disturbance of the blood supply of the buccal plate would be influenced by the flap procedure used and would therefore affect the late marginal bone stability around the implants. A total of 40 consecutive patients were treated in 2 different practice locations (20 at each office) with alveolar split procedures and simultaneous implant placement, using 3 different flap approaches and were seen again after 1 year at the 2 private office locations. The patients were in general good health, without active periodontal disease. All patients were nonsmokers. Patients with diabetes mellitus were excluded from the study. The aim of the present study was to establish the stability of the mobilized buccal bone plate, which could only be observed indirectly. The method used to detect the presence or absence of buccal marginal bone was a blunt periodontal probe used in the sulcus on the facial surface of the restored implant or a sharp explorer used transgingivally to detect marginal bone presence. However, the bone thickness could not be established using either of these methods. This was done in both practice locations by the surgeon who had performed the procedure (in a few cases, open flap procedures were done up to 1 year after grafting, which permitted direct observation of the original treatment site). The 3 different flap approaches studied were full-thickness flap reflection, partial-thickness flap reflection, and minimal flap reflection of the osteoperiosteal flap approach to crestally split and then widen the alveolus. A total of 40 consecutive patients treated with 65 alveolar split expansion procedures done in 2 practice locations during a 2-year period were statistically analyzed retrospectively for buccal bone augmentation presence and implant restorability after 1 year of healing. Facial bone loss of 2 mm or more was seen in 11 sites, 10 of which were full flap reflections and 1 an osteoperiosteal flap site. Implant osseointegration was 92.5% for the osteoperiosteal flaps, 93.3% for the partial-thickness flaps, and 94.4% for the full-thickness flaps. The 3 flap approaches to alveolar widening by crest splitting with implant placement had a sustained increased alveolar width after 1 year. However, most full flap alveolar split cases had facial bone loss and gingival recession. The osteoperiosteal flaps (book flap) and partial-thickness flaps showed stable buccal bone patterns. The results of the present clinical study of relatively early osseous remodeling suggest that full mucoperiosteal flaps should not be reflected when an alveolar split is done. However, to further elucidate the marginal bone vitality, a longer study period must be undertaken to more fully validate the alveolar split procedure and verify the best flap approach.

Letter to the Editor concerning “A less invasive surgical approach in the lumbar lateral recess stenosis: direct approach to the medial wall of the pedicle” (A. Colak et al., Eur Spine J (2008) 17:1745–1751)

Dear Sir, I have read the paper of Dr. Simsek which was published in European Spine Journal (2008) 17:1745–1751 and compliment the authors on preparing this publication. In the discussion on p 1750 the problem is addressed of determining the degree of facetectomy required for relief of the lateral spinal stenosis, and it is stated that no satisfactory guideline has been established. However, when responding to the question “How do you know that decompression is complete?” I submit that there are two clinical observations that can be made during surgery. The first is that in the early stages of its exposure in the stenotic canal, the nerve root is extremely sensitive and, when touched with a blunt probe, it will cause the leg on the affected side to go into a vigorous spasm. The second observation is that, as the stenosis is finally relieved, the collapsed perineural veins refill rapidly, and within minutes of this perineural vein refilling, manipulation of the nerve root no longer elicits vigorous muscular contractions in the leg. To the question as to how one knows that the decompression is complete, the answer is that when the surgeon observes the dramatic rapid refilling of the perineural veins on the posterior surface of the exposed nerve root and the nerve root loses its extreme sensitivity [1]. In addition, I will mail you a copy of a CD film I prepared on Techniques of Lumbar Canal Decompression, which complements this current paper in the European Spine Journal and deals with the surgical techniques for the relief of lumbar spinal canal stenosis [2]. I hope you will find it of interest.

Effect of photoelectric emission on blunt probe conductivity measurements in the stratosphere

Two identical planar blunt probes of stainless steel material, biased with a bipolar ramp voltage, are used to measure the stratospheric polar conductivities to altitudes of 34 km. One probe (DP) is mounted closer to the gondola, looking downwards and shielded from sunlight, while the other (SP) is mounted looking sideways, away from the gondola. The daytime observations of positive ions in the 29–34 km altitude range with SP, and of negative ions at 34 km with DP, show photoelectric contaminations induced by solar UV radiations in the 190–230 nm band. These contaminations are found to be due to photoemissions from the SP probe steel surface and from the carbon paint that coats the surface of the gondola, respectively. It is found that, a segment of the photocurrent contaminated I– V curve, recorded with SP at higher negative probe potentials, is linear, and it can give the ambient positive polar conductivity.

Prevalence and distribution of caries in the 12-15 year urban school children in Enugu, Nigeria.

Aim: To investigate the prevalence and distribution of dental caries among 12 to 15 year old urban school children in Enugu, South-East, Nigeria.Methods: A multistage sampling technique was used to select the 353 school children that were studied. Presence of caries was identified by using semi structured interviewer administered questionnaires, mouth mirror and blunt probe under natural illumination. Data on presence of caries were recorded using WHO criteria of 1997.Results: Caries were diagnosed in 85 (24.1%) of the 353children. The total mean DMFT for the 353 children was 0.45 ± 0.53. The mean DMFT for boys was 0.35 ± 0.33 and for girls it was 0.54 ± 0.86. There was a general increase in mean DMFT with age. Caries was most prevalent in first molars (46.5%) while canines and first premolars were caries free. Caries were also observed more in the mandibular molars (23.29%).Conclusion: Caries prevalence was low compared to those obtained from previous studies. The prevalence gets worse with increasing age. To sustain the low prevalence, a cost effective preventive approach to caries should be used especially by the older children.

Taser Blunt Probe Dart-To-Heart Distance Causing Ventricular Fibrillation in Pigs

The maximum distance between the heart and a model Taser stimulation dart, called the dart-to-heart distance, at which the Taser can directly cause ventricular fibrillation (VF), was measured in pigs. A 9-mm-long blunt probe was advanced snugly through the surrounding tissues toward the heart. Five animals [pig mass=61.2+/-6.23 standard deviation (SD) kg] for ten dart-to-heart distances where the Taser caused VF were tested. The dart-to-heart distances where the Taser caused VF of the first stimulation site ranged from 4 to 8 mm with average 6.2 mm+/-1.79 (SD) and of the second stimulation site ranged from 2 to 8 mm with average 5.4 mm+/-2.41 (SD). The results help inform the evolving discussion of risks associated with Tasers.

How Effective is a Saline Arthrogram for Wounds Around the Knee?

Traumatic arthrotomies may predispose patients to subsequent septic arthritis and therefore are regarded as serious injuries requiring emergent treatment. The saline arthrogram is a commonly used test to determine if a patient has a traumatic arthrotomy. We determined the sensitivity of the saline arthrogram to identify known intraarticular wounds in 78 patients (80 knees) undergoing elective arthroscopic procedures. There were 66 infrapatellar and 14 suprapatellar incisions. The average length of the incision was 7.5 mm. Intraarticular position was confirmed with a blunt probe. A saline arthrogram then was performed using 60 mL normal saline. The known arthrotomy (operative wound) was observed during the injection for evidence of saline leakage (positive static test). If no leakage was observed, the knee was brought through a range of motion with continued observation for leakage from the arthrotomy (positive dynamic test). Twenty-two of 80 knees had a positive test without passive range of motion of the knee (static sensitivity, 36%). Eight additional knees had a positive test with subsequent passive motion (dynamic sensitivity, 43%). Our data suggest a saline arthrogram has low sensitivity for detecting known small traumatic arthrotomy wounds of the knee. Level I, diagnostic study. See the Guidelines for Authors for a complete description of levels of evidence.

ORAL HEALTH STATUS

Oral health, although an important aspectof the general health, unfortunately is an ignored aspect, by almost all population strata. Poverty, lack of education andlack of public awareness programs add to the dilemma. Aims & Objectives: Evaluation of the oral health, toothcleaning devices and at the top, awareness about such devices, among the most ignored and deprived group ofpopulation. The evaluation of oral hygiene of the poor railway coolies, was the objective of this study. Materials &Methods: A very simple proforma in Urdu was designed. It included some questions about personal data, tooth cleaninghabits, the devices used for the purpose and the reasons for not using the tooth brush. DMFT and the periodontalconditions were then noted in the same proforma. About 120 coolies agreed to participate in the study. Examinationwas made in day light with a mirror and a blunt probe. Results: The age varied from 15-60 years. There was about100% periodontal involvements, while DMFT increased with age (0.75 to 12.5). About 49.5 % used brush, 41.5%miswak, 5.3% tooth powder, while 3.5 % did not use any of these. Tooth brush users had least DMFT while powderusers had the maximum. Of the non brush users 50.9% of people could not buy brush, 33.9% did not like it while15.09% were ignorant of it. Conclusion: Poverty, illiteracy and lack of dental awareness are the major causes of dental/ periodontal problems. The tooth brushing techniques must be taught to the public.

Underlay Tympanoplasty with Laser Tissue Welding

We investigated the feasibility of using laser tissue welding techniques to perform transcanal underlay tympanoplasty. We used 10 temporal bones obtained from human cadavers. After creating a subtotal tympanic membrane perforation, we introduced harvested periosteum through the perforation and used laser tissue welding to secure the periosteum graft in place in an underlay fashion. The procedure was performed via a transcanal approach and did not require middle ear packing. Immediately after the graft had been placed, we qualitatively tested its integrity with a blunt probe. The graft was as strong as the native cadaver tympanic membrane in all 10 cases. We conclude that laser transcanal underlay tympanoplasty is a feasible and effective method of repairing a tympanic membrane. The ultimate goal is to develop a technique that will allow physicians to routinely perform underlay tympanoplasty on moderately sized perforations in an office setting.

Cochlear transducer operating point adaptation

The operating point (OP) of outer hair cell (OHC) mechanotransduction can be defined as any shift away from the center position on the transduction function. It is a dc offset that can be described by percentage of the maximum transduction current or as an equivalent dc pressure in the ear canal. The change of OP can be determined from the changes of the second and third harmonics of the cochlear microphonic (CM) following a calibration of its initial value. We found that the initial OP was dependent on sound level and cochlear sensitivity. From CM generated by a lower sound level at 74 dB SPL to avoid saturation and suppression of basal turn cochlear amplification, the OHC OP was at constant 57% of the maximum transduction current (an ear canal pressure of -0.1 Pa). To perturb the OP, a constant force was applied to the bony shell of the cochlea at the 18 kHz best frequency location using a blunt probe. The force applied over the scala tympani induced an OP change as if the organ of Corti moved toward the scala vestibuli (SV) direction. During an application of the constant force, the second harmonic of the CM partially recovered toward the initial level, which could be described by two time constants. Removing the force induced recovery of the second harmonic to its normal level described by a single time constant. The force applied over the SV caused an opposite result. These data indicate an active mechanism for OHC transduction OP.

Instrumental Measurement of Physical Properties of Cooked Asian Wheat Flour Noodles

ABSTRACTInstrumental texture tests on cooked noodles are valuable research tools and are well suited for monitoring noodle texture after changes in formulations, raw materials, and processing. Uniaxial tests are most common, and a variety of test types, strains, strain rates, and probe dimensions are used. Consequently, standardization is a challenge. Compressive tests (cutting and blunt probe compression) are more frequently reported than tensile tests. Combining results of tensile and compressive tests shows potential to uncover aspects of noodle texture not detectable using one method alone. Tensile and blunt‐probe compression tests can be both adapted for stress relaxation experiments and may be used to derive fundamental rheological information. Dynamic oscillating rheometry shows promise as a tool for investigating composition/structure/function relationships in cooked noodles. However, unlike large deformation “texture” tests, dynamic oscillating rheometry struggles to match sensory perceptions of noodle texture. This may result from the scale of the deformations applied, which are commonly much smaller than the deformations required for rupture. Limitations of small deformations become more evident when considering fracture properties of noodles and how these are affected by changes in flour composition and inhomogenieties in noodle structure at the macro‐, meso‐, and micro‐scales. Combining information from small and large deformations has been used to investigate changes in noodle texture occurring after changes in amylose and protein composition. This combined approach may prove to be useful in resolving differences and similarities in noodle texture wrought by changes in the constituent polymers of wheat flour.

Role for Human Posterior Parietal Cortex in Visual Processing of Aversive Objects in Peripersonal Space

The posterior parietal cortex of both human and non-human primates is known to play a crucial role in the early integration of visual information with somatosensory, proprioceptive and vestibular signals. However, it is not known whether in humans this region is further capable of discriminating if a stimulus poses a threat to the body. In this functional magnetic resonance imaging (fMRI) study, we tested the hypothesis that the posterior parietal cortex of humans is capable of modulating its response to the visual processing of noxious threat representation in the absence of tactile input. During fMRI, participants watched while we "stimulated" a visible rubber hand, placed over their real hand with either a sharp (painful) or a blunt (nonpainful) probe. We found that superior and inferior parietal regions (BA5/7 and BA40) increased their activity in response to observing a painful versus nonpainful stimulus. However, this effect was only evident when the rubber hand was in a spatially congruent (vs. incongruent) position with respect to the participants' own hand. In addition, areas involved in motivational-affective coding such as mid-cingulate (BA24) and anterior insula also showed such relevance-dependent modulation, whereas premotor areas known to receive multisensory information about limb position did not. We suggest these results reveal a human anatomical-functional homologue to monkey inferior parietal areas that respond to aversive stimuli by producing nocifensive muscle and limb movements.

Motor neurone excitability in back muscles assessed using mechanically evoked reflexes in spinal cord injured patients

Objective: The clinical and functional assessment of back muscles in human spinal cord injury (SCI) has received little attention. The aim of this study was to develop a method to...

Towards a general semi-empirical model for the aspiration efficiencies of aerosol samplers in perfectly calm air

In previous papers we have described a body of experimental work, backed up by numerical studies, to acquire a large set of new data for the aspiration efficiencies of aerosol samplers of simple geometries in perfectly calm air and for a range of orientations. The samplers studied were idealized thin-walled and spherical blunt probes, and experiments were conducted for upwards, downwards and horizontal sampling. Taken as a whole, this is believed to be the most comprehensive data set yet obtained for aerosol sampling in calm air. In this paper, we have examined this complete data set—including both experimental and numerical data—and used it to construct a set of semi-empirical models for aspiration efficiency. The starting point for these is the basic physical model of Levin (1957) for the entry of particles into a point sink in calm air. Additional terms are introduced that account for the role of the sampler having finite dimensions and defined shape. The models are expressed in terms of groups of dimensionless combinations of variables that embody the effects of particle inertia, gravitational settling, sampler bluntness and sampler orientation with respect to the vertical. They are semi-empirical in that, although they thus embody physical mechanisms and ideas, the added terms (beyond the Levin-model starting point) containing those dimensionless quantities are incorporated into mathematical constructs that are entirely empirical. The constructs are such that they may be combined together in a single universal form that reverts back to the individual specific cases when those conditions are inserted. Agreement is generally good across the whole range of conditions studied. The small number of areas where agreement is less good may be explained in terms of experimental error or technical limitations in acquiring the experimental data.