Amplification Band Research Articles

Genetic detection to Aeromonas hydrophila proteolytic activity in milk samples (cows, buffaloes and goats) in Basra governorate

This study aim is to determine the incidence and the virulence of Aeromonas hydrophila in raw milk, randomly collected from Basra governorate by using of polymerase chain reaction (PCR) technique. In this study, the total number of raw milk samples collected from cows, buffaloes and goats that kept from different the regions of Basra governorate were 90 samples. The PCR technique is modern method which regarded as a reliable tool to detect virulent gene of the A. hydrophila isolates. The PCR assays using the primers sets SerAh-F and SerAh-R resulted in the amplification of 650-bp bands from the targeted proteases gene of the A. hydrophil. The result of the present study showed that the results of PCR concerning the proteolytic activity of A. hydrophila in the tested raw milk samples according to animals' source. The higher percentage of the proteolytic activity was found in the cow's raw milk samples 40% and in the buffalo's milk samples was 26.7% while, the proteolytic activity did not find in the goat's milk samples. The association between the source of the milk sample and proteolytic A. hydrophila positive results was considered to be statistically highly significant. The higher percentage of the A. hydrophila isolates found in the raw cow milk was 40%, and the A. hydrophila isolates found in the raw buffalo milk was 26.7%, while, the A. hydrophila isolates did not find in the goat milk.

Prevalence, Virulence Characterization, AMR Pattern and Genetic Relatedness of Vibrio parahaemolyticus Isolates From Retail Seafood of Kerala, India.

Vibrio parahaemolyticus, a halophilic bacterium often found in the marine or estuarine environment is a well-known enteropathogen responsible for foodborne outbreaks associated with seafood. The pathogenic strains of V. parahaemolyticus are marked by the presence of thermostable direct hemoylsin (tdh) and/or TDH related hemolysin (trh) genes. This study aimed to investigate the prevalence and characteristics of potentially pathogenic V. parahaemolyticus in selected retail markets of Cochin, Kerala, along the south-western coast of the Indian subcontinent. One hundred samples collected from 10 retail markets were analyzed for the presence of pathogenic isolates of V. parahaemolyticus. Out of the 721 presumptive isolates, 648 were confirmed to be V. parahaemolyticus by toxR gene amplification, among which 29 were Kanagawa phenomenon (KP) positive. Among these potentially pathogenic isolates, 17 possessed the tdh gene whereas none of them had the trh gene. The faint amplification bands produced during the amplification of tdh gene from two isolates was confirmed by sequencing. Multiplex O serotyping identified O1 serotype as the most prevalent serotype among the 29 potentially pathogenic isolates. Further, studies on the pandemic nature of these isolates revealed that 14 of the 29 were positive for the PGS-PCR, whereas all the isolates were negative for GS-PCR and HU-α PCR. The antibiogram of the isolates revealed that three isolates had significant Multiple Antibiotic Resistance (MAR) index of 0.2 or above. Pathogenic isolates resistant to second, third and fourth generation Cephalosporins were found to be present in the seafood studied. The molecular fingerprinting studies using ERIC-PCR, and PFGE revealed that three of these isolates shared close genetic similarities with the clinical strains. The environmental and seafood isolates that produced faint amplification bands during the amplification of tdh gene suggests that the tdh gene often goes undetected in environmental isolates. The conventional methods used to identify the pathogenic V. parahaemolyticus would be good for clinical isolates, but a more elaborate method is recommended for the detection of tdh gene in environmental isolates. This is the first comprehensive study on pathogenic V. parahaemolyticus in Kerala, India and demonstrates for the first time, the isolation of potentially pathogenic V. parahaemolyticus, carrying tdh gene from seafood collected from retail markets in Kerala.

Anatomical profile and genetic variability of sweet potato (Ipomoea batatas) cultivars in Banyumas, Central Java, based on RAPD markers

Abstract. Samiyarsih S, Fitrianto N, Azizah E, Herawati W, Rochmatino. 2020. Anatomical profile and genetic variability of sweet potato (Ipomoea batatas) cultivars in Banyumas, Central Java, based on RAPD markers. Biodiversitas 21: 1755-1766. Indonesia has developed a food consumption diversification based on local sources. Sweet potato (Ipomoea batatas) is one of the tubers of carbohydrate sources in addition to wheat, rice, corn, potatoes, and cassava. It has a wide distribution, and high cultivars diversity produces a high variation on its morphology, anatomy, and genetic modification. The objectives of this research were to investigate the anatomical profile and genetic variability of eight sweet potatoes (Ipomoea batatas) cultivars found in Banyumas, Central Java, Indonesia. Anatomical profile was observed by the embedding method and subjected to analysis of variance. DNA amplification using Random Amplified Polymorphic DNA (RAPD) method with 10 primers, namely OPA-1, OPA-2, OPA-3, OPA-4, OPA-9, OPA-11, OPA-13, OPA-15, OPA-16, and OPA-18. The result of the anatomical study showed that eight sweet potato cultivars have significantly different (p<0.05) variation in leaf anatomical profile. RAPD primers produced 52 amplified fragments varying from 100 to 1300 bp in size, and 90.40% of the amplification bands were polymorphic. The genetic similarity level is ranged from 0.37 to 0.93. Two unspecific groups were forming at a coefficient of 55% from the dendrogram. The first group consisted of one cultivar, Cangkuang, and the second group consisted of seven cultivars Antin, Ungu Tua, Borobudur, Sukuh, Sari, Beta, and Kidal. The nearest relationships cultivars were Borobudur, and Ungu Tua had the highest similarity coefficient of 93%, and the lowest similarity found in Cangkuang and Antin with a coefficient of 37%. The range of genetic distance of eight cultivars was from 0.37-0.93. Implementation of the research would particularly useful for the identification and evaluation of the genetic improvement of sweet potato cultivars.

Updated emm-typing protocol for Streptococcus pyogenes

ObjectivesPCR-based typing of the emm gene Streptococcus pyogenes often results in the amplification of multiple bands. This has resulted in the misclassification of strains into types based on non-emm gene sequences. We aimed to improve the specificity of the emm typing PCR reaction using a primer called CDC3, the sequence for which has been previously used to identify emm genes in silico. MethodsThe proposed primer CDC3 was validated in silico from a global database of 1688 GAS genomes and in vitro with 32 isolates. PCR reactions were performed on genomic DNA from each isolate, using the published CDC1 forward primer with the CDC2 reverse primer or the new CDC3 reverse primer. The products were examined by gel electrophoresis, and representative PCR products were sequenced. ResultsIn 1688 S. pyogenes genomes, the previous CDC2 reverse primer annealed in silico in 1671 emm genes and also in 2109 non emm genes in close proximity, whereas the new CDC3 primer annealed in 1669 emm genes only. The remaining 19 genes without a CDC3 binding site were chimeric emm genes. The PCR pair CDC1+CDC3 produced a single band at appropriate molecular weight in all 32 isolates tested, while the CDC1+CDC2 pair produced more than one band in 13 of 32 isolates (40%). ConclusionsThe new CDC3 primer is more specific for emm genes than the previous CDC2 primer and represents a simple solution to reduce the potential for mistyping S. pyogenes strains.

Broadly tunable laser based on novel metallic resonant leaky-mode diffraction grating

We present a fibre laser broadly tunable in a wavelength range from 1058 nm to 1640 nm based on a new type of metallic resonant leaky-mode diffraction grating and three fibre-pigtailed semiconductor optical amplifiers. For TM polarization in Littrow configuration, the grating has experimentally measured diffraction efficiency into the -1st reflected order of more than 90 % over a spectral range of 1417 nm to 1700 nm. The laser covered a spectral range of 331 nm within a tuning band of 558 nm without any adjustment of optics and its tuning range was limited by amplification bands of available semiconductor optical amplifiers.

Genetic Diversity Analysis and DNA Fingerprint Construction of Dendrobium Based on ISSR Markers

In order to make reasonable use of collected and preserved Dendrobium germplasm resources, ISSR molecular marker method was used to analyze the genetic relationship and genetic diversity of 22 Dendrobium species. A total of 6 primers with clear amplification bands, high polymorphism and good repeatability were chosen from 100 ISSR primers. The selected primers were used to amplify the genomic DNA of 22 Dendrobium species by PCR, and a total of 241 bands were generated, of which 241 were polymorphic bands. Polymorphic ratio was 100%. By GenAlEx 6.5 software, average value of observed allele number, effective number of alleles, Nei's gene diversity and Shannon's information index was 1.983, 1.167, 0.133 and 0.247, respectively, indicating that a high level of genetic diversity among 22 Dendrobium species. The genetic similarity coefficient among 22 Dendrobium species ranged from 0.698 4 to 0.878 7 by NTSYS-pc 2.1 software. UPGMA clustering based on genetic similarity coefficient, 22 Dendrobium species could be divided into 10 groups when genetic similarity was 0.795. UPGMA clustering results are consistent with traditional morphological classification results. The DNA fingerprint map constructed with 3 pairs of primers can separately identify 22 Dendrobium species. This research laid a theoretical foundation for the identification of Dendrobium germplasm resources and the selection of parents for cross breeding.

Identification of sex-linked markers in the sexually cryptic coco de mer: are males and females produced in equal proportions?

Lodoicea maldivica (coco de mer) is a long-lived dioecious palm in which male and female plants are visually indistinguishable when immature, only becoming sexually dimorphic as adults, which in natural forest can take as much as 50 years. Most adult populations in the Seychelles exhibit biased sex ratios, but it is unknown whether this is due to different proportions of male and female plants being produced or to differential mortality. In this study, we developed sex-linked markers in Lodoicea using ddRAD sequencing, enabling us to reliably determine the gender of immature individuals. We screened 589 immature individuals to explore sex ratios across life stages in Lodoicea. The two sex-specific markers resulted in the amplification of male-specific bands (Lm123977 at 405 bp and Lm435135 at 130 bp). Our study of four sub-populations of Lodoicea on the islands of Praslin and Curieuse revealed that the two sexes were produced in approximately equal numbers, with no significant deviation from a 1:1 ratio before the adult stage. We conclude that sex in Lodoicea is genetically determined, suggesting that Lodoicea has a chromosomal sex determination system in which males are the heterogametic sex (XY) and females are homogametic (XX). We discuss the potential causes for observed biased sex ratios in adult populations, and the implications of our results for the life history, ecology and conservation management of Lodoicea.

Heme oxygenase-1 modified mesenchymal stem cells in the treatment of ischemia-reperfusion injury in lung transplantation

Objective To explore the protective mechanism of Heme Oxygenase-1 (HO-1) modified mesenchymal stem cells (MSC) in the treatment of lung transplantation ischemia-reperfusion injury (IRI). Methods Sixty SD rats were randomly divided into Surgical control (Ⅰ), simple MSCs (Ⅱ), empty vector-MSCs (Ⅲ), HO-1 modified MSCs (Ⅳ) were established. After establishing orthotopic left lung transplantation model in rats, group Ⅱ, Ⅲ and Ⅳ were injected with MSCs, empty vector-MSCs and HO-1-MSCs from pulmonary artery fine needles of recipient rats. Four hours later, partial pressure of oxygen (PaO2), partial pressure of carbon dioxide (PaCO2), tumor necrosis factor-alpha (TNF-α), Interleukin-10 (IL-10), wet/dry ratio (W/D), superoxide dismutase (SOD), malondialdehyde (MDA) and myeloperoxidase (MPO) were measured. Histopathological examination. Detection of HO-1-mRNA expression in transplants by reverse transcription polymerase chain reaction (RT-PCR). Multigroup mean comparison using One-way ANOVA. Results PaO2: Group Ⅰ, Ⅱ, Ⅲ and Ⅳ were (70.40±4.64), (87.53±4.01), (87.27±4.06), (96.80±647) mmHg (1 mmHg=0.133 kPa) gradually increased (F=75.578, P 0.05). PaCO2: group Ⅰ, Ⅱ, Ⅲ and Ⅳ were (32.67±3.31), (27.80±2.98), (27.60±2.41), (19.87±3.02) mmHg gradually decreased (F=48.286, P 0.05). W/D: Group Ⅰ, Ⅱ, Ⅲ and Ⅳ were (4.96±0.22), (4.04±0.28), (4.11±0.31), (3.85±0.27) gradually decreased (F=48.992, P 0.05). MDA content: In group Ⅰ, Ⅱ, Ⅲ and Ⅳ, the levels of MDA were (126.80±11.14), (114.27±16.45), (114.06±17.68), (102.40±14.21) nmol/g gradually decreased (F=6.551, P 0.05). MPO content: group Ⅰ, Ⅱ, Ⅲ and Ⅳ were (53.51±3.06), (45.07±3, 32), (44.45±3.37), (40.60±2.47) U/g decreased gradually (F=46.907, P 0.05). SOD activity: In group Ⅰ, Ⅱ, Ⅲ and Ⅳ, SOD activity increased gradually [(304.60±34.74), (329.87±19.44), (329.87±19.44), (338.73±15.77) U/g, (F=6.038, P 0.05). TNF-α: In group Ⅰ, Ⅱ, Ⅲ and Ⅳ, the levels of TNF-αwere (61.56±2.83), (48.32±4.11), (48.53±4.20), (36.77±3.79) ng/L gradually decreased (F=108.215, P 0.05). IL-10: The levels of IL-10 in group Ⅰ, Ⅱ, Ⅲ and Ⅳ were (23.43±2.37), (34.96±3.04), (35.48±3.00), (41.16±3.12) ng/L gradually increased (F=98.751, P 0.05). Under light microscopy, neutrophils infiltrated pulmonary interstitium and inflammatory exudation was seen in alveolar cavity. Inflammation in group Ⅳ was the lightest in each group. The amplification bands of HO-1 mRNA in group IV were significantly stronger than other groups. Conclusion HO-1 gene modified MSCs have synergistic anti-injury effect in the treatment of lung transplantation IRI. Key words: Heme oxygenase-1; Mesenchymal stem cells; Lung transplantation ischemia-reperfusion injury

Blue to near infra-red photoluminescence from distorted SAP (C4V) tris(hexafluoroacetylacetonato)Ho(III) and Tm(III) complexes with indazole

A sensitizer ligand, 1,1,1,5,5,5-Hexafluoro-2,4-pentandione (Hhfaa) is employed to synthesize two new ternary–lanthanide(III) complexes, [Ho(hfaa)3(Hind)2] and [Tm(hfaa)3(Hind)2], in which the monodentate N-donor indazole (Hind) was used as the antenna ligand. Both the complexes were characterised thoroughly. The single-crystal XRD suggests that the complexes are eight-coordinate where the metal ions are coordinated to three hfaa̶ and two Hind ligands making the coordination polyhedra as LnO6N2 with distorted square antiprismatic geometries. The one- and two-dimensional NMR analyses confirm the eight-coordinate structures and show that the complexes are isostructural in the solution. The complexes are thermally stable up to 200 °C, which is quite suitable to find the potential application in the optoelectronic devices. Furthermore, the UV-excitation of the complexes led to characteristic emission transitions in the visible and NIR regGive a space between NIR and region on from the [Ho(hfaa)3(Hind)2] and [Tm(hfaa)3(Hind)2] complexes. The NIR luminescence, particularly 1.5 μm from the Ho complex and 1.4 μm from the Tm complex makes them potential candidates for optical communications and of broadening amplification band from C– band (1530–1560 nm) to S + band (1450–1500 nm) in optical fibre, respectively.

Pairing and Exchanging between Daypyrum villosum Chromosomes 6V#2 and 6V#4 in the Hybrids of Two Different Wheat Alien Substitution Lines.

Normal pairing and exchanging is an important basis to evaluate the genetic relationship between homologous chromosomes in a wheat background. The pairing behavior between 6V#2 and 6V#4, two chromosomes from different Dasypyrum villosum accessions, is still not clear. In this study, two wheat alien substitution lines, 6V#2 (6A) and 6V#4 (6D), were crossed to obtain the F1 hybrids and F2 segregating populations, and the testcross populations were obtained by using the F1 as a parent crossed with wheat variety Wan7107. The chromosomal behavior at meiosis in pollen mother cells (PMCs) of the F1 hybrids was observed using a genomic in situ hybridization (GISH) technique. Exchange events of two alien chromosomes were investigated in the F2 populations using nine polymerase chain reaction (PCR) markers located on the 6V short arm. The results showed that the two alien chromosomes could pair with each other to form ring- or rod-shaped bivalent chromosomes in 79.76% of the total PMCs, and most were pulled to two poles evenly at anaphase I. Investigation of the F2 populations showed that the segregation ratios of seven markers were consistent with the theoretical values 3:1 or 1:2:1, and recombinants among markers were detected. A genetic linkage map of nine PCR markers for 6VS was accordingly constructed based on the exchange frequencies and compared with the physical maps of wheat and barley based on homologous sequences of the markers, which showed that conservation of sequence order compared to 6V was 6H and 6B > 6A > 6D. In the testcross populations with 482 plants, seven showed susceptibility to powdery mildew (PM) and lacked amplification of alien chromosomal bands. Six other plants had amplification of specific bands of both the alien chromosomes at multiple sites, which suggested that the alien chromosomes had abnormal separation behavior in about 1.5% of the PMCs in F1, which resulted in some gametes containing two alien chromosomes. In addition, three new types of chromosome substitution were developed. This study lays a foundation for alien allelism tests and further assessment of the genetic relationship among 6V#2, 6V#4, and their wheat homoeologous chromosomes.

In Vitro Regeneration and ISSR-Based Genetic Fidelity Analysis of Orthosiphon stamineus Benth

Orthosiphon stamineus has been widely used as traditional remedy for various illnesses and diseases, such as cardiovascular diseases and epileptic seizures. In this study, direct regeneration through nodal segment of this species was attempted using Kinetin (6-Furfurylaminopurine) and IAA (indole-3-acetic acid). Optimum regeneration media was identified as MS media supplemented with 2.0 mg L−1 Kin plus 0.5 mg L−1 IAA. This yielded the highest number of shoots (5.57 ± 0.42) and leaves (20.53 ± 1.91) per explant. Acclimatization of the resulting in vitro regenerants was successful in all potting mixtures tested. However, potting mixture PF (1:1:1 ratio of black soil/red soil/compost) was identified as the best medium for acclimatization of this species, as it yielded 100% survival percentage after 90 days of acclimatization. Ten in vitro regenerants of O. stamineus were randomly collected after the third subculture and subjected to genetic variation analysis using inter-simple sequence repeat (ISSR) markers. Out of 20 ISSR markers tested, 10 working primers were observed to produce satisfactory amplification of bands, with an average of 7.11 bands per primer. A total of 610 bands were produced by the 10 primers. The percentage of polymorphism was observed to be very low, yielding only 7.32% polymorphism among all samples. Jaccard dissimilarity analysis was also conducted and very low genetic distance (about 0.1) was found among the in vitro regenerants and between the regenerants with the mother plant, thus ascertaining the clonal nature of the plantlets produced in this study.

Supramolecular Self-Assembly Driven Selective Sensing of Phosphates.

A new bis-heteroleptic RuII complex (1[PF6]2) with iodotriazole as the anion binding group along with the attached pyrene moiety is developed to investigate anion sensing properties and the origin of its selectivity toward a particular class of anions. Selective sensing of phosphates over other anions in both the solution and solid states by 1[PF6]2 is clearly evident from the perturbation of the absorption band and a large degree of amplification of 3MLCT emission band in the presence of phosphates. Importantly, macroscopic investigation such as Scanning Electron Microscopy (SEM) and Dynamic Light Scattering (DLS) indicated the formation of supramolecular architecture in the presence of dihydrogen phosphate via halogen bonding interaction and π-π stacking of pyrene moieties. Such macroscopic property is further corroborated by solution and solid state spectroscopic studies, e.g., 1H-DOSY NMR, single crystal X-ray crystallography, and solid state photoluminescence (PL) spectroscopy.

Methods for measuring parameters of ultra-wideband microwave radiation

The plasma source of ultra-wideband (UWB) microwave radiation was developed. Operation of this source is based on amplification of the relativistic electron beam (REB) noise. The middle frequency of UWB amplifiers of this type is determined only by the plasma density and does not depend on duration of the high-voltage pulse at the cathode. This allows obtaining rather long signals with durations of about 200–300 ns and tuning the signal middle frequency from 2.2 to 3.8 GHz by means of varying the plasma density. A number of problems were solved, which occur in the course of measuring the UWB microwave signal parameters. In particular, a new method for measuring signal energy was developed, the optimal length of the receiving antenna used for recording the UWB radiation spectra was chosen, and the effective potential of the plasma UWB source was estimated. It was demonstrated that the energy of microwave signal is more than 10 J. The effective potential of the plasma UWB source was found to be approximately 400 kV for the signal with a middle frequency of 3 GHz that is comparable to that of other UWB microwave sources. It was also shown that the spectrum of the plasma UWB source is determined by its amplification band and by the oscillation spectrum of the current generated by the explosive emission cathode.

Molecular characterization of Salmonella isolated from internal organs of dead turkey and its antimicrobial activity pattern

Salmonella enterica is a zoonotic pathogen which can readily pass from animal to man through the consumption of contaminated food. This study was designed to determine molecular characterization of Salmonella and antibiotic resistance profiles of Salmonella recovered from internal organs of dead turkey. A total of 40 internal organ samples from dead turkey were collected from different turkey farms in Dinajpur district. Among the samples 12 (30%) were positive for Salmonella. Salmonella virulence factors were determined using the polymerase chain reaction assays targeting the virulence gene &16S rRNA gene region was amplified with the universal primers, forward primer- 27F (5'AGAGTTTGATCCTGGCTCAG 3') and reverse primer- 1492R (5' TACCTTGTTACGACTT 3'). PCR amplification band was found at 1470 bp. Among the different serotypes, Salmonella enterica was identified by using phylogenetic tree analysis. Antibiotic resistance analysis indicates that Salmonella spp. were 100% sensitive to Azithromycin, Kanamycin, Norfloxacin and Chloramphenicol. The isolates were 100% resistant to Cefradine, Cloxacillin, Bacitracin, Levofloxacin, Amoxicillin, Nalidixic acid and Tetracycline. In conclusion, this study provides that the isolated Salmonella spp. were found to AMR in response to variety of multi drugs. Salmonella enterica can cause a wide range of illnesses, ranging from gastroenteritis to acute, life-threatening enteric fever for turkey. This study suggests that turkeys may act as a reservoir for these strains which can be transferred to humans.
 Asian J. Med. Biol. Res. June 2019, 5(3): 219-225

Experimental demonstration of free electron maser operation in the regime of non-resonant trapping

The regime of nonresonant trapping aimed at improving the operation of the amplifying scheme of free electron devices has been developed and experimentally demonstrated in the Ka-band. In this regime, the wiggler is profiled in such a way that the electron beam is out of resonance with the operating wave at the beginning of the wiggler, and different electron fractions gradually get into synchronism as the wiggler's period decreases. According to the simulations, such “nonresonant” trapping provides higher efficiency, a broader amplification band, and lower sensitivity to the beam quality as compared to conventional regimes of interaction. The conclusions of the theoretical analysis are confirmed by the results of joint experiments between the Joint Institute for Nuclear Research and the Institute of Applied Physics of the Russian Academy of Sciences, in which a free-electron maser utilizing this regime was implemented: Using a set of kilowatt magnetrons with frequencies in the range from 30 to 36 GHz, an output power of up to 25–28 MW with a gain of up to 36–37 dB was demonstrated. This makes the investigated regime attractive for shorter wavelength designs of free-electron devices whose efficiency is strongly affected by the electron beam quality.

Expression of Nitrite Transporter Gene to Increase Nitrate Absoprtion in Rice Plant (Oryza Sativa Cv Nipponbare) as Sole Nitrogen Source

Incorporated of CsNitr1-L-transgene in rice plant was showed to active and transport NO2 - from cytosol into chloroplast. With a PCR method screening of CsNitr1-L gene were confirmed which the CsNitr1-L-transgene have amplification band, while the plant were not contained CsNitr1-L gene, there are no amplification band. Some strain were obtained and got a seeds. Almost CsNitr1-L-transgene was raising in all parameter test, such as plant height, tillers number, respectively. The accumulation of NO2 - in the leaves of CsNitr1-L-transgene was lower compared with wild type. CsNitr1-L is a cucumber NO2 - -transporter gene that located in chloroplast membrane have been transformed into japonica rice cv. Nipponbare. A series experiments was carried out to understand the expression- CsNitr1-L-transgenic rice. The seeds were cultivated to observe the activity of CsNitr1-L-transgene with medium containing NO3 - or NO2 - as inducer. Agronomical test, like tillers number and plant height were observed and compare with non CsNitr1-L- transgenic rice. While the NO2 - content in leaves were analyzed with capillary electrophoresis method

Electro-optic dual-comb spectrometer in the thulium amplification band for gas sensing applications.

We demonstrate a dual-comb spectrometer based on the direct electro-optic modulation of a continuous-wave laser operating in the thulium amplification band. We show that the emergent two-micrometer technology is already suitable for developing all-fibered dual-comb setups employed here for gas sensing applications. By performing spectroscopic measurements around two micrometers on carbon dioxide, we obtain very good agreement between the experimental results and calculations provided by the HITRAN database. These results pave the way to the extension of electro-optic dual-comb spectrometry in the mid-infrared region.

New genus-specific primers for PCR identification of Rubrobacter strains

A set of oligonucleotide primers, Rubro223f and Rubro454r, were found to amplify a 267 nucleotide sequence of 16S rRNA genes of Rubrobacter type strains. The primers distinguished members of this genus from other deeply-rooted actinobacterial lineages corresponding to the genera Conexibacter, Gaiella, Parviterribacter, Patulibacter, Solirubrobacter and Thermoleophilum of the class Thermoleophilia. Amplification of DNA bands of about 267 nucleotides were generated from environmental DNA extracted from soil samples taken from two locations in the Atacama Desert. Sequencing of a DNA library prepared from the bands showed that all of the clones fell within the evolutionary radiation occupied by the genus Rubrobacter. Most of the clones were assigned to two lineages that were well separated from phyletic lines composed of Rubrobacter type strains. It can be concluded that primers Rubro223f and Rubro454r are specific for the genus Rubrobacter and can be used to detect the presence and abundance of members of this genus in the Atacama Desert and other biomes.

PCR Detection of Mixed and Zoonoses Malaria Using Plasmodium spp Dynein Light Chain (dlc-tctex) Gene

Novel gene targets are needed in accurate diagnosis of malaria. Previous studies show that the dynein light chains (dlc) in Plasmodium are uniquely conserved within the species, possibly due to their role as the cargo adptor moiety. This study aimed at the development of PCR assay for the detection of Plasmodium based on the (dlc-Tctex) as a genus and species-specific tool in malaria diagnosis. Multiple primers were designed based on Plasmodium spp dlc(Tctex) genes. The primers were applied on PCR to detect malaria on clinical samples and on laboratory maintained isolates of P. falciparum and P. vivax for human infecting species and P. knowlesi and P. cynomolgi for zoonoses infection involving primates. The amplified PCR fragments were gene cleaned and sequenced. BLASTn e-values output from the raw nucleotide queries supports that the genes are uniquely conserved. Species-specific primers amplified P. falciparum infections with no cross-reactivity to P. vivax, P. knowlesi or P. cynomolgi species. In this assay only 11 out of the 30 microscope positive malaria positive clinical blood samples were positive for PCR detection of P. falciparum infection. Primers designed for Plasmodium genus amplified the target band in all clinical malaria samples but also had another specific band amplification. This preliminary data demonstrate that a species-specific dlc(Tctex) PCR assay can be used for detection of P. falciparum and optimized genus primers can be applied to differentiate mixed malaria infections.

Genetic Diversity Analysis between Different Varieties of Chickpea (Cicer arietinum L.) Using SSR Markers

The paper aims at evaluating genetic diversity among genomes of chickpea comprising of 5 different varieties with the help of simple sequence repeats (SSR) molecular markers. Genomic DNA isolated from all varieties was checked with 15 different SSR markers specific for ENDPOINT PCR using PCR based techniques. Amplification bands with different markers enabled identification of the genomic regions responsible for Drought Tolerance in chickpea. All 15 SSR markers chosen gave monomorphic bands. A hierarchical tree was also constructed using UPGMA Dendogram for figuring out the exact genetic distance of cultivars using band amplification data. It depicted GUJ-1 and GUJ-2 are closest of all cultivars. GUJ-5 is at the center having GUJ-3 and UJJAVAL at an almost equal distance but GUJ-5 and GUJ-3 are more related. Physiological data also supported this genetic evidence.
 Int. J. Appl. Sci. Biotechnol. Vol 7(2): 236-242