Nuclear Protein Binding Sites Research Articles

Active intracellular domain of Notch enhances transcriptional activation of CCAAT/enhancer binding protein beta on a rat pregnancy-specific glycoprotein gene.

Pregnancy-specific glycoproteins (PSGs) are primarily expressed in the placenta and become the major glycoproteins at term. To understand the regulation of PSG expression, we characterized the promoter elements of a rodent PSG gene, rnCGM3, and delineated three nuclear protein binding sites: FPI, -II, and -III in the 5'-flanking region of the gene. The FPII-binding factor is shown to be C/EBPbeta, which positively regulates rnCGM3 expression [Chen, H., et al. (1995) DNA Cell Biol. 14, 681-688]. In the current study, we used the yeast one-hybrid system to isolate transcription factors binding to the FPIII site and demonstrated that a rodent J kappa recombination signal sequence binding protein, rRBPJ kappa-2N, bound to the FPIII site. Electrophoretic mobility shift assay with rat placental nuclear proteins revealed a constitutive occupancy of the FPIII site by RBPJ kappa. By transient expression analyses, we demonstrated that rRBPJ kappa-2N repressed the expression from an FPIII-driven SV40 promoter. However, this repression effect was counteracted by the active intracellular domain of Notch (NotchIC). Using the native rnCGM3 promoter construct, we demonstrated that the promoter activity stimulated by C/EBP beta was also repressed by rRBPJ kappa-2N but enhanced by NotchIC. Additionally, we found that NotchIC can stimulate expression through another RBPJkappa site within the FPI site. A functional interaction between factors binding to the FPI, FPII, and FPIII sites is proposed.

Multiple binding sites for nuclear proteins of the anterior pituitary are located in the 5′-flanking region of the porcine follicle-stimulating hormone (FSH) β-subunit gene

Gonadotropins, follicle-stimulating hormone (FSH), and luteinizing hormone (LH), are synthesized specifically in the gonadotropes of the anterior pituitary. The aim of this study was to investigate nuclear factors that bind specifically to the porcine FSH β-subunit gene. We examined nuclear protein binding to 2.75 kilobase pairs (kbp) of DNA adjacent to the porcine FSH β-subunit gene: about 2.32 kbp of upstream DNA and 0.43 kbp of downstream DNA. The upstream region contains only TATA box, CACCC element, and some imperfect sequences of cAMP-responsive element, activator protein-1 binding site, and activator protein-2 binding site. Gel mobility shift assay using nuclear proteins extracted from the porcine anterior pituitary revealed that the proteins bound to a limited region of DNA, 107 bp long (designated as Fd2), located about −800 bp upstream from the transcription initiation site. Competitive binding assays demonstrated that the protein binding was sequence specific; the addition of excess amounts of several putative regulatory sequences and plasmid (non-homologous) DNA fragments did not reduce the binding. Furthermore, all five subfragments of Fd2 were also bound by the pituitary nuclear proteins, showing that the entire region of Fd2 is involved in this interaction. Southwestern blotting demonstrated that at least seven protein species of 110, 98, 78, 63, 52, 42, and 35 kDa recognize Fd2. Nuclear proteins from several other porcine tissues were also able to bind to the Fd2 fragment but the gel shift patterns were different and the bindings were weak, although only the cerebellum showed a pattern of binding that was similar to that of the anterior pituitary. These data suggest that multiple proteins of the anterior pituitary recognize a specific region of the porcine FSH β-subunit gene.

The FeLV-945 LTR Confers a Replicative Advantage Dependent on the Presence of a Tandem Triplication

Feline leukemia virus (FeLV), like other naturally occurring retroviruses, is characterized by a high degree of genetic diversity. FeLV-945 is a natural isolate derived from non-B-cell non-T-cell lymphomas classified anatomically as multicentric. FeLV-945 exhibits a unique structural motif in the LTR composed of a 21-bp tandem triplication downstream of a single copy of enhancer. The unique FeLV-945 LTR is precisely conserved among eight independent multicentric lymphomas collected in a geographic cluster. Previous studies using reporter gene constructs predict that the FeLV-945 LTR would confer a replicative advantage on the virus that contains it, particularly in primitive hematopoietic cells. Such an advantage may account for the precise conservation of the unique LTR sequence. To test that prediction, a set of recombinant, infectious FeLVs was developed that are isogenic other than the presence of the FeLV-945 LTR or mutations of it. Replication assays show that the FeLV-945 LTR confers a distinct growth advantage in K-562, FEA, and 3201 cells and implicate the 21-bp triplication in that function. Replacement of two copies of the triplicated element with random sequence greatly diminished the replicative capacity, thus implicating the triplicated sequence itself in LTR function. The 21-bp triplication was shown to contain specific nuclear protein binding sites, which may account for the selective pressure to conserve the sequence.

Multiple cloning sites from mammalian expression vectors interfere with gene promoter studies in vitro.

When performing transcriptional analyses, reporter gene-expression vectors are used to insert promoter fragments through the selected use of a multiple cloning site (MCS) located upstream of the reporter gene. The MCS from pBluescript has frequently been transferred into reporter plasmids (usually bearing the chloramphenical acetyltransferase reporter gene) and used to subclone various promoter fragments from diverse genes. Analyses in electrophoretic mobility shift assay using this MCS as labeled probe revealed that it specifically binds multiple nuclear proteins from a whole array of widely used cell types. Moreover, the presence of the MCS sequence dramatically altered promoter activity in a totally unpredictable fashion that depends on the distance between the MCS and the basal promoter start site of the gene, leading to severe misinterpretation of the transfection data. Finally, we provide evidence that the BamHI/SmaI/PstI restriction site combination is likely one of the major binding site for nuclear proteins on the pBluescript MCS, therefore suggesting that this particular combination of restriction sites should be avoided in the MCS from plasmids that are to be used in promoter studies.

A novel parsley 4CL1 cis-element is required for developmentally regulated expression and protein-DNA complex formation.

The phenylpropanoid enzyme 4-coumarate:coenzyme A ligase (4CL) participates in the biosynthesis of a wide range of secondary products with specialized function and tissue distribution in plants. The parsley 4CL1 promoter directs a complex tissue- and cell-specific pattern of reporter gene expression in transgenic tobacco, consistent with the distribution of phenylpropanoid products and sites of 4CL expression in tobacco vegetative and floral organs. We generated mutants in a 4CL1 promoter element previously implicated as a site for protein-DNA complex formation to analyze its role in vivo. Mutation of this element (FP56) reduced expression in some organs/tissues up to several hundredfold, with little effect on cell-specific expression patterns. Electrophoretic mobility shift assays indicated that the FP56 cis-element is the binding site for tobacco and parsley nuclear proteins, and that mutations in the same element that reduce reporter gene expression in transgenic plants greatly reduce or abolish protein-DNA complex formation. DNAse I protection assays showed that the region of the 4CL1 promoter surrounding the FP56 element is the site for formation of two large protein-DNA complexes, and that an intact FP56 element is required for formation of these complexes. Finally, the detergent deoxycholate was used to investigate the role of protein-protein interactions in FP56 complex formation. Our data suggest that the FP56 cis-element plays a central role in transcriptional activation from the 4CL1 promoter, and that its role may be to nucleate formation of a large protein complex on the promoter.

A binding site for multiple transcriptional activators in the fushi tarazu proximal enhancer is essential for gene expression in vivo.

The Drosophila homeobox gene fushi tarazu (ftz) is expressed in a highly dynamic striped pattern in early embryos. A key regulatory element that controls the ftz pattern is the ftz proximal enhancer, which mediates positive autoregulation via multiple binding sites for the Ftz protein. In addition, the enhancer is necessary for stripe establishment prior to the onset of autoregulation. We previously identified nine binding sites for multiple Drosophila nuclear proteins in a core 323-bp region of the enhancer. Three of these nine sites interact with the same cohort of nuclear proteins in vitro. We showed previously that the nuclear receptor Ftz-F1 interacts with this repeated module. Here we purified additional proteins interacting with this module from Drosophila nuclear extracts. Peptide sequences of the zinc finger protein Ttk and the transcription factor Adf-1 were obtained. While Ttk is thought to be a repressor of ftz stripes, we have shown that both Adf-1 and Ftz-F1 activate transcription in a binding site-dependent fashion. These two proteins are expressed ubiquitously at the time ftz is expressed in stripes, suggesting that either may activate striped expression alone or in combination with the Ftz protein. The roles of the nine nuclear factor binding sites were tested in vivo, by site-directed mutagenesis of individual and multiple sites. The three Ftz-F1-Adf-1-Ttk binding sites were found to be functionally redundant and essential for stripe expression in transgenic embryos. Thus, a biochemical analysis identified cis-acting regulatory modules that are required for gene expression in vivo. The finding of repeated binding sites for multiple nuclear proteins underscores the high degree of redundancy built into embryonic gene regulatory networks.

TATA-less Mouse Vitronectin Gene Promoter: Characterization of the Transcriptional Regulatory Elements and a Nuclear Protein Binding Site on the Promoter.

Vitronectin in a cell-adhesion molecule whose expression is temporally and spatially regulated in vivo, but whose regulatory mechanism of transcription is unknown. In this study, we characterized the mouse vitronectin gene promoter. Luciferase expression vectors cloned the successive 5'- or 3'-deletions of the 5'-flanking region upstream of the luciferase gene and were transfected into the human hepatoma cell line HepG2. The assay of luciferase activity in the transfected cells revealed that a 38 base pair (bp)-element (positions +3 to +40) displays promoter activity. A consensus sequence consisting of a TATA box and initiator is shown around the transcription initiation site of the mouse vetronectin gene, but the GC box is not shown. Site-directed or deleted mutagenesis against a consensus sequence of TATA box and initiator could not abolish the promoter activity. These results induce that the putative TATA box and initiator are not involved in the promoter activity, and that the vitronectin promoter lacks the TATA box, initiator and GC box. To characterize trans-acting factors involved in promoter activity, a DNA fragment (position -74 to +95) was subjected to gel shift assay using nuclear proteins extracted from HepG2 cells. One shifted band was detected by the gel shift assay, suggesting that a nuclear protein binds to the promoter region. Results of the DNase I foot printing assay and gel shift assay demonstrate that the nuclear proteins can bind to the 38 bp-element, which has promoter activity. The nuclear protein is a putative trans-acting factor involved in transcription initiation.

Physical interactions between Ets and NF-kappaB/NFAT proteins play an important role in their cooperative activation of the human immunodeficiency virus enhancer in T cells.

The transcriptional regulatory elements of many inducible T-cell genes contain adjacent or overlapping binding sites for the Ets and NF-kappaB/NFAT families of transcription factors. Similar arrays of functionally important NF-kappaB/NFAT and Ets binding sites are present in the transcriptional enhancers of human immunodeficiency viruses types 1 and 2 (HIV-1 and HIV-2), suggesting that this pattern of nuclear protein binding sites reflects an evolutionarily conserved mechanism for regulating inducible T-cell gene expression that has been co-opted during HIV evolution. Despite these findings, the molecular mechanisms by which Ets and NF-kappaB/NFAT proteins cooperatively regulate inducible T-cell gene expression remained unknown. In the studies described in this report, we demonstrated a physical interaction between multiple Ets and NF-kappaB/NFAT proteins both in vitro and in activated normal human T cells. This interaction is mediated by the Ets domain of Ets proteins and the C-terminal region of the Rel homology domains of NF-kappaB/NFAT proteins. In addition, the Ets-NF-kappaB/NFAT interaction requires the presence of DNA binding sites for both proteins, as it is abolished by the DNA intercalating agents propidium iodide and ethidium bromide and enhanced by the presence of synthetic oligonucleotides containing binding sites for Ets and NF-kappaB proteins. A dominant-negative mutant of NF-kappaB p50 that binds DNA but fails to interact with Ets proteins inhibits the synergistic activation of the HIV-1 and HIV-2 enhancers by NF-kappaB (p50 + p65) and Ets-1, suggesting that physical interaction between Ets and NF-kappaB proteins is required for the transcriptional activity of the HIV-1 and HIV-2 enhancers. Taken together, these findings suggest that evolutionarily conserved physical interactions between Ets and NF-kappaB/NFAT proteins are important in regulating the inducible expression of T-cell genes and viruses. These interactions represent a potential target for the development of novel immunosuppressive and antiviral therapies.

A serum response factor-dependent transcriptional regulatory program identifies distinct smooth muscle cell sublineages.

The SM22alpha promoter has been used as a model system to define the molecular mechanisms that regulate smooth muscle cell (SMC) specific gene expression during mammalian development. The SM22alpha gene is expressed exclusively in vascular and visceral SMCs during postnatal development and is transiently expressed in the heart and somites during embryogenesis. Analysis of the SM22alpha promoter in transgenic mice revealed that 280 bp of 5' flanking sequence is sufficient to restrict expression of the lacZ reporter gene to arterial SMCs and the myotomal component of the somites. DNase I footprint and electrophoretic mobility shift analyses revealed that the SM22alpha promoter contains six nuclear protein binding sites (designated smooth muscle elements [SMEs] -1 to -6, respectively), two of which bind serum response factor (SRF) (SME-1 and SME-4). Mutational analyses demonstrated that a two-nucleotide substitution that selectively eliminates SRF binding to SME-4 decreases SM22alpha promoter activity in arterial SMCs by approximately 90%. Moreover, mutations that abolish binding of SRF to SME-1 and SME-4 or mutations that eliminate each SME-3 binding activity totally abolished SM22alpha promoter activity in the arterial SMCs and somites of transgenic mice. Finally, we have shown that a multimerized copy of SME-4 (bp -190 to -110) when linked to the minimal SM22alpha promoter (bp -90 to +41) is necessary and sufficient to direct high-level transcription in an SMC lineage-restricted fashion. Taken together, these data demonstrate that distinct transcriptional regulatory programs control SM22alpha gene expression in arterial versus visceral SMCs. Moreover, these data are consistent with a model in which combinatorial interactions between SRF and other transcription factors that bind to SME-4 (and that bind directly to SRF) activate transcription of the SM22alpha gene in arterial SMCs.

Gene Structure of the Rat Kainate Receptor Subunit KA2 and Characterization of an Intronic Negative Regulatory Region

We have isolated and analyzed the structure of the gene grik5 (glutamate receptor ionotropic kainate 5), encoding the rat kainate receptor subunit KA2. Six overlapping DNA fragments containing the entire grik5 gene were identified in a rat genomic library. grik5 is a unique gene composed of 20 exons that together span over 54 kilobases (kb). Reporter gene analysis demonstrated that 2 kb of grik5 5'-flanking sequence confers tissue-specific expression on a chloramphenicol acetyltransferase gene in vitro. We show that (i) the first intron of grik5 (3.4 kb) inhibited transcription of the chloramphenicol acetyltransferase gene driven by the 2-kb grik5 5'-flanking region; (ii) the negative regulatory element was located within 500 bp of the 3'-end of intron 1, and this 500-bp fragment selectively bound nuclear proteins isolated from neural and nonneural cells; (iii) the effect of the negative regulatory element on grik5 transcription was orientation- and distance-independent; and (iv) a 24-nucleotide sequence (CTTTCTGTGGCCTCTGACCTTTCC) was identified as the binding site for nuclear proteins within the 500-bp fragment, as determined by footprinting and gel shift assays. We conclude that an intronic element that displays features of a silencer modulates grik5 transcription.

GATA-5: A Transcriptional Activator Expressed in a Novel Temporally and Spatially-Restricted Pattern during Embryonic Development

Members of the GATA family of zinc finger transcription factors regulate critical steps of cellular differentiation during vertebrate development. In the studies described in this report, we have isolated and functionally characterized the murine GATA-5 cDNA and protein and defined the temporal and spatial pattern of GATA-5 gene expression during mammalian development. The amino terminus of the mouse GATA-5 protein shares high level amino acid sequence identity with the murine GATA-4 and -6 proteins, but not with other members of the GATA family. GATA-5 binds to the functionally important CEF-1 nuclear protein binding site in the cardiac-specific slow/cardiac troponin C (cTnC) transcriptional enhancer and overexpression of GATA-5 transactivates the cTnC enhancer in noncardiac muscle cell lines. During embryonic and postnatal development, the pattern of GATA-5 gene expression differs significantly from that of other GATA family members. In the primitive streak embryo, GATA-5 mRNA is detectable in the precardiac mesoderm. Within the embryonic heart, the GATA-5 gene is expressed within the atrial and ventricular chambers (ED 9.5), becomes restricted to the atrial endocardium (ED 12.5), and is subsequently not expressed in the heart during late fetal and postnatal development. Moreover, coincident with the earliest steps in lung development, only the GATA-5 gene is expressed within the pulmonary mesenchyme. Finally, the GATA-5 gene is expressed in tissue-restricted subsets of smooth muscle cells (SMCs), including bronchial SMCs and SMCs in the bladder wall. These data are consistent with a model in which GATA-5 performs a unique temporally and spatially restricted function in the embryonic heart and lung. Moreover, these data suggest that GATA-5 may play an important role in the transcriptional program(s) that underlies smooth muscle cell diversity.

Characterization of Hepatic-specific Regulatory Elements in the Promoter Region of the Human Cholesterol 7α-Hydroxylase Gene

Cholesterol 7alpha-hydroxylase is the rate-limiting enzyme in the degradation of cholesterol to bile salts and plays a central role in regulating cholesterol homeostasis. The mechanisms involved in the transcriptional control of the human gene are largely unknown. HepG2 cells represent an appropriate model system for the study of the regulation of the gene. To identify liver-specific DNA sequences in the promoter of the human CYP7 gene, we first examined the DNase I hypersensitivity in the 5'-region of the gene. An area of hypersensitivity was observed in the region from -50 to -200 of the human gene in nuclei from transcriptionally active HepG2 cells, but was absent in transcriptionally inactive HeLa cell nuclei or in free DNA. Various 5'-promoter deletion constructs were made and transfected into HepG2 cells. About 300 base pairs of upstream sequence are required for high level promoter activity of the human CYP7 gene in HepG2 cells. DNase I footprinting of the hypersensitive region revealed nine protected sequences. Gel retardation experiments demonstrated binding of HNF-3 to the segment from -80 to -70 and of hepatocyte nuclear factor HNF-4 (and ARP-1) to the segment from -148 to -127 of the human CYP7 promoter. Deletion of either of these sites depressed promoter activity in HepG2 cells. A third region from -313 to -285 is bound by members of the HNF-3 family and acts as an enhancer. Additionally, the segment from -197 to -173 binds a negative regulatory protein that is present in Chinese hamster ovary cell extracts and in HepG2 cell extracts. These experiments define the key control elements responsible for basal transcription of the human CYP7 gene in HepG2 cells.

Sequence analysis of the putative viral enhancer in tissues from 33 cats with various feline leukemia virus-related diseases

Diseases resulting from infection by feline leukemia virus (FeLV) and several other retroviruses relate in part, to non-coding regulatory sequences within the viral long terminal repeat (LTR). Both enhancer repeats and mutations within the LTR have been implicated in FeLV-related disease. In order to investigate the relationship between nucleotide sequence of the FeLV LTR and disease, tissues from 33 cats with 7 different types of degenerative and proliferative FeLV-related disease were studied. An FeLV LTR region containing the putative transcriptional enhancer unit was amplified by polymerase chain reaction (PCR) from FeLV-infected tissues. Phylogenetic analysis of FeLV 3′ unique (U3) sequences revealed only one meaningful grouping which contained 4 of the 5 antigen-negative lymphosarcomas (LSAs). No sequence duplications were found in any of the 33 FeLV U3 regions. Point mutations relative to the corresponding region of FeLV-A/Glasgow, were identified at 102 positions; 68 of these were accounted for by mutations at 5 locations. Only 1 point mutation was found within the leukemia virus b-simian virus 40-like core (LVb-CORE) site. However, the nuclear factor 1 (NF1) site contained 11 mutations, and the FeLV-specific (FLV-1) site contained 26 mutations. Most of the remaining mutations were upstream of the LVb site or between the glucocorticoid response element (GRE) and FLV-1. The 10 LSAs, particularly the 5 antigen-negative LSAs, deviated least from the corresponding sequence for FeLV-A/Glasgow. Conclusions were that the spectrum of neoplastic and non-neoplastic FeLV-related diseases investigated in this study, developed in the presence of FeLVs containing the single enhancer unit. The significance of the point mutations is unknown, however, those occurring with high frequency and within nuclear protein binding sites should be first to be investigated in functional studies.

In Vivo Footprinting Analysis of the Hepatic Control Region of the Human Apolipoprotein E/C-I/C-IV/C-II Gene Locus

Expression of both the apolipoprotein (apo)E and apoC-I genes in the liver is specified by a 319-nucleotide hepatic control region (HCR-1) that is located 15 kilobase pairs downstream of the apoE gene and 5 kilobase pairs downstream of the apoC-I gene. In vivo footprint analysis of HCR-1 in intact nuclei revealed several liver-specific protein-binding sites that were not detectable by in vitro methods. In addition to three previously identified in vitro footprints, four in vivo footprints were identified in a region of HCR-1 that is required for directing gene expression to hepatocytes. Prominent liver-specific DNase I-hypersensitive sites were associated with these footprints. Liver-specific nuclear protein binding to these sites was confirmed by oligonucleotide gel-retention assays. The in vivo analysis also identified a cluster of nuclear protein-binding sites in the Alu family repeat segment adjacent to the domain required for liver expression. Micrococcal nuclease digestion indicated the presence of a nucleosome in the central domain of HCR-1 in liver chromatin that was in phase with the nucleosome location in tissues that did not express the transgene. These results suggest that HCR-1 functions in a highly structured chromatin environment requiring a complex interaction of liver-enriched transcription factors.

An H3 coding region regulatory element is common to all four nucleosomal classes of mouse histone-encoding genes

We have previously identified the α element within the mouse H2A and H3 histone gene coding region activating sequences (CRAS). This common element is required for normal in vivo expression of these two replication-dependent genes and interacts with nuclear factor(s). Here we report that the CRAS α element is present in the coding region sequences of two other replication-dependent mouse H genes, H2B and H4. The DNA-protein interactions were examined by DNase I footprinting and methylation-interference assays, and are very similar, if not identical, for these replication-dependent genes, confirming that the α element is the binding site for common nuclear protein(s) in H genes of all four nucleosomal classes. Moreover, we show that the same nuclear factor is involved in these DNA-protein interactions. Our findings, together with the fact that a replication-independent H gene, H3.3, has a mutated α element that fails to interact with nuclear proteins, suggest that this regulatory element is involved in the coordinate expression of the replication-dependent core H genes in the eukaryotic cell cycle.

Autoregulation of the human D1A dopamine receptor gene by cAMP.

Stimulation of the D1A dopamine receptor increases intracellular cAMP concentration and down-regulates the receptor protein. We evaluated the possibility that this second messenger system could affect the expression of the D1A gene as a positive autoregulatory mechanism. Treatment of the D1A-expressing cells SK-N-MC with 100 microM dopamine resulted in an initial increase in steady-state levels of the D1A mRNA beginning at 30 min, followed by decline below the baseline and then recovery by 24 hr. Forskolin/IBMX (100 microM each) treatment also resulted in a decline followed by recovery. To determine if these changes in D1A message levels are due to transcriptional control, transient expression assays were done using reporter gene constructs of the human D1A gene 5'-flanking region. Forskolin/IBMX treatment for 19 hr resulted in a four- to seven-fold increase in trans-activation of the human D1A gene promoter. Two cAMP-responsive regions in exon 1 of this gene with nuclear protein binding sites within both regions were identified. The segment of the D1A gene between these two cAMP-responsive regions contained two additional DNA-protein interaction sites, one of which bound to nuclear factors considerably stronger following forskolin/IBMX treatment. Several consensus sequences for classical transcription factors known to mediate the cAMP response, such as CREB, AP2, and AP1, are found in the human D1A gene. However, the location of all but one AP2 site in other parts of this gene and lack of AP2 expression in SK-N-MC cells suggest that these factors are unlikely to transduce this response. Thus, dopamine treatment results in delayed cAMP-mediated trans-activation of the D1A gene via an indirect mechanism.

GATA-6: A Zinc Finger Transcription Factor That Is Expressed in Multiple Cell Lineages Derived from Lateral Mesoderm

Members of the GATA family of zinc finger transcription factors play important roles in the development of several mesodermally derived cell lineages. In the studies described in this report, we have isolated and functionally characterized the murine GATA-6 cDNA and protein and defined the temporal and spatial patterns of GATA-6 gene expression during mammalian development. The GATA-6 and -4 proteins share high-level amino acid sequence identity over a proline-rich region at the amino terminus of the protein that is not conserved in other GATA family members. GATA-6 binds to a functionally important nuclear protein binding site within the cardiac-specific cardiac troponin C (cTnC) transcriptional enhancer. Moreover, the cTnC promoter enhancer can be transactivated by overexpression of GATA-6 in noncardiac muscle cells. During early murine embryonic development, the patterns of GATA-6 and -4 gene expression are similar, with expression of GATA-6 restricted to the precardiac mesoderm, the embryonic heart tube, and the primitive gut. However, coincident with the onset of vasculogenesis and development of the respiratory and urogenital tracts, only the GATA-6 gene is expressed in arterial smooth muscle cells, the developing bronchi, and the urogenital ridge and bladder. These data are consistent with a model in which GATA-6 functions in concert with GATA-4 to direct tissue-specific gene expression during formation of the mammalian heart and gastrointestinal tract, but performs a unique function in programming lineage-restricted gene expression in the arterial system, the bladder, and the embryonic lung.

Structure and Characterization of the 5′-Flanking Region of the Mouse Smooth Muscle Myosin Heavy Chain (SM1/2) Gene

We have previously shown that smooth muscle myosin heavy chain isoforms (SMs), including SM1, SM2, and SMemb, are differentially expressed during vascular development, and in vascular lesions, such as atherosclerosis. The SM1/2 gene is expressed exclusively in smooth muscle cells and generates SM1 and SM2 mRNAs by alternative splicing. Whereas SM1 is constitutively expressed from early development, SM2 appears only after birth. In this study, we have isolated and characterized the 5'-flanking region of the mouse SM1/2 gene. Transient transfection assays using a series of promoter-luciferase chimeric constructs demonstrated that tandem elements of the CCTCCC sequence, located at -89 and -61 bp relative to the transcription start site, were essential for transcriptional activity of the SM1/2 gene in primary cultured rabbit aortic smooth muscle cells and smooth muscle cell lines derived from the rabbit aorta but not in non-smooth muscle cells. Gel mobility shift assays indicated that CCTCCC was a binding site for nuclear proteins prepared from smooth muscle cells. Double-stranded oligonucleotides containing either the CACC box or the Sp1 consensus sequence efficiently competed with the CCTCCC elements for binding the nuclear extracts. Site-specific mutations of CCTCCC elements resulted in a significant reduction of the promoter activity. Moreover, CCTCCC elements are evolutionary conserved between mouse and rabbit. In conclusion, the results of this study indicate an important role for the interaction of the CCTCCC sequence with Sp1 or related factors in activating transcription from the SM1/2 gene promoter.

Binding sites for maize nuclear proteins in the subterminal regions of the transposable element Activator.

Genetic data suggest that transposition of the maize element Activator (Ac) is modulated by host factors. Using gel retardation and DNase I protection assays we identified maize proteins which bind to seven subterminal sites in both ends of Ac. Four DNase I-protected sites contain a GGTAAA sequence, the other three include either GATAAA or GTTAAA. The specificity of the maize protein binding to Ac was verified by using a synthetic fragment containing four GGTAAA motifs as probe and competitor in gel retardation assays. All seven binding sites are located within regions required in cis for transposition. A maize protein binding site with the same sequence has previously been identified in the terminal inverted repeats of the maize Mutator element. Thus, the protein, that recognizes this sequence is a good candidate for a regulatory host factor for Ac transposition.

The Myeloid-Cell-Specific c-fes Promoter Is Regulated by Sp1, PU.1, and a Novel Transcription Factor

The protein product of the c-fps/fes (c-fes) proto-oncogene has been implicated in the normal development of myeloid cells (macrophages and neutrophils). mRNA for c-fes has been detected exclusively in myeloid cells and vascular endothelial cells in adult mammals. Although a 13-kilobase-pair (kb) human c-fes transgene exhibits high levels of expression in mice, the sequences that confer myeloid-cell-specific expression of the human c-fes gene have not been defined. Transient-transfection experiments demonstrated that plasmids containing 446 bp of c-fes 5'-flanking sequences linked to a luciferase reporter gene were active exclusively in myeloid cells. No other DNA element within the 13-kb human c-fes locus contained positive cis-acting elements, with the exception of a weakly active region within the 3'-flanking sequences. DNase I footprinting assays revealed four distinct sites that bind myeloid nuclear proteins (-408 to -386, -293 to -254, -76 to -65, and -34 to +3). However, the first two footprints resided in sequences that were largely dispensable for transient activity. Plasmids containing 151 bp of 5'-flanking sequences confer myeloid-cell-specific gene expression. Electrophoretic mobility shift analyses demonstrated that the 151-bp region contains nuclear protein binding sites for Sp1, PU.1, and/or Elf-1, and a novel factor. This unidentified factor binds immediately 3' of the PU.1/Elf-1 sites and appears to be myeloid cell specific. Mutation of the PU.1/Elf-1 site or the 3' site (FP4-3') within the context of the c-fes promoter resulted in substantially reduced activity in transient transfections. Furthermore, transient-cotransfection assay demonstrated that PU.1 (and not Elf-1) can transactivate the c-fes promoter in nonmyeloid cell lines. We conclude that the human c-fes gene contains a strong myeloid-cell-specific promoter that is regulated by Sp1, PU.1, and a novel transcription factor.