Ampelomyces Research Articles

Combining sanitation and disease modelling for control of grapevine powdery mildew

Chasmothecia of Erysiphe necator form in one season, survive winter and discharge ascospores that cause primary infections and trigger powdery mildew epidemics in the next season. A strategy for powdery mildew control was developed based on (i) the reduction in overwintering chasmothecia and on (ii) spring fungicide applications to control ascosporic infections timed based on estimate risk (two to five sprays per season). Several fungicides, the hyperparasite Ampelomyces quisqualis, and a mineral oil product were first tested as separate applications in a greenhouse and in vineyards. In the greenhouse, A. quisqualis suppressed chasmothecia formation by 41 %; fungicides and mineral oil suppressed chasmothecia formation by 63 % and ascospore viability by 71 %. In vineyards, application of boscalid + kresoxim-methyl or meptyldinocap once after harvest, as well as application of A. quisqualis pre- and post-harvest, delayed disease onset and epidemic development in the following season by 1 to 3 weeks and lowered disease severity (up to the pea-sized berry stage) by 56 to 63 %. Risk-based applications of sulphur and of synthetic fungicides provided the same control as the grower spray program but required fewer applications (average reduction of 47 %). Sanitation strategies were then tested by combining products and application times (late-season, and/or pre-bud break, and/or spring). Adequate disease control with a reduced number of sprays was achieved with the following combination: two applications of A. quisqualis (pre- and post-harvest), one application of mineral oil before bud break, and model-based applications of sulphur fungicides between bud break and fruit set.

Management of peach rusty spot epidemics with biorational fungicides

A total of nine biorational fungicides were examined during the 2000 and 2001 growing seasons for their ability to manage rusty spot epidemics, caused by Podosphaera leucotricha, on moderately susceptible ‘Jerseyglo’ peach. The biorationals studied were the biological control agents Bacillus subtilis, Ampelomyces quisqualis and Phoma glomerata; the plant extracts neem seed oil, cinnamon oil and extracts from leaves of giant knotweed, Reynoutria sachalinensis; the inorganic compounds potassium bicarbonate and potassium dihydrogen phosphate; and chitosan, a deacetylated form of chitin derived from crustacean shells. Disease assessments, consisting of fruit lesion counts, were made at three- to six-day intervals during the course of the epidemics. Three biorational fungicides, B. subtilis, neem seed oil extract and potassium bicarbonate, significantly reduced areas under the disease incidence and lesion density progression curves in both years of the study. The remaining biorational materials reduced disease in only one year or neither year. When the logistic model was fit to the disease progress curves, the three most effective biorationals also significantly reduced the estimated maximum disease level or carrying capacity parameter K. Although these reductions were statistically significant, the amount of disease control was relatively low, ranging from 24 to 34%, versus 94% control for the myclobutanil standard. Thus, B. subtilis, neem seed oil extract and potassium bicarbonate provide insufficient efficacy for commercial management of rusty spot when applied alone. However, since these biorationals consistently provided some levels of control, they may be candidates for use in integrated programs with conventional fungicides.

Is the mycoparasitic activity of Ampelomyces quisqualis biocontrol strains related to phylogeny and hydrolytic enzyme production?

The use of mycoparasites is a highly elegant method of biocontrol, as the agent is specific and can expand its activity on its own, and it presents no risk to the environment. Ampelomyces quisqualis best typifies the potential of mycoparasites, as it is highly specific to powdery mildews, does not produce any toxic metabolites and can easily be mass-produced in vitro. However, the level of parasitization varies between strains, and the cause of this variation is unknown. In this study, twenty-four selected strains isolated from different host mildews and possessing different ITS rDNA sequences were evaluated for their ability to colonize cucumber, grapevine and strawberry powdery mildews and for in vitro production of cell wall degrading enzymes (CWDEs). Individual strains differed significantly in enlargement of the colonization area by intra-hyphal formation of pycnidia within powdery mildew colonies and in inhibition of host conidation. Pronounced differences in the in vitro activity of chitobiases, proteases and β-1,3-glucanases were also observed between strains. We found a positive correlation between mycoparasitic activity and chitobiases and proteases but not glucanases. Furthermore, principal component analysis showed that A. quisqualis strains with similar levels of mycoparasitic activity originated from the same host species and shared an identical ITS rDNA sequence. These results provide a deeper understanding of the process of mycoparasitism and a sound basis for developing new screening strategies for detecting highly effective A. quisqualis strains in the biocontrol of powdery mildews.

The effects of different biological control agents (BCAs) and plant defence elicitors on cucumber powdery mildew (Podosphaera xanthii)

An experiment was conducted in both 2008 and 2009 to develop and evaluate strategies for the control of cucumber powdery mildew caused by Podosphaera xanthii. Effects of biological control agents (BCAs) Ampelomyces quisqualis and Pythium oligandrum and plant defence elicitors Milsana® VP 2002 (a plant extract of Reynoutria sachalinensis) and chitosan (derived from chitin) alone and in combination on disease incidence and fruit yield of two cucumber cultivars were investigated. As the cultivars Gloria and Palmera differed in their tolerance to powdery mildew it was possible to test if the use of tolerant cultivars could maximise any beneficial effects of the treatments. In both cultivars in both years, the elicitor Milsana® VP 2002 reduced the disease incidence and fruit yield was similar to that from plants treated with the chemosynthetic fungicide treatments. Whilst foliar application of the other elicitor chitosan significantly reduced powdery mildew, it was less effective than Milsana® VP 2002. BCAs A. quisqualis and P. oligandrum were less effective than the elicitors Milsana® VP 2002 and chitosan and fruit yield was similar to untreated control plants. There was no synergistic or additive effects on disease control or fruit yield detected with any combinations. Disease tolerance of cultivars significantly affected disease incidence. However, the more susceptible cultivar Palmera outyielded the tolerant one (Gloria) despite greater infection.

Efficacy of biocontrol agents and natural compounds against powdery mildew of zucchini

The activity of different types of natural compounds and of two biofungicides based on Bacillus subtilis and Ampelomyces quisqualis alone and in combination with fungicides was tested against powdery mildew of zucchini. The efficacy was compared to the activity of fungicides used alone in four experimental trials carried out in the open field and under greenhouse conditions. The Podosphaera xanthii population used throughout the work was partially resistant to azoxystrobin, whereas it was susceptible to mychlobutanil. Sulphur plus terpenes and mustard oil consistently controlled powdery mildew, followed by mychlobutanil alone or in combination with A. quisqualis. B. subtilis and A. quisqualis when tested alone were partially effective. The combination of azoxystrobin and B. subtilis only delayed the spread of the pathogen.

Existence of different physiological forms within genetically diverse strains of Ampelomyces quisqualis

Powdery mildew fungi are parasitized by strains of the genetically distinct Ampelomyces quisqualis. To investigate whether differences in the phylogeny and other cultural, morphological and physiological characteristics of these different strains are related to differences in their geographic origins or the host species from which they were isolated, several A. quisqualis strains isolated from different species of Erysiphaceae collected in different countries and possessing different ITS rDNA sequences were selected and characterized. The results revealed some significant variation among the selected strains, which provides evidence for the existence of different physiological forms within the A. quisqualis species. Two groups that display differential growth on artificial media were identified. These groups also differ in the morphology of their mycelium, but not in the morphology of their pycnidia and conidia. Temperature greatly affected the in vitro growth of the A. quisqualis strains and growth rate was closely correlated to colony color. Differences in the conidial germination of distinct strains were observed during the recognition phase of the parasitic relationship. The germination of each of the investigated strains was greatly stimulated by all of the examined powdery mildew species and not only by the conidia of their original hosts. An Italian strain isolated from grapevine in the Trentino Alto-Adige region was identified as the strain that germinates the most quickly in the presence of powdery mildew conidia. Phylogenetic analysis revealed that these A. quisqualis strains can be classified into five different genetic groups, which generally correlate with the fungal host of origin and morphological and growth characteristics.

OCCURRENCE OF AMPELOMYCES QUISQUALIS ON THE CUCURBIT POWDERY MILDEW SPECIES IN THE CZECH REPUBLIC

From 2002 to 2006, in the Czech Republic (CR), 585 leaf samples with powdery mildew symptoms collected from cucurbits (mainly from Cucurbita pepo, Cucurbita maxima, Cucumis sativus) were microscopically examinated for presence of hyperparasitic fungus Ampelomyces quisqualis Ces. (Aq). Identification of cucurbit powdery mildew species (Golovinomyces cichoracearum /Gc/, Podosphaera xanthii /Px/) was carried out by microscopic examination of the morphological characters of dry conidia in a 3% KOH solution. In total of 443 samples was determined as Gc, 106 samples as mixed infection (Gc, Px) and 36 samples as Px. Aq was detected on 12% of collected samples from the CR. However, frequency of its occurrence varied among the years. In 2002 and 2006, Aq was more frequent (18-20%) as compared with the years 2003-2005 (only 6-8%). Pycnidia of Aq were recorded mainly on Gc hyphae and basal cells of conidiophores (12%) or on mixed infection (Gc, Px) (14%). Occurrence of Aq on Px was only sporadic (only 3 CPM samples/2 locations - 2/1 in 2005 and 1/1 in 2006). Its distribution was recorded in 52 locations of the CR, it was not restricted to limited areas, nevertheless the most of Aq locations originated from the South Moravia. In some locations its presence was recorded repeatedly, in some others it was detected only once. The majority of samples with presence of Aq were collected in August and September.

First Report of Powdery Mildew Caused by Podosphaera leucotricha on Callery Pear in North America.

Callery pear, often referred to as Bradford pear, is a species native to China that is planted throughout North America as an ornamental tree for its white flowers in spring, bright colored foliage in autumn, and resistance to disease. In some regions it is becoming an invasive species that is replacing native trees. In May 2009, leaves of Pyrus calleryana 'Cleveland Select' showing distortion and signs of powdery mildew were collected in Columbia (Howard County), Maryland. A survey of the surrounding area found numerous similarly diseased trees of this cultivar. Microscopic observation of the leaves revealed a fungus with an Oidium anamorph having nipple-shaped appressoria; conidiophores erect, foot cells cylindric, straight, of terminal origin, 41 to 55 × 9.5 to 12.5 μm, with the following cells present in variable numbers; conidia catenulate, broadly ellipsoid to rarely slightly ovoid, 22 to 27 × 11 to 17 μm, with fibrosin bodies. Chasmothecia were absent. On the basis of morphology and host, the fungus was identified as Podosphaera leucotricha (Ellis & Everh.) E.S. Salmon (Leotiomycetes, Erysiphales) (1). The specimen on P. calleryana was deposited in the U.S. National Fungus Collections as BPI 879141. Additional confirmation resulted from a comparison of internal transcribed spacer (ITS) region DNA sequence data (GenBank Accession No. GU122230) obtained with the custom designed primer, Podoprimer Forward (5'-3' ACTCGTTCTGCGCGGCTGAC), and the ITS4 primer. The sequence of the fungus on Callery pear was identical to available GenBank sequences of P. leucotricha. P. leucotricha is the etiological agent of a powdery mildew disease that occurs on rosaceous plants, primarily Malus and Pyrus. This fungus occurs nearly worldwide (1), and the pathology of the disease on Callery pear is similar to that of known hosts (1,4). To our knowledge, this is the first report of P. leucotricha on Pyrus calleryana in North America. P. leucotricha has been reported previously only once on Callery pear, Pyrus calleryana 'Chanticleer', in Hungary (4). Additionally, the powdery mildew fungus was heavily parasitized by Ampelomyces quisqualis Ces. sensu lato, a cosmopolitan coelomycetous mycoparasite of the Erysiphales that is well known on this species (2,3). ITS region DNA sequence data from the Ampelomyces (GenBank Accession No. GU122231) obtained with the ITS1 and ITS4 primers was identical to that of other isolates parasitic on P. leucotricha (2).

Genetic variability and mycohost association of Ampelomyces quisqualis isolates inferred from phylogenetic analyses of ITS rDNA and actin gene sequences

Ampelomyces quisqualis complex is well known as the most common and widespread hyperparasite of the family Erysiphaceae, the cause of powdery mildew diseases. As commercial biopesticide products it is widely used to control the disease in field and plastic houses. Although genetic diversity within Ampelomyces isolates has been previously recognized, a single name A. quisqualis is still applied to all pycnidial intracellular hyperparasites of powdery mildew fungi. In this study, the phylogenetic relationships among Ampelomyces isolates originating from various powdery mildew fungi in Korea were inferred from Bayesian and maximum parsimony analyses of the sequences of ITS rDNA region and actin gene. In the phylogenetic trees, the Ampelomyces isolates could be divided into four distinct groups with high sequence divergences in both regions. The largest group, Clade 1, mostly accommodated Ampelomyces isolates originating from the mycohost Podosphaera spp. (sect. Sphaerotheca). Clade 2 comprised isolates from several genera of powdery mildews, Golovinomyces, Erysiphe (sect. Erysiphe), Arthrocladiella, and Phyllactinia, and was further divided into two subclades. An isolate obtained from Podosphaera (sect. Sphaerotheca) pannosa was clustered into Clade 3, with those from powdery mildews infecting rosaceous hosts. The mycohosts of Ampelomyces isolates in Clade 4 mostly consisted of species of Erysiphe (sect. Erysiphe, sect. Microsphaera, and sect. Uncinula). The present phylogenetic study demonstrates that Ampelomyces hyperparasite is indeed an assemblage of several distinct lineages rather than a sole species. Although the correlation between Ampelomyces isolates and their mycohosts is not obviously clear, the isolates show not only some degree of host specialization but also adaptation to their mycohosts during the evolution of the hyperparasite.

Lasiodiplodia theobromae is a Mycoparasite of a Powdery Mildew Pathogen

Powdery mildews on over 40 plants in Bangalore were screened during July-December of 2003~2008. Isolates from mycoparasitised Oidium caesalpiniacearum of Bauhinia purpurea comprised Lasiodiplodia theobromae, in addition to Ampelomyces quisqualis. Koch’s postulates were satisfied to establish the mycoparasitism of L. theobromae. This is the first report that L. theobromae acts as a mycoparasite of a powdery mildew.

Management of Okra Powdery Mildew Using Ampelomyces quisqualis

The fungus Ampelomyces quisqualis is a naturally occurring hyperparasite of powdery mildews. Stanes Bio-Dewcon is a talc- based biological fungicide that contains the spores and mycelial fragments (1 x 10 8 CFUs g -1 ) of A. quisqualis . Bio-Dewcon at three different concentrations, viz., 2.0, 2.5 and 3.0kg ha -1 significantly reduced the okra powdery mildew incidence. The product was applied to plants as preventive spray at 30 and 45 days after sowing. Among the three doses tested, 3.0kg ha -1 was found to be on par with wettable sulphur (0.4%). Even though both Bio-Dewcon and wettable sulphur were found to be equally effective in controlling powdery mildew, Bio-Dewcon may be preferred due to its non-residual and odourless properties, especially in vegetables.

Management of Okra Powdery Mildew Using Ampelomyces quisqualis

The fungus Ampelomyces quisqualis is a naturally occurring hyperparasite of powdery mildews. Stanes Bio-Dewcon is a talc- based biological fungicide that contains the spores and mycelial fragments (1 x 10 8 CFUs g -1 ) of A. quisqualis . Bio-Dewcon at three different concentrations, viz., 2.0, 2.5 and 3.0kg ha -1 significantly reduced the okra powdery mildew incidence. The product was applied to plants as preventive spray at 30 and 45 days after sowing. Among the three doses tested, 3.0kg ha -1 was found to be on par with wettable sulphur (0.4%). Even though both Bio-Dewcon and wettable sulphur were found to be equally effective in controlling powdery mildew, Bio-Dewcon may be preferred due to its non-residual and odourless properties, especially in vegetables.

Species spectra, distribution and host range of cucurbit powdery mildews in the Czech Republic, and in some other European and Middle Eastern countries

The occurrence and geographic distribution of powdery mildew on cucurbits was studied in the Czech Republic, Austria, France, Germany, Great Britain, Italy, Slovakia, Slovenia, Spain, Switzerland, the Netherlands, as well as in Turkey and Israel, during the period 1995–2000. In total, 599 leaf samples with powdery mildew symptoms were collected from cucurbits from 166 locations within the Czech Republic; an additional 69 samples were collected from 42 locations elsewhere. Two powdery mildews (Golovinomyces cichoracearum and Podosphaera xanthii) were identified. The host range included the cultivated cucurbits (Cucumis melo, C. sativus, Cucurbita pepo, C. maxima, and Citrullus lanatus) and several other species. P. xanthii was the only powdery mildew pathogen found in Spain, Israel, and Turkey. P. xanthii and G. cichoracearum were detected in the other surveyed countries, occurring in both mixed infections and separately. In the more northerly latitudes and higher elevations, G. cichoracearum is more often the single species. G. cichoracearum was the dominant powdery mildew species in the Czech Republic (detected in 98.8% of the locations there); P. xanthii was found as the lone species in 1.2% of locations. At 28.4% of locations, G. cichoracearum was found with P. xanthii as mixed infections. The hyperparasitic fungus Ampelomyces quisqualis was found in 30% of the samples from the Czech Republic and was also recorded in Austria, Italy, Slovenia, Switzerland, and Great Britain.

Occurrence ofErysiphe necatorChasmothecia and Their Natural Parasitism byAmpelomyces quisqualis

In northern Italy, Erysiphe necator overwinters almost exclusively as chasmothecia. From 2004 to 2008, we investigated the occurrence of natural parasitism of grapevine powdery mildew chasmothecia by Ampelomyces quisqualis in the Trentino-Alto Adige region, in northern Italy. The survey was conducted in 18 vineyards in autumn 2004 and 2005 and in 45 vineyards in autumn 2006 and 2007. The incidence of powdery mildew signs (white powdery mycelia and conidia), the number of chasmothecia and their development pattern, and the incidence of parasitism by A. quisqualis were assessed. The production of E. necator chasmothecia on leaves is related to the incidence and severity of the disease on leaves at the end of the season and is not correlated with the elevation of the vineyard, which is inversely related to the temperature. A limited amount of natural parasitism of E. necator by Ampelomyces spp. (0.17 to 3.51%) was observed in all of the years of the survey. Pycnidia and conidia of Ampelomyces spp. parasitizing E. necator chasmothecia were found in conventional, organically grown, and untreated vineyards. Some of the isolated Ampelomyces strains have conidia that are shaped differently than those of the commercial A. quisqualis strain (AQ10) and are phylogenetically different from AQ10.

A laboratory evaluation to determine the compatibility of microbiological control agents with the pollinator Bombus terrestris

This study was undertaken to identify any potential adverse side effects of the use of seven microbiological control agents (MCAs) on the bumblebee, Bombus terrestris L., in the context of combined use in integrated pest management (IPM). AQ10 (Ampelomyces quisqualis), Binab-T-vector (Hypocrea parapilulifera + T. atroviride; 1/1), Prestop-Mix (Gliocladium catenulatum J1446), Serenade (Bacillus subtilis QST713), Trianum-P (Trichoderma harzianum T22), Botanigard (Beauveria bassiana GHA) and Granupom (Cydia pomonella granulovirus), comprising five biofungicides and two bioinsecticides, were investigated. Bumblebee workers were exposed under laboratory conditions to each MCA at its maximum field recommended concentration (MFRC) via three different routes of exposure: dermal contact and orally via either treated sugar water or pollen. The tested MCAs were found to be safe for workers of B. terrestris, with the exception of Botanigard and Serenade. Exposure to Botanigard via contact at its MFRC caused 92% mortality after 11 weeks, while the 1/10 MFRC killed 46% of exposed workers. For Serenade, topical contact and oral delivery via sugar water resulted in 88 and 100% worker mortality respectively. With lower concentrations (1/2, 1/5 and 1/10 MFRC) the toxicity decreased, but the effect depended on the route of exposure. In addition to lethal effects, nests were also evaluated for sublethal effects after treatment with the seven MCAs at their respective MFRCs over 11 weeks. In these bioassays, only Botanigard and Serenade gave rise to a significant (P < 0.05) decrease in drone production. Sublethal effects on foraging behaviour were also evaluated, and only Botanigard at its MFRC delivered via treated sugar water induced negative effects. The results demonstrated that most of the MCAs tested can be considered safe for use in combination with B. terrestris, based on the International Organisation for Biological Control of Noxious Animals and Plants (IOBC) classification. However, some can be harmful, such as the biofungicide Serenade and the bioinsecticide Botanigard. Therefore, it is recommended that all should be tested before use in combination with pollinators. In this context, it is also advisable that these MCAs should be evaluated in more realistic field situations for the assessment of potentially deleterious effects on foraging behaviour.

Taxonomy and nomenclature of powdery mildew fungi: &lt;I&gt;Erysiphe asclepiadis&lt;/I&gt;, &lt;I&gt;E. robiniicola&lt;/I&gt; and &lt;I&gt;Golovinomyces caulicola&lt;/I&gt;

The new species Erysiphe asclepiadis is described, illustrated and discussed. A new Chinese collection of Erysiphe robiniicola has recently been found that can be used to elucidate and discuss the confused taxonomy and nomenclature of this species and other taxa of Erysiphe s. lat. on Robinia spp. Based on a re-examination of type material in connection with the data given in the protologue, it can be shown that Capnodium lygodesmiae must be reduced to synonymy with Ampelomyces quisqualis. The confusion surrounding the name C. lygodesmiae, caused by the occurrence of the hyperparasite A. quisqualis on a powdery mildew fungus with abundant chasmothecia, is discussed in detail. The new combination, Golovinomyces caulicola (; Spolverinia caulicola), is proposed for the powdery mildew that serves as host of C. lygodesmiae.

Spray treatments combined with climate modification for the management of Leveillula taurica in sweet pepper

The effects of several spray and climate treatments on Leveillula taurica were tested under controlled and commercial greenhouse conditions either alone or combined with a climate treatment. Ampelomyces quisqualis AQ10 inhibited the germination of conidia on leaves, but not on glass. Trichoderma harzianum T39 inhibited germination on both surfaces. Neither the examined biological control agents (BCAs) nor the two tested mineral oils (AddQ and JMS Stylet-Oil) affected the viability of conidia. Sulphur drastically limited the germination and viability of L. taurica. In experiments at 15–25°C, AQ10 alone reduced hyphal leaf colonisation at 25°C. T. harzianum T39 significantly reduced leaf colonisation at all temperatures but significantly reduced disease only at 20–25°C. The oils significantly reduced leaf colonisation and sulphur reduced both leaf colonisation and disease at all temperatures. Results were confirmed in an experimental greenhouse. In a field experiment, azoxystrobin, polyoxin AL, neem extract, and T39 were effective; sulphur was superior to them. Under severe epidemic conditions the disease had a negative impact on yield; late fungicide treatments at spring-time were found unnecessary. Chemical sprays applied in alternation was compared with the ‘friendly’ spray regime (alternation of Heliosoufre, T. harzianum T39 + JMS Stylet oil, A. quisqualis AQ10+AddQ oil and Neemgard) in two climates i.e. (i.) day warm climate and (ii.) regular (cool) day climate regimes. In the warm climate, there was no significant difference in the performance of the ‘friendly’ spray regime and the chemical spray regime. However, in the cooler climate, the ‘friendly’ spray programme was not as effective as the chemical spray programme. It was concluded that a change in the greenhouse climate may affect the development of powdery mildew and, at the same time, promote the activity of BCAs and render a pathogen more vulnerable to these control agents, allowing for better disease suppression.

Efficacy of the biocontrol agents Bacillus subtilis and Ampelomyces quisqualis applied in combination with fungicides against powdery mildew of zucchini

The activity of two biofungicides based on Bacillus subtilis and Ampelomyces quisqualis alone and in combination with fungicides against Podosphaera xanthii on zucchini was tested in five experimental trials carried out under greenhouse conditions. The population of P. xanthii used throughout the work for artificial inoculation was able to cause slight infections on zucchini plants treated with the field dosages of azoxystrobin and penconazole. B. subtilis when combined with azoxystrobin against P. xanthii at the recommended field dosages provided better powdery mildew control than the two control measures alone. Such results were consistent throughout the different trials. A similar synergistic effect was shown by the combination of A. quisqualis with myclobutanil: however, in this case, more studies are necessary to confirm the consistency of that phenomenon. The results obtained in this study support the possibility of a synergistic effect among the biocontrol agent B. subtilis and QoI fungicides. Such interaction is very interesting because of the presence of resistance towards QoI in the populations of P. xanthii.

Occurrence of anamorphic and teleomorphic stage of Erysiphe palczewskii (syn. Microsphaera palczewskii) on Caragana arborescens in the Czech Republic and Austria and its morphological characterisation

During the summer of 2007 in a private garden in Smržice (district Prostějov, Czech Republic) symptoms of powdery mildew on &lt;I&gt;Caragana arborescens&lt;/I&gt; were recorded. Until now at least two powdery mildew species (&lt;I&gt;Microsphaera trifolii&lt;/I&gt; var. &lt;I&gt;trifolii&lt;/I&gt; and &lt;I&gt;M. palczewskii&lt;/I&gt;), both differing in some basic morphological features, have been recorded for the genus &lt;I&gt;Caragana&lt;/I&gt;. Comparison of our measurements with previous descriptions of powdery mildew samples found in the Czech Republic on &lt;I&gt;Caragana arborescens&lt;/I&gt; identified our species as &lt;I&gt;Microsphaera palczewskii&lt;/I&gt; (newly &lt;I&gt;Erysiphe palczewskii&lt;/I&gt;). This is probably the first detailed record of this species on C. &lt;I&gt;arborescens&lt;/I&gt; in the Czech Republic. Fungus from Czech Republic was compared with the material collected in 2007 in Vienna (Austria). The aim of this paper was to provide a detailed comparative morphological characterisation of &lt;I&gt;E. palczewskii&lt;/I&gt; anamorph and teleomorph found in the Czech Republic and in Austria. Serious reduction of the anamorph, caused by hyperparasitic fungus &lt;I&gt;Ampelomyces quisqualis&lt;/I&gt;, was recorded on the sample from Austria.

오이 흰가루병 생물적 방제를 위한 중복기생균 Ampelomyces quisqualis 94013의 선발 및 동정

국내에서 73종의 식물에서의 흰가루병균에서 중복기생균인 Ampelomyces 속 308 균주를 분리하였다. 팥의 흰가루병균에서 분리한 AQ94013 균주는 오이 흰가루병균에 가장 기생력이 우수한 균주로 선발되었다. 94013 균주의 병자각은 담갈색이나 다갈색이며, 구형이나 긴 서양배 모양으로, 그 크기는 <TEX>$52.5{\sim}82.5{\times}35.0{\sim}47.5$</TEX>(평균 <TEX>$62.5{\times}40.5){\mu}m$</TEX>이다. 병포자는 옅은 갈색의 단세포이며, 세포안에 유적이 보이고, 곧은 원통모양의 방추형이며, 크기는 <TEX>$5.0{\sim}8.0{\times}2.5{\sim}4.3$</TEX> (평균 <TEX>$6.0{\times}3.0){\mu}m$</TEX>이다. 그러므로 AQ94013 균주는 형태학적 및 분자적 특성을 조사한 결과에서 Ampelomyces quisqualis로 동정하였다. 또한 Ampelomyces quisqualis 94013균주는 기 상업화한 Ampelomyces sp. AQ10균주 등의 rDNA ITS sequence를 비교 분석한 결과에서 다른 균주임이 증명되었다. 308 isolates of Ampelomyces sp. were isolated from powdery mildew fungi of 73 plant species in Korea for selection of biocontrol agents. An isolate 94013 isolated from powdery mildew fungus of red bean was selected as an effective biological control agent against cucumber powdery mildew in greenhouse. The morphological characteristics of the isolate is as follows. Pycnidia were sub-globose or elongated to pyriform, pale to dart brown, <TEX>$52.5{\sim}82.5\;{\times}\;35.0{\sim}47.5\;(ave.\;62.5{\times}40.5){\mu}m$</TEX>, and conidia were guttulate, straight cylindrical to fusiform, pale brown, <TEX>$5.0{\sim}8.0\;{\times}\;2.5{\sim}4.3\;(ave.\;6.0{\times}3.0){\mu}m$</TEX>. The isolate 94013 was identified as Ampelomyces quisqualis by morphological characteristics and rDNA ITS sequencing. The isolate A. quisqualis 94013 was different from that of the commercial product <TEX>$AQ10^R$</TEX> in the rDNA ITS sequence.