BCR-ABL mRNA Levels Research Articles

A Canadian Expanded Access Trial of Oral Nilotinb in Adult Patients with Imatinib-Resistant or -Intolerant Chronic Myeloid Leukemia in Blast Crisis, Accelerated Phase or Chronic Phase

Abstract 4437This multi-center, open-label, single-arm study evaluated the safety and efficacy of nilotinib in patients with imatinib resistant/intolerant chronic myeloid leukemia (CML) in blast crisis, accelerated phase and chronic phase. This study provided expanded access to nilotinib prior to commercial availability. Methods:Patients received nilotinib orally at a dose of 400 mg twice daily. Adverse events were monitored throughout the study and assessments of cardiac, hematology and blood chemistry were performed every 3 months at a minimum. The efficacy assessments were performed every 6 months at a minimum and comprised of cytogenetic analysis of bone marrow, evaluation of extramedullary disease, and cancer related symptoms. Results:Sixty-five patients were enrolled in the study. The median age was 56 (range 21–85) years; 50.8% were male, and 89.2% Caucasian. The majority of patients (92.3%) were in chronic phase; 3.1% and 4.6% of the patients were in blast crisis and accelerated phase respectively. Twenty-five (38.5%) patients were imatinib-resistant, thirty-seven (56.9%) imatinib-intolerant and three (4.6%) both imatinib-resistant and -intolerant. The overall median duration of treatment with nilotinib was 27.2 (range 0.3 – 48.8) months. Thirty-six patients (55.4%) were still on treatment at study end. The main reasons for discontinuation were adverse events (16.9%) and unsatisfactory therapeutic effect (12.3%).Treatment related adverse events reported in at least 10% of patients, irrespective of severity, included rash (23.1%), pruritus (20%), fatigue (18.5%), muscle spasms (15.4%), headache (16.9%), alopecia (13.8%), abdominal pain (10.8%) and lipase elevation (10.8%). Grade 3 and 4 adverse events reported in at least 5% of patients, irrespective of study drug relationship, included thrombocytopenia (12.3 %), anemia (6.2%), neutropenia (6.2%) and lipase elevation (6.2%). Three patients (4.6%) discontinued due to cardiac disorders including tachycardia (1), myocardial infarction (1), and palpitations (1). Clinically significant abnormal ECG results were uncommon and mostly transient. There was no evidence of toxicity to a major organ system. One patient died within 28 days after study discontinuation due to progression of recently diagnosed multiple myeloma and chronic obstructive pulmonary disease deterioration not suspected to be related to study drug.Thirty patients received treatment for at least 30 months with nilotinib on study. At month 30, 14 (82.4%) of 17 patients who underwent a bone marrow aspirate achieved a complete cytogenetic response. Seven of these fourteen patients (50%) had never previously achieved complete cytogenetic response with imatinib. Conclusions:This phase IIIB trial provided nilotinib to 65 patients with imatinib-resistant or -intolerant chronic CML in all phases on expanded access for 44 months, allowing evaluation of its safety profile. Nilotinib treatment was reasonably well-tolerated with an overall safety profile similar to that reported in previous studies, without the occurrence of unexpected adverse events. Real-time quantitative RT-PCR of BCR-ABL mRNA levels was not a study endpoint but is used routinely in Canada to monitor patients in complete cytogenetic response instead of cytogenetic assessments which likely explains the low compliance with cytogenetic assessments in this study. Disclosures:Turner:Novartis Pharmaceuticals Canada: Research Funding, Speakers Bureau. Leber:Novartis Pharmaceuticals: Membership on an entity's Board of Directors or advisory committees, Speakers Bureau. Hasegawa:Novartis Pharmaceuticals: Membership on an entity's Board of Directors or advisory committees. Leitch:Novartis Pharmaceuticals: Honoraria, Membership on an entity's Board of Directors or advisory committees. Bence-Bruckler:Novartis Pharmaceuticals: Membership on an entity's Board of Directors or advisory committees. Sandeep:Novartis Pharmaceuticals: Honoraria. Laneuville:Novartis Pharmaceuticals: Consultancy, Honoraria, Membership on an entity's Board of Directors or advisory committees, Speakers Bureau. Woo:Novartis Pharmaceuticals Canada Inc.: Employment. Beauparlant:Novartis Pharmaceuticals Canada Inc: Employment. Lipton:Novartis Pharmaceuticals Canada Inc: Honoraria, Membership on an entity's Board of Directors or advisory committees.

Monitoring twenty-six chronic myeloid leukemia patients by BCR-ABL mRNA level in bone marrow:a single hospital experience.

Chronic myeloid leukemia (CML) is caused by the BCR-ABL oncogene. The Philadelphia chromosome (Ph) from a reciprocal translocation, t(9;22) (q34;q11) causes a fusion gene, BCR-ABL, that encodes a constitutively active tyrosine kinase. Treatment of CML by imatinib is effective to control the tyrosyl phosphorylation of the protein related to the cell signaling. BCR-ABL mRNA is overexpressed in the minimal residual disease (MRD), known as an early sign of relapse. Between December 2005 and June 2008, we measured BCR-ABL mRNA levels in the bone marrow (BM) from patients by quantitative real-time polymerase chain reaction (RQ-PCR) in Aomori Prefectural Central Hospital. Eighty-six samples from 26 patients were collected. Among the 26 CML patients, 11 patients (42%) were in the pretreatment group. Seven (64%) of the 11 patients achieved complete molecular response (CMR). In the post-treatment group consisting of the remaining 15 patients, 9 (60%) patients achieved CMR. The patients receiving imatinib at a dose over 300 mg per day required 13 (6-77) months [median (range)] to achieve CMR. On the other hand, the patients receiving a dose below 300 mg per day required 29.5 (11-84) months [median (range)]. When BCR-ABL mRNA was detected during the treatment course of patients with CMR, careful observation of BCR-ABL mRNA was useful for tracking the clinical course of patients. In conclusion, the BCR-ABL mRNA level was useful for monitoring the clinical course in 26 patients with CML.

Establishment of the first World Health Organization International Genetic Reference Panel for quantitation of BCR-ABL mRNA

Serial quantitation of BCR-ABL mRNA levels is an important indicator of therapeutic response for patients with chronic myelogenous leukemia and Philadelphia chromosome-positive acute lymphoblastic leukemia, but there is substantial variation in the real-time quantitative polymerase chain reaction methodologies used by different testing laboratories. To help improve the comparability of results between centers we sought to develop accredited reference reagents that are directly linked to the BCR-ABL international scale. After assessment of candidate cell lines, a reference material panel comprising 4 different dilution levels of freeze-dried preparations of K562 cells diluted in HL60 cells was prepared. After performance evaluation, the materials were assigned fixed percent BCR-ABL/control gene values according to the International Scale. A recommendation that the 4 materials be established as the first World Health Organization International Genetic Reference Panel for quantitation of BCR-ABL translocation by real-time quantitative polymerase chain reaction was approved by the Expert Committee on Biological Standardization of the World Health Organization in November 2009. We consider that the development of these reagents is a significant milestone in the standardization of this clinically important test, but because they are a limited resource we suggest that their availability is restricted to manufacturers of secondary reference materials.

Hedgehog Signaling Is Useful as a Novel Molecular Marker for Predicting Relapse and Resistance During Chronic Myeloid Leukemia Treatment.

AbstractAbstract 1215Chronic myeloid leukemia (CML) is a clonal myeloproliferative disorder characterized by the expansion of a Leukemic Stem Cell (LSC) clone carrying a Philadelphia translocation, which outgrows the non-malignant haematopoietic stem cells. The tyrosine kinase inhibitors (TKIs) imatinib, nilotinib and dasatinib, are the gold standard for CML treatment since each one shows an impressive rates of complete cytogenetic and molecular response in chronic phase (CP) CML. However the major problem concerning the final efficacy of TKIs therapy is that the majority of responding CP CML patients have detectable BCR-ABL transcripts which might arise from a population of quiescent CML LSC not effectively targeted by TKIs. Therefore the molecular monitoring not always provide a sufficiently precise evaluation of patients to allow the appropriate choice of clinical interventions. Accordingly, it is necessary to monitor the appearance and increase of LSCs to identify and to treat quickly the fundamental responsible for relapse. Thus, we focused Hedgehog (Hh) signalling which has been proved essential for maintenance of cancer stem cells in myeloid leukaemia. Notably recent studies reported that the expansion of BCR-ABL positive leukemic stem cell is dependent on Hh pathway activation. Here, we analyzed the mRNA levels of Smoothened (SMO), a seven-transmembrane domain receptor protein, and Ptch1, a surface receptor regulator of SMO, in 20 CP-CML patients (8 High, 4 Intermediate and 8 Low Sokal Risk respectively) at diagnosis and during the follow-up. Using RT-PCR, in diagnosis setting, we proved that 60% of patients (bone marrow samples) showed Hh signalling significantly activated compared to CD34+ cells from healthy donors. In detail 75% (6/8) of High Sokal Risk CML patients showed an up-regulation of Smo and a down-regulation of Ptch1 mRNA levels, suggestive of active Hh signalling at diagnosis. Conversely Low and Intermediate Sokal Risk CML patients did not show features of Hh activation. Finally we monitored, during the follow-up, the mRNA levels of Smo and Ptch1 together with BCR-ABL to assess the kind of relationship between these parameters. Interestingly we noticed a direct correlation between the increase of BCR-ABL mRNA levels and signs of Hh activity (Smo mRNA increase level and Ptch1 mRNA decrease level). Characteristically, molecular monitoring highlighted that all patients developing resistance to TKIs treatment, showed a tendency to Hh activation (high and low mRNA levels of Patch1 and Smo respectively) few months before the development of Abl KD mutation (10/10). Typically this last behaviour was more evident in patients developing the gatekeeper mutation T315I. Finally, in accordance with published data, we noted that the pharmacological inhibition of Hh signalling impairs the growth of TKIs resistant human CML cell line BaF/T315I, suggesting a novel treatment option. All our data provide molecular evidence for a role of the stemness pathway to predict quickly both the relapse and the TKIs resistance during CML treatment. Therefore, we propose to use Ptch1 and Smo mRNA levels together with BCR-ABL for the molecular monitoring of CP CML. Disclosures:No relevant conflicts of interest to declare.

Additive Effects of Anti-Leukemia Capacity by Gfi-1B- and Bcr-Abl-Specific siRNA In Advanced Chronic Myeloid Leukemic Cells

AbstractAbstract 4466 Background:Growth factor independent-1B (Gfi-1B) is a transcription factor with six C2H2 zinc fingers and one unique N-terminal SNAG (Snail/Gfi-1) transcriptional repressor domain. The Gfi-1B gene was mapped to chromosome 9q34.13 and is so located downstream the bcr-abl translocation in chronic myeloid leukemia (CML) cells. Selective inhibition of the BCR-ABL tyrosine kinase by RNA interference has been demonstrated in leukemic cells. Therefore, we evaluated the specific bcr-abl small inferring RNA (siRNA) and gfi-1B siRNA silencing in K562 cells and in primary CML cells with myeloid blast crises. Method:For in vitro transfection with gfi-1B siRNA, a total of 175 pM gfi-1B siRNA, No. AF 081946 was added to 1×10E5 cells and transfection was performed as previously described by us. Sequences of siRNA directed against the BCR-ABL transcript were published previously by Scherr (Blood 2003) and transfection with 54 pM bcr-abl siRNA were preformed as described for gfi-1B siRNA. As control we used two or more non-silencing siRNA (mismatched or scrambled siRNA) from Qiagen. Result:Using fluorescence marked non-silencing siRNA (Qiagen) we evaluated either the transfection rate in K562 cells and in primary CML cells. At mean (± standard deviation) we found a transfection rate of 69.4 ± 5.7% in K562 cells and 45.8 ± 12.8% in primary CML cells. The bcr-abl siRNA or the combination with both siRNAs revealed the strongest effects in reducing the viability of K562 cells by 28.5 to 5.3 % (mean) compared to controls (controls were set up to 100%). The gfi-1B siRNA reduced the viability of these cells by 49.8 % after the start of transfection. To confirm that cell growth is dependent on the timing of siRNA silencing, we next investigated the time course of the cotransfection of bcr-abl siRNA and gfi-1B siRNA induced effects in K562 cells. A strong reduction of cell growth to 21.9 + 4.5% compared to the rate of spontaneous viable cells in K562 cells was observed after 24 h of siRNA transfection, which was statistically significant (p<0.0001). We further observed a strong inhibition of cell growth to 5.3 + 1.8% (p<0.0001) compared to the cell growth rate after 48 h of cotransfection with these above siRNAs. After 72 h of the cotransfection of bcr-abl siRNA and gfi-1B siRNA no further reduction of cell growth was measured in K562 cells, in fact cell growth increased to 8.6 + 3.2% compared to the spontaneous cell growth rate. The combination of both bcr-abl siRNA and gfi-1B siRNA reduced the bcr-abl mRNA level to 2 fold higher comparing the amount after bcr-abl siRNA alone (p<0.0001). Cotransfection with bcr-abl siRNA and gfi-1B siRNA resulted in an exaggerated decrease of proliferation rate to 9.9 + 1.7% compared to controls. The inhibitory efficiency of bcr-abl siRNA and gfi-1B siRNA has shown a 3-fold increasing result comparing to bcr-abl siRNA alone and a 5-fold increasing effect comparing to gfi-1B siRNA alone. Concordantly, we observed an additive effect on induction of apoptosis by cotransfection of bcr-abl siRNA and gfi-1B siRNA in K562 cells. The rate of induced apoptosis increased from 1 + 0.09 (controls set to 1.0) to 3.3 + 0.2, whereas the use of either bcr-abl siRNA alone or gfi-1B siRNA alone was again less effective. In order to verify the above anti-leukemic results, we assessed bcr-abl siRNA and gfi-1B siRNA transfection in primary cells from patients with blast crisis of CML. We found either a reduction of the bcr-abl mRNA- and of the gfi-1B mRNA amount in these advanced CML patients compared to untreated controls. Furthermore we found in primary CML cells a strongly decreased level of c-myc gene expression after cotransfection with bcr-abl siRNA and gfi-1B siRNA to 65% compared to controls. Conclusion:Our data suggested that silencing by both bcr-abl siRNA and gfi-1B siRNA may be associated with an additive antileukemic activity against K562 cells and in primary CML cells in myeloid blast crises, and might be a suitable target to treated advanced CML. Disclosures:No relevant conflicts of interest to declare.

Sensitive detection and quantification of minimal residual disease in chronic myeloid leukaemia using nested quantitative PCR for BCR‐ABL DNA

Increasing numbers of patients with chronic myeloid leukaemia (CML) treated with tyrosine kinase inhibitors achieve undetectable levels of BCR-ABL mRNA using sensitive quantitative real-time reverse transcriptase PCR (RT-qPCR) methods and a method to measure minimal residual disease (MRD) in patients with low levels could be of value. Following isolation and sequencing of the patient-specific BCR-ABL breakpoint, a DNA-based nested qPCR assay was established, and MRD was measured by this method and one-round RT-qPCR in 38 samples from 24 patients with CML. Mixing experiments using patient DNA in normal DNA indicated that DNA qPCR could detect BCR-ABL sequences at a limit of approximately 10⁻⁶. In 22 samples in which MRD was detectable by both methods, comparison of the results of DNA qPCR with the results obtained on the same sample by RT-qPCR showed good correlation. In another 16 samples, BCR-ABL mRNA was not detectable by RT-qPCR. In 8 of the 16 samples, BCR-ABL DNA was detected at levels ranging from 1.1 × 10⁻⁵ up to 2.8 × 10⁻⁴ and in the remaining eight samples BCR-ABL was not detected by either method. In one patient, who had stopped imatinib, an almost 1000-fold rise in MRD, to 5.2 × 10⁻⁴ was observed in sequential samples. Nested DNA qPCR was more sensitive than one-round RT-qPCR and could be used for the monitoring of patients with CML with very low levels of MRD.

Co‐encapsulation of anti‐BCR‐ABL siRNA and imatinib mesylate in transferrin receptor‐targeted sterically stabilized liposomes for chronic myeloid leukemia treatment

Chronic myeloid leukemia (CML) is triggered by the BCR-ABL oncogene. Imatinib is the first-line treatment of CML; however imatinib resistance and intolerance have been detected in many patients. Therefore, new therapeutic approaches are required. The present work aimed at the development and application of transferrin receptor (TrfR) targeted liposomes co-encapsulating anti-BCR-ABL siRNA and imatinib at different molar ratios. The encapsulation yields and drug loading of each molecule was evaluated. Anti-leukemia activity of the developed formulations co-encapsulating siRNA and imatinib and of the combination of Trf-liposomes carrying siRNA and free imatinib under two different treatment schedules of pre-sensitization was assessed. The results obtained demonstrate that the presence of imatinib significantly decreases the encapsulation yields of siRNA, whereas imatinib encapsulation yields are increased by the presence of siRNA. Cytotoxicity assays demonstrate that the formulations co-encapsulating siRNA and imatinib promote a 3.84-fold reduction on the imatinib IC(50) (from 3.49 to 0.91 µM), whereas a 8.71-fold reduction was observed for the pre-sensitization protocols (from 42.7 to 4.9 nM). It was also observed that the formulations with higher siRNA to imatinib molar ratios promote higher cell toxicity. Thus, the present work describes a novel triple targeting strategy with one single system: cellular targeting (through the targeting ligand, transferrin) and molecular targeting at the BCR-ABL mRNA and Bcr-Abl protein level.

WT1 peptide vaccine induces reduction in minimal residual disease in an Imatinib‐treated CML patient

How to treat CML patients who are resistant to inhibitors of BCR-ABL tyrosine kinase such as Imatinib is a very important and urgent issue in clinical hematology. Here, we report a case of Imatinib-treated CML in which intradermally administered WT1 peptide vaccine elicited WT1-specific immune responses and the resultant reduction in the persistent residual disease in co-administration of Imatinib. BCR-ABL mRNA levels were being maintained under the detection limit for 8 months since week 77 of vaccination. No adverse effects except local erythema at the injection sites were observed. The tetramer assay revealed that the decrease in BCR-ABL mRNA levels was associated with the increase in frequency of WT1-specific cytotoxic T lymphocytes, notably effector-memory type of that, in the patient's peripheral blood. The case presented here indicates that WT1 peptide vaccine may become a safe and cure-oriented therapy for CML patients who have residual disease regardless of the treatment with Imatinib.

Pristimerin induces apoptosis in imatinib-resistant chronic myelogenous leukemia cells harboring T315I mutation by blocking NF-κB signaling and depleting Bcr-Abl

BackgroundChronic myelogenous leukemia (CML) is characterized by the chimeric tyrosine kinase Bcr-Abl. Bcr-Abl-T315I is the notorious point mutation that causes resistance to imatinib and the second generation tyrosine kinase inhibitors, leading to poor prognosis. CML blasts have constitutive p65 (RelA NF-κB) transcriptional activity, and NF-κB may be a potential target for molecular therapies in CML that may also be effective against CML cells with Bcr-Abl-T315I.ResultsIn this report, we discovered that pristimerin, a quinonemethide triterpenoid isolated from Celastraceae and Hippocrateaceae, inhibited growth and induced apoptosis in CML cells, including the cells harboring Bcr-Abl-T315I mutation. Additionally, pristimerin inhibited the growth of imatinib-resistant Bcr-Abl-T315I xenografts in nude mice. Pristimerin blocked the TNFα-induced IκBα phosphorylation, translocation of p65, and expression of NF-κB-regulated genes. Pristimerin inhibited two steps in NF-κB signaling: TAK1→IKK and IKK→IκBα. Pristimerin potently inhibited two pairs of CML cell lines (KBM5 versus KBM5-T315I, 32D-Bcr-Abl versus 32D-Bcr-Abl-T315I) and primary cells from a CML patient with acquired resistance to imatinib. The mRNA and protein levels of Bcr-Abl in imatinib-sensitive (KBM5) or imatinib-resistant (KBM5-T315I) CML cells were reduced after pristimerin treatment. Further, inactivation of Bcr-Abl by imatinib pretreatment did not abrogate the TNFα-induced NF-κB activation while silencing p65 by siRNA did not affect the levels of Bcr-Abl, both results together indicating that NF-κB inactivation and Bcr-Abl inhibition may be parallel independent pathways.ConclusionTo our knowledge, this is the first report to show that pristimerin is effective in vitro and in vivo against CML cells, including those with the T315I mutation. The mechanisms may involve inhibition of NF-κB and Bcr-Abl. We concluded that pristimerin could be a lead compound for further drug development to overcome imatinib resistance in CML patients.

Sustained Molecular Response With Interferon Alfa Maintenance After Induction Therapy With Imatinib Plus Interferon Alfa in Patients With Chronic Myeloid Leukemia

Imatinib induces sustained remissions in patients with chronic myelogenous leukemia (CML), but fails to eradicate CML stem cells. This is of major concern regarding the issues of cure, long-term imatinib tolerability, and imatinib resistance. We therefore asked whether interferon alfa-2a (IFN) alone could maintain molecular remissions achieved by a prior combination therapy with imatinib and IFN. Imatinib therapy was stopped in 20 patients who had concomitantly been pretreated with imatinib and IFN for a median of 2.4 years (range, 0.2 to 4.8 years) and 2.5 years (range, 0.2 to 4.9 years), respectively. After imatinib discontinuation, remission status was monitored monthly by quantitative analysis of the peripheral-blood BCR-ABL mRNA levels using real-time polymerase chain reaction. Proteinase-3 expression and proteinase-3-specific cytotoxic T cells (CTLs) were longitudinally measured to assess putative markers of IFN response. With a median time of 2.4 years after imatinib withdrawal (range, 0.5 to 4.0 years), 15 (75%) of 20 patients remained in remission. The number of patients in complete molecular remission increased under IFN from two patients at baseline to five patients after 2 years. Relapses occurred in five patients within 0.4 years (range, 0.2 to 0.8 years), but patients underwent rescue treatment with imatinib, re-establishing molecular remission. IFN therapy was associated with an increase in the expression of leukemia-associated antigen proteinase 3 and induction of proteinase-3-specific CTLs. Treatment with IFN enables discontinuation of imatinib in most patients after prior imatinib/IFN combination therapy and may result in improved molecular response. Induction of a proteinase-3-specific CTL response by IFN may contribute to this effect.

Transferrin Receptor-Targeted Liposomes Encapsulating anti-BCR-ABL siRNA or asODN for Chronic Myeloid Leukemia Treatment

The present work aimed at the development and application of transferrin receptor (TrfR)-targeted sterically stabilized liposomes encapsulating anti-BCR-ABL siRNA or asODN. Transferrin was coupled to the surface of liposomes encapsulating siRNA or asODN through the postinsertion method. Cell association and internalization were assessed by flow cytometry and confocal microscopy, respectively. BCR-ABL mRNA and Bcr-Abl protein levels were evaluated by qRT-PCR and Western blot, respectively. Cell viability was assessed using the resazurin reduction method. The amount of coupled transferrin and the size and stability over time of the liposomes were very satisfactory and reproducible. The siRNA encapsulation yield was dependent on the concentration of the encapsulation buffer used (20 or 300 mM), as opposed to asODN encapsulation yield which was high for both concentrations tested. Cell association and internalization studies were performed in leukemia cell lines treated with liposomes coupled to Trf (Trf-liposomes) or albumin (BSA-liposomes) or with nontargeted liposomes (NT-liposomes) encapsulating fluorescently labeled siRNA (Cy3-siRNA). These experiments clearly indicated that BSA- and NT-liposomes have no ability to promote the delivery of the encapsulated nucleic acids and that the Trf-liposomes deliver the nucleic acids by a Trf receptor-dependent mechanism. The Trf-liposomes encapsulating siRNA or asODN promote sequence-specific down-regulation of the BCR-ABL mRNA, although a certain extent of nonspecific sequence effects at the protein and cell viability level were observed. Overall, our results indicate that Trf-liposomes encapsulating gene silencing tools allow combining molecular and cellular targeting, which is a valuable approach for cancer treatment.

Reversal of Multidrug-Resistance in Human Leukemia Cell Line K562/A02 by Tyrosine Kinase Inhibitors.

Abstract 4828 ObjectiveThis study was aimed to investigate the reversible effect of tyrosine kinase inhibitors(TKI)on Multidrug resistance cell line K562/A02. MethodsThe expression levels of mdr-1 mRNA and bcr-abl mRNA were assayed by RT-PCR. The protein levels of P-glycoprotein (P-gp) and P210 were detected by Western blot. The DNR accumulation of K562/A02 cells were analyzed by flow cytometry (FCM). ResultsAnalysis of the inhibition rate showed that 0.0625μmol/L Imatinib or 5nM Nilotinib alone had no effect on the inhibition of K562/A02 cells. The fluorescence intensity of intracellular DNR of Imatinib, Nilotinib in K562/A02 cells was 7.85%, 12.02% (respectively of that in K562 cells). Imatinib or Nilotonib alone could decrease the mdr-1 mRNA and bcr-abl mRNA expression levels (Imatinib 0.65±0.02, 0.87±0.02; Nilotinib 0.48±0.04, 0.73 ±0.02) respectively, all these of which were significantly lower than the K562/A02 cells group 0.96±0.01, 1.87±0.04. The P-gp and P210 protein expression levels were also down after treated with different drugs (Imatinib 0.74±0.02, 0.68±0.01; Nilotinib 0.61±0.05, 0.60±0.01; the K562/A02 cells group 0.93±0.01, 1.25±0.03). ConclusionIt is concluded that multidrug resistance (MDR) can be partially reversed by Imatinib or Nilotinib. The effect of Nilotinib was greater than Imatinib. DisclosuresNo relevant conflicts of interest to declare.

To Study the Proliferative Inhibition of Anticancer Drug in Two Kinds of Ph (+) Leukemia Cell Lines.

Abstract 4110 ObjectiveTo study the proliferative inhibition of imatinib, daunorubicin and bortezomib in two kinds of Ph(+) leukemia cell lines: chronic myelogenous leukemia cell line K562 expressing P210 protein and acute lymphoblastic leukemia cell line SUP-B15 expressing P190 protein. Methods(1) Cell proliferation with imatinib, daunorubicin and bortezomib for 72 hours was analyzed by the MTT assay and displayed by growth curve and IC50 value. (2) The change of bcr-abl gene mRNA levels after the 48 hours' intervention of imatinib (final concentration at 0μM, 0.35μM, 1 μM) was detected by reverse transcription polymerase chain reaction (RT-PCR). Results(1) The IC50 values of K562 and SUP-B15 cells inhibited by imatinib, daunorubicin and bortezomib for 72 hours was respectively 0.286±0.06 (μmol/L), 0.303±0.009 (μmol/L), 22.127±3.592 (nmol/L) and 1.387±0.180(μmol/L), 0.117±0.017 (μmol/L), 12.350±0.740 (nmol/L), which indicated that the K562 cell line was the more sensitive to imatinib than SUP-B15 cell line, whereas the SUP-B15 cell line had the more sensitivity to daunorubicin and bortezomib. (2) There was no change of bcr-abl gene expression after the 48 hours' intervention of imatinib in both cell lines. Conclusion(1) Imatinib, daunorubicin and bortezomib had good anti-cancer effect to Ph+ leukemia cells in vitro. What's more, the K562 cell was the more sensitive to imatinib and only imatinib will have good effect on chronic myelogenous leukemia. Whereas the SUP-B15 cell had the more sensitivity to daunorubicin and bortezomib and combining imatinib with daunorubicin or bortezomib, the effect will be better on Ph(+) acute lymphoblastic leukemia. (2) The short time intervention of imatinib had no effect on the bcr-abl gene expression and imatinib could need long time to show curative effect for the Ph+ leukemia. Disclosures:No relevant conflicts of interest to declare.

Molecular Monitoring of Residual Disease in Chronic Myeloid Leukemia by Genomic DNA Compared with Conventional mRNA Analysis

Translocation t(9;22), which produces the BCR-ABL gene, is pathognomonic of chronic myeloid leukemia. For clinical purposes, the amount of chimeric transcript is considered proportional to the leukemic clone; thus, mRNA is commonly used for molecular monitoring of patients. However, there is no consensus regarding the degree of increase in mRNA that should cause concern or whether the absence of transcript indicates a "cure." In this study, we analyzed 57 samples from 10 chronic myeloid leukemia patients undergoing imatinib treatment. For each sample, we compared BCR-ABL mRNA levels with the actual proportion of leukemic cells, which were measured through a novel genomic approach based on the quantitative amplification of DNA breakpoints. The two approaches gave similar patterns of residual disease, and the majority of patients were still positive after an average treatment period of 2 years. Nevertheless, in one of two patients with confirmed undetectable levels of chimeric transcript, DNA still revealed the persistence of leukemic cells at 42 months. These findings appear to justify the clinical practice of maintaining imatinib treatment indefinitely. However, the absence of leukemic DNA (observed in 1 of 10 patients) could be used to identify possible candidates for drug discontinuation. In conclusion, DNA analysis proved to be a reliable index of residual disease with potential applications in the field of clinical diagnostics and research.

Triptolide Inhibits Bcr-Abl Transcription and Induces Apoptosis in STI571-resistant Chronic Myelogenous Leukemia Cells Harboring T315I Mutation

Resistance to STI571 is an emerging problem for patients with chronic myelogenous leukemia (CML). Mutation in the kinase domain of Bcr-Abl is the predominant mechanism of the acquired resistance to STI571. In the present study, we investigated the effect of triptolide on cell survival or apoptosis in CML cells bearing Bcr-Abl-T315I or wild-type Bcr-Abl. CML cell lines (KBM5 versus KBM5-T315I, BaF3-Bcr-Abl versus BaF3-Bcr-Abl-T315I) and primary cells from CML patients with clinical resistance to STI571 were treated with triptolide, and analyzed in terms of growth, apoptosis, and signal transduction. Nude mouse xenograft model was also used to evaluate the antitumor activity. Triptolide potently down-regulated the mRNA and protein levels of Bcr-Abl independently of the caspase or proteosome activation in CML cells. It induced mitochondrial-dependent apoptosis in Bcr-Abl-T315I CML cells and primary cells from CML patients with clinical resistance to STI571. Additionally, triptolide inhibited the growth of STI571-sensitive KBM5 and STI571-resistant KBM5-T315I CML cells in nude mouse xenografts. Triptolide also down-regulated the expression of survivin, Mcl-1, and Akt in CML cells, which suggests that it may have multiple targets. These findings suggest that triptolide is a promising agent to overcome STI571-resistant CML cells, and warrant a clinical trial of triptolide derivatives for CML with Bcr-Abl-T315I mutation.

Killing K562 cells by RNA interference compared with imatinib

Objective To compare RNA interference (RNAi) with imatinib in killing K562 cells. Methods Design effective shRNA sequences special for bcr-abl silencing and insert them into the eukaryotic expression vector for RNAi by gene engineering. The recombinant plasmi(ts were then transfected into K562 cells. 48 hours later, the efficiency of transfection was identified by fluorescent microscope, bcr-abl mRNA level was detected by RT-PCR. Another group of K562 cells were treated respectively by imatinib with different concentration. All groups of K562 cells were finally analyzed in apoptosis, cell proliferation and phosphotyrosine-containing proteins. Results Both RNAi and imatinib induced apoptosis, decreased proliferation and reduced phosphotyrosine-containing proteins. Conclusion BNAi can kill K562 cells successfully as imatinib, and it may be a promising way to treat CML patients in clinic, especially for those who fail in imatinib or other chemotherapy. Key words: Leukemia,myeloid,chronic; K562 cells; RNA interference; Fusion proteins,bcr-abl

Methanolic Extract of Cynara Cardunculus L. Inhibits Cell Proliferation and Bcr/Abl Expression in K562 Cell Line

Introduction: Chronic myeloid leukaemia (CML) is a myeloid neoplasm defined by the Bcr/Abl oncoprotein that is considered essential for leukaemogenesis and accumulation of neoplastic cells. Evidence exists showing that extracts of antichoke Cynara cardunculus L. (CCE) are able to inhibit cancer cell growth in vitro (1). In the present study we have investigated the antiproliferative effect of methanolic extract of CEE on K562 Bcr-Abl positive leukemia cell line. In addition we evaluated whether the extract of CEE also affects the mRNA levels of Bcr-Abl and p210 expression in this cell line.Materials and Methods:Preparation of methanolic extract of CEE. The aerial parts of CEE were air dried until dryness at room temperature, cut into small pieces and then extracted with methanol through maceration (48 h for 3 times). The resultant total extracts were dried under reduced pressure and their weight was determined.Cell culture. The K562 cells were grown in RPMI 1640 with L-glutamine supplemented with 10% (v/v) heat-inactivated FBS, 1% penicillin/streptomycin in humidified atmosphere of 5% CO2 at 37°C. In all experiments growing cells at optimal concentration were placed in 24 or 96 well plate and then treated with vehicle or 5–100–200 μg/ml methanolic extract of CEE. 48h after the treatment cultures were tested for proliferative activity, mRNA level of Bcr-Abl by RT-PCR and p210 protein expression by western blotting analysis.Proliferative activity. Proliferative activity was determined using the MTT technique according to the method described by Tubaro et al. (1996). The assay was performed in triplicate and absorbance values at 550 nm were measured using a microplate reader.RT-PCR Analysis. The total cellular mRNA was isolated from treated and control cells using an silica coloumns. Using equal amounts of the RNA from each sample, the cDNA was synthesized by Superscript VILO™ cDNA kit. PCR was performed using Platinum® Taq DNA polymerase and specific primers for t(9;22) p210 transcripts (b3a2): GAAGTGTTTCAGAAGCTTTCC (sense) and GTTTGGGCT-TCACACCATTCC (antisense). 35 amplification cycles were performed at 94°C for 30s, 55°C for 30s and 72°C for 1min. Gel electrophoresis and ethidium bromide staining was used to visualize the PCR products.Western Blot Analysis. Cell pellets from control and treated cultures were lysed using lysis buffer with protease and phosphatase inhibitors. The proteins were then quantified and equal amounts (30 ug) were separated by SDS-PAGE and electro-blotted to nitrocellulose. After blocking procedure the blots were incubated with specific primary antibody against p210 protein and then challenged with specific horseradish peroxidase-conjugated secondary antibody. The reactive protein was visualized using an enhanced chemiluminescence detection system.Results: The results have shown that treatment of K562 cell line with methanolic extract of CEE reduced cell viability in a dose-dependent fashion (IC50=41.7 μg/ml) as demonstrated by MTT assay. PCR and Western blot analysis revealed that the cell growth inhibition was associated to a dramatic decrease of mRNA levels of Bcr-Abl and to a significant reduction of p210 protein expression suggesting that the antiproliferative effect of methanolic extract of CEE likely due to the inhibition at transcriptional level of Bcr-Abl oncoprotein. Further studies are needed to better elucidate this mechanisms and to identify the compound of crude extract which is responsible of cancer growth suppression.

Dasatinib-Associated Major Molecular Responses Are Rapidly Achieved in Patients with Chronic Myeloid Leukemia in Chronic Phase (CML-CP) Following Resistance, Suboptimal Response, or Intolerance on Imatinib.

Dasatinib (SPRYCEL®) is a highly potent BCR-ABL inhibitor, with 325-fold higher potency than imatinib and a 16-fold higher potency than nilotinib in vitro. Across a series of phase II and III trials with more than 2 years of follow-up, dasatinib has demonstrated durable efficacy in patients with CML following resistance, suboptimal response, or intolerance to imatinib. Qualitative and quantitative assessment of BCR-ABL transcripts by RT-PCR is the most sensitive method for assessing minimal residual disease in patients with CML. In the treatment of patients with CML in the first-line setting, achievement of a major molecular response (MMR) within 18 months of therapy is considered to be clinically important. Here, molecular responses to dasatinib in patients with CML-CP following resistance, suboptimal response, or intolerance to imatinib were analyzed using data from two phase II studies (CA180-013 [START-C], -017 [START-R]) and a phase III dose-optimization study (CA180-034). BCR-ABL mRNA levels were determined in peripheral blood samples using real-time quantitative PCR and results were standardized using the international scale. A MMR was defined as a reduction of BCR-ABL transcripts to ≤ 0.1%. Samples were assayed at one of four laboratories (Mannheim, Germany; Adelaide, Australia; or Seattle, USA for −013 and −017; and Wallingford, USA for −034). Of 1,158 patients with CML-CP who were randomized to (017) or treated with (013/034) dasatinib, 1,067 had a molecular assessment and were included in the analysis. After 3, 6, 12, and 24 months of follow-up, a MMR was achieved by 12%, 22%, 35%, and 40%, respectively, of all patients analyzed. The 24-month MMR rate among patients who had achieved or maintained a complete cytogenetic response was 72%. In patients with imatinib resistance/suboptimal response (n=829), overall MMR rates after 3, 6, 12, and 24 months were 10%, 18%, 29%, and 34%, respectively, and in patients with imatinib intolerance (n=238), MMR rates were 22%, 37%, 55%, and 63%, respectively. In patients treated during the 034 study with dasatinib 100 mg once daily, which is associated with fewer key side effects, MMR rates at different time points were similar to rates with other dose schedules (24-month MMR: 100 mg QD, 36%; other schedules, 38%). Among all patients who achieved a MMR, median time to MMR was 5.7 months (6.0 months with 100 mg QD), and after 18 months, 92% of responding patients were without loss of MMR (88% with 100 mg QD). Overall, the results of this analysis demonstrate that high rates of MMR are rapidly achieved in patients with CML-CP treated with dasatinib following resistance, suboptimal response, or intolerance to imatinib.TableMajor molecular response (%)Follow-up (months)361224All analyzed patients (n=1067)12223540Resistant/suboptimal response (n=829)10182934Intolerant (n=238)22375563Phase II studies (013/017) (n=467)17273944Resistant (n=373)13213135Intolerant (n=94)33506978Phase III dose-optimization study (034) (n=600)9193238Resistant/suboptimal response (n=456)7162733Intolerant (n=144)15294654Response by dose schedule100 mg QD (n=154)718293670 mg BID (n=146)9183238140 mg QD (n=144)1322323850 mg BID (n=156)7173438

Desirable performance characteristics for BCR-ABL measurement on an international reporting scale to allow consistent interpretation of individual patient response and comparison of response rates between clinical trials

AbstractAn international basis for comparison of BCR-ABL mRNA levels is required for the common interpretation of data derived from individual laboratories. This will aid clinical decisions for individual patients with chronic myeloid leukemia (CML) and assist interpretation of results from clinical studies. We aligned BCR-ABL values generated by 38 laboratories to an international scale (IS) where a major molecular response (MMR) is 0.1% or less. Alignment was achieved by application of laboratory-specific conversion factors calculated by comparisons performed with patient samples against a reference method. A validation procedure was completed for 19 methods. We determined performance characteristics (bias and precision) for consistent interpretation of MMR after IS conversion. When methods achieved an average BCR-ABL difference of plus or minus 1.2-fold from the reference method and 95% limits of agreement within plus or minus 5-fold, the MMR concordance was 91%. These criteria were met by 58% of methods. When not met, the MMR concordance was 74% or less. However, irrespective of precision, when the bias was plus or minus 1.2-fold as achieved by 89% of methods, there was good agreement between the overall MMR rates. This indicates that the IS can deliver accurate comparison of molecular response rates between clinical trials when measured by different laboratories.

Molecular responses of late chronic phase chronic myeloid leukemia patients after achieving complete cytogenetic responses with imatinib treatment: a 6-year follow-up

To explore the long-term efficacy of imatinib to chronic myeloid leukemia, a total of 46 late chronic phase (CP) patients were assessed after achieving complete cytogenetic response (CCyR). The median duration of imatinib treatment was 68 (61-74) months. Two hundred fifty-three bone marrow samples were detected BCR-ABL messenger RNA (mRNA) levels by TaqMan-based real-time quantitative reverse transcription-polymerase chain reaction. The median time when CCyR was first achieved was eight (3-72) months. Thirty-four patients achieved major molecular response (MMoR), and their median time when MMoR was first achieved was 35 (3-65) months. More patients achieving CCyR within 18 months obtained MMoR than those after 18 months (85% vs 42%, p = 0.006). One patient progressed into blastic crisis, and four patients suffered cytogenetic relapse later. The estimated 6-year event-free survival (EFS) rate of all patients was 81%. The BCR-ABL mRNA levels at the time of first CCyR of relapsed patients were significantly higher than those in continuous CCyR (p = 0.011). The 6-year estimated EFS rate of MMoR patients was significantly higher than that of non-MMoR patients (100% vs 44%, p = 0.0001). Achieving CCyR within 18 months had a higher probability of achieving MMoR within 6 years. The 6-year estimated EFS rate was significantly higher for patients achieving CCyR within 12 months than those after 12 months (97% vs 55%, p = 0.05). The time when MMoR was first achieved did not affect 6-year estimated EFS. Therefore, imatinib could induce most late CP patients to achieve long-term durable responses after achieving CCyR. Both the time when CCyR was first achieved and the depth of BCR-ABL reduction after CCyR are relevant to long-term EFS.