Adeno-associated Virus Terminal Repeat Research Articles

Computationally designed adeno-associated virus (AAV) Rep 78 is efficiently maintained within an adenovirus vector

Adeno-associated virus (AAV) is a single-stranded parvovirus retaining the unique capacity for site-specific integration into a transcriptionally silent region of the human genome, a characteristic requiring the functional properties of the Rep 78/68 polypeptide in conjunction with AAV terminal repeat integrating elements. Previous strategies designed to assemble these genetic elements into adenoviral (Ad) backbones have been limited by the general intolerability of AAV Rep sequences, prompting us to computationally reengineer the Rep gene by using synonymous codon pair recoding. Rep mutants generated by using de novo genome synthesis maintained the polypeptide sequence and endonuclease properties of Rep 78, while dramatically enhancing Ad replication and viral titer yields, characteristics indistinguishable from adenovirus lacking coexpressed Rep. Parallel approaches using domain swaps encompassing WT and recoded genomic segments, coupled with iterative computational algorithms, collectively established that 3' cis-acting Rep genetic elements (and not the Rep 78 polypeptide) retain dominant-acting sequences inhibiting Ad replication. These data provide insights into the molecular relationships of AAV Rep and Ad replication, while expanding the applicability of synonymous codon pair reengineering as a strategy to effect phenotypic endpoints.

Generation of Novel AAV Variants by Directed Evolution for Improved CFTR Delivery to Human Ciliated Airway Epithelium

Recombinant adeno-associated virus (AAV) vectors expressing the cystic fibrosis transmembrane conductance regulator (CFTR) gene have been used to deliver CFTR to the airway epithelium of cystic fibrosis (CF) patients. However, no significant CFTR function has been demonstrated likely due to low transduction efficiencies of the AAV vectors. To improve AAV transduction efficiency for human airway epithelium (HAE), we generated a chimeric AAV library and performed directed evolution of AAV on an in vitro model of human ciliated airway epithelium. Two independent and novel AAV variants were identified that contained capsid components from AAV-1, AAV-6, and/or AAV-9. The transduction efficiencies of the two novel AAV variants for human ciliated airway epithelium were three times higher than that for AAV-6. The novel variants were then used to deliver CFTR to ciliated airway epithelium from CF patients. Here we show that our novel AAV variants, but not the parental, AAV provide sufficient CFTR delivery to correct the chloride ion transport defect to ~25% levels measured in non-CF cells. These results suggest that directed evolution of AAV on relevant in vitro models will enable further improvements in CFTR gene transfer efficiency and the development of an efficacious and safe gene transfer vector for CF lung disease.

Efficient Intrathymic Gene Transfer Following In Situ Administration of a rAAV Serotype 8 Vector in Mice and Nonhuman Primates

The thymus is the primary site of T-cell development and plays a key role in the induction of self-tolerance. We previously showed that the intrathymic (i.t.) injection of a transgene-expressing lentiviral vector (LV) in mice can result in the correction of a T cell-specific genetic defect. Nevertheless, the efficiency of thymocyte transduction did not exceed 0.1-0.3% and we were unable to detect any thymus transduction in macaques. As such, we initiated studies to assess the capacity of recombinant adeno-associated virus (rAAV) vectors to transduce murine and primate thymic cells. In vivo administration of AAV serotype 2-derived single-stranded AAV (ssAAV) and self-complementary AAV (scAAV) vectors pseudotyped with capsid proteins of serotypes 1, 2, 4, 5, and 8 demonstrated that murine thymus transduction was significantly enhanced by scAAV2/8. Transgene expression was detected in 5% of thymocytes and, notably, transduced cells represented 1% of peripheral T lymphocytes. Moreover, i.t. administration of scAAV2/8 particles in macaques, by endoscopic-mediated guidance, resulted in significant gene transfer. Thus, in healthy animals, where thymic gene transfer does not provide a selective advantage, scAAV2/8 is a unique tool promoting the in situ transduction of thymocytes with the subsequent export of gene-modified lymphocytes to the periphery.

Percutaneous Transendocardial Delivery of Self-complementary Adeno-associated Virus 6 Achieves Global Cardiac Gene Transfer in Canines

Achieving efficient cardiac gene transfer in a large animal model has proven to be technically challenging. Previous strategies have used cardiopulmonary bypass or dual catheterization with the aid of vasodilators to deliver vectors, such as adenovirus, adeno-associated virus (AAV), or plasmid DNA. Although single-stranded AAV (ssAAV) vectors have shown the greatest promise, they suffer from delayed expression, which might be circumvented using self-complementary vectors. We sought to optimize cardiac gene transfer using a percutaneous transendocardial injection catheter to deliver adeno-associated viral vectors to the canine myocardium. Four vectors were evaluated--ssAAV9, self-complementary AAV9 (scAAV9), scAAV8, scAAV6--so that comparison could be made between single-stranded and self-complementary vectors as well as among serotypes 9, 8, and 6. We demonstrate that scAAV is superior to ssAAV and that AAV 6 is superior to the other serotypes evaluated. Biodistribution studies revealed that vector genome copies were 15-4,000 times more abundant in the heart than in any other organ for scAAV6. Percutaneous transendocardial injection of scAAV6 is a safe, effective method to achieve efficient cardiac gene transfer.

104. The Adeno-Associated Virus Terminal Repeat Hairpin Structure Effects Expression from Transfected DNA, but Not Recombination Frequency

104. The Adeno-Associated Virus Terminal Repeat Hairpin Structure Effects Expression from Transfected DNA, but Not Recombination Frequency

Adeno-associated Virus of a Single-polarity DNA Genome Is Capable of Transduction In Vivo

The adeno-associated virus (AAV) is a promising vector for gene therapy. Further improvement of the virus for clinical application depends on better understanding of the molecular structure and fate of the vector genome. AAV vectors with wild-type inverted terminal repeats package either the plus- or the minus-strand DNA genomes with equal frequency. By creating a series of deletions within the, we have developed a genetic approach that can generate an AAV vector that packages its single-stranded DNA genome predominantly in a single polarity (99.4%). This novel reagent efficiently transduced muscle, brain and liver in whole animals. The transduction efficiencies were similar to those of the control mixed-polarity vectors. Our results showed that reannealing of plus- and minus-strand DNA was not required for AAV-mediated transduction in vivo, supporting the hypothesis that second-strand DNA synthesis is a primary pathway in converting the single-stranded AAV genome into double-stranded forms. The availability of the single-polarity AAV vector would aid further studies on the mechanism of AAV transduction as well as the application of AAV vector for gene replacement therapy.

A Hybrid Vector System Expands Adeno-associated Viral Vector Packaging Capacity in a Transgene-independent Manner

The trans-splicing (ts) and overlapping (ov) vectors expand the packaging capacity of adeno-associated virus (AAV). But their application depends on the inherent properties of the target gene. The ts vectors require an optimal gene-splitting site and the ov vectors require a highly recombinogenic domain. In order to overcome these limitations, we developed a hybrid dual (hd) vector system. In the hd vectors, we inserted a highly recombinogenic alkaline phosphatase (AP) sequence in the ts vectors to allow for transgene-independent reconstitution through homologous recombination of the AP sequences. We first tested the hybrid system with the LacZ gene. Both in the cell line (in vitro) and in the mouse muscle (in vivo), the hd vectors significantly outperformed the ts and ov vectors. In muscle, the transduction efficiency of the hybrid vectors reached 80% of that from the single intact vector. Southern blot confirmed AP sequence-mediated transgene reconstitution. In order to validate the hybrid system, we split the 6 kilobase (kb) mini-dystrophin gene at the exon 55/56 junction, a predicted poor site for the ts approach. In dystrophic mdx mouse muscle, the hd vectors yielded 5.6-fold higher transduction than the ts vectors did. Taken together, these data suggest that the hybrid system efficiently expresses large therapeutic genes that are poor candidates for the ts and ov approaches.

Adeno-associated virus terminal repeat (TR) mutant generates self-complementary vectors to overcome the rate-limiting step to transduction in vivo.

An important limitation of recombinant adeno-associated virus (rAAV) vector efficiency is the requirement of hostcell-mediated synthesis of double-stranded DNA from the single-stranded genome. We have bypassed this step in a specialized self-complementary rAAV (scAAV) vector, by utilizing the tendency of AAV to package DNA dimers when the replicating genome is half the length of the wild type (wt). To produce these vectors efficiently, we have deleted the terminal resolution site (trs) from one rAAV TR, preventing the initiation of replication at the mutated end. These constructs generate single-stranded, inverted repeat genomes, with a wt TR at each end, and a mutated TR in the middle. After uncoating, the viral DNA folds through intramolecular base pairing within the mutant TR, which then proceeds through the genome to form a double-stranded molecule. We have used the scAAV to investigate barriers to rAAV transduction in the mouse liver, muscle and brain. In each tissue, scAAV was characterized by faster onset of gene expression and higher transduction efficiency. This study confirms earlier predictions that complementary-strand DNA synthesis is the primary barrier to rAAV-2 transduction. The scAAV is unaffected by this barrier, and provides an extremely efficient vector for gene transfer into many types of cells in vivo.

Characterization of the adenoassociated virus Rep protein complex formed on the viral origin of DNA replication

Interaction between the adenoassociated virus (AAV) replication proteins, Rep68 and 78, and the viral terminal repeats (TRs) is mediated by a DNA sequence termed the Rep-binding element (RBE). This element is necessary for Rep-mediated unwinding of duplex DNA substrates, directs Rep catalyzed cleavage of the AAV origin of DNA replication, and is required for viral transcription and proviral integration. Six discrete Rep complexes with the AAV TR substrates have been observed in vitro, and cross-linking studies suggest these complexes contain one to six molecules of Rep. However, the functional relationship between Rep oligomerization and biochemical activity is unclear. Here we have characterized Rep complexes that form on the AAV TR. Both Rep68 and Rep78 appear to form the same six complexes with the AAV TR, and ATP seems to stimulate formation of specific, higher order complexes. When the sizes of these Rep complexes were estimated on native polyacrylamide gels, the four slower migrating complexes were larger than predicted by an amount equivalent to one or two TRs. To resolve this discrepancy, the molar ratio of protein and DNA was calculated for the three largest complexes. Data from these experiments indicated that the larger complexes included multiple TRs in addition to multiple Rep molecules and that the Rep-to-TR ratio was approximately 2. The two largest complexes were also associated with increased Rep-mediated, origin cleavage activity. Finally, we characterized a second, Rep-mediated cleavage event that occurs adjacent to the normal nicking site, but on the opposite strand. This second site nicking event effectively results in double-stranded DNA cleavage at the normal nicking site.

Replication competent helper functions for recombinant AAV vector generation.

Adeno-associated virus (AAV) is a promising gene transfer vector tested in both animal studies and human clinical trials. However, current production methods are generally inefficient and require improvements to meet the increasing clinical need for economical, high titer and high quality rAAV vectors. The inefficiency of the current systems largely arises from the AAV helper function, which contains only the AAV coding region but lacks inverted terminal repeats. The terminal repeats were originally removed to prevent replication competent AAV contamination. Here we designed a novel and highly efficient rAAV helper function containing AAV terminal repeats. The new helper function not only mimics the wild-type AAV growth as it replicates along with the vector plasmid, but also restores the cis regulating function of the AAV terminal repeats. Addition of heterologous introns to the helper genome and use of a mutant AAV terminal repeat defective in packaging effectively controls the contamination of replication competent AAV particles. This new strategy also performs better in AAV producing cell lines than those based on non-replicating AAV rep and cap genome.

Adeno-associated virus (AAV) site-specific recombination does not require a Rep-dependent origin of replication within the AAV terminal repeat.

Adeno-associated virus (AAV) is the only known eukaryotic virus capable of targeted integration in human cells. An AAV Rep binding element (RBE) and terminal resolution site (trs) identical to the viral terminal repeats required for AAV DNA replication are located on chromosome (ch) 19. Both ch-19 RBE and trs elements have been shown to be essential for viral targeting to this locus. To characterize the role of the AAV inverted terminal repeat (ITR) cis-acting sequences in targeted integration an AAV trs mutant incapable of supporting viral replication was tested. Wild-type and mutant substrates were assayed for targeted integration after cotransfection in the presence or absence of Rep. Our results demonstrated that, in the presence of Rep78, both ITR substrates targeted to ch-19 with similar frequency. Molecular characterization of the mutant ITR integrants confirmed the presence of the trs mutation in the majority of samples tested. Complementation analysis confirmed that the mutant targeted viral genomes were unable to rescue and replicate. In addition, Rep78 induced extensive rearrangement and amplification of ch-19 sequences independent of wild-type or mutant targeting substrate. These studies demonstrate that Rep-dependent nicking of the viral cis-acting trs sequence is not a prerequisite for site-specific recombination and suggests AAV targeting is mediated by Rep78/68-dependent replication from the ch-19 origin of replication (ori). These studies have significant impact toward the understanding of AAV site-specific recombination and the development of targeting vectors.

Adeno-associated virus (AAV) site-specific recombination does not require a Rep-dependent origin of replication within the AAV terminal repeat

Adeno-associated virus (AAV) site-specific recombination does not require a Rep-dependent origin of replication within the AAV terminal repeat

Adeno-associated virus (AAV) Rep protein enhances the generation of a recombinant mini-adenovirus (Ad) utilizing an Ad/AAV hybrid virus.

Mini-adenoviruses (mAd) deleted of all viral coding regions represent an emerging approach for transgene expression. We have exploited the unique features of the adeno-associated virus (AAV) terminal repeats within the context of an adenovirus-adeno-associated hybrid virus (Ad/AAV) as a strategy for rapid and efficient generation of mAd. Excision and generation of mAd from the parental Ad/AAV hybrid vector was achieved in 293 cells through recombination but without selection for mAd production. Analysis of mAd isolated from 293 cells indicated that mAd DNA exists as monomer and dimer forms within the recombinant viral capsid. Formation of recombinant mAd was significantly increased using an AAV Rep78- or Rep68-expressing cell line through Rep-mediated excision utilizing the AAV terminal repeat sequences present in the Ad/AAV hybrid virus genome. The mAd viruses were infectious and able to transfer functional gene to A549 and HeLa cells. This approach is rapid and efficient, thereby providing a simplified methodology for generating mAd with functional transducing capabilities.

Novel Transcriptional Regulatory Signals in the Adeno-Associated Virus Terminal Repeat A/D Junction Element

Novel Transcriptional Regulatory Signals in the Adeno-Associated Virus Terminal Repeat A/D Junction Element

In vitro packaging of adeno-associated virus DNA.

We have developed an in vitro procedure for packaging of recombinant adeno-associated virus (AAV). By using AAV replicative-form DNA as the substrate, it is possible to synthesize an infectious AAV particle in vitro that can be used to transfer a marker gene to mammalian cells. The packaging procedure requires the presence of both the AAV Rep and capsid proteins. Two kinds of in vitro products can be formed which facilitate DNA transfer. Both are resistant to heat and have a density in cesium chloride gradients that is indistinguishable from that of the in vivo-synthesized wild-type virus. This indicates that the particles formed have the appropriate protein-to-DNA ratio and a structure that shares the heat resistance of mature AAV particles. The two types of particles can be distinguished by their sensitivity to chloroform and DNase I treatment. The chloroform-resistant product is, by several criteria, an authentic AAV particle. In addition to having the correct density and being resistant to treatment with chloroform, DNase I, and heat, this particle is efficiently synthesized only if the AAV genome contains intact terminal repeats, which are known to be required for AAV packaging. It is also precipitated by a monoclonal antibody that recognizes mature virus particles but not bound by an antibody that recognizes monomeric or denatured capsid proteins. The chloroform-resistant species is not made when aphidicolin is present in the reaction mixture, suggesting that active DNA replication is required for in vitro packaging. In contrast, the chloroform-sensitive product has several features that suggest it is an incompletely assembled virus particle. It is sensitive to DNase I, does not require the presence of AAV terminal repeats, and is capable of transferring DNA that is theoretically too large to package. Sucrose gradient centrifugation of the in vitro-synthesized products reveals that the particles have sedimentation values between 60S and 110S, which is consistent with partially assembled and mature AAV particles. The in vitro packaging procedure should be useful for studying the mechanism by which a human icosahedral DNA virus particle is assembled, and it may be useful for producing recombinant AAV for gene therapy. The chloroform-sensitive particle may also be useful for transferring DNA that is too large to be packaged in mature recombinant AAV.

Cellular recombination pathways and viral terminal repeat hairpin structures are sufficient for adeno-associated virus integration in vivo and in vitro.

The human parvovirus adeno-associated virus (AAV) is unique in its ability to target viral integration to a specific site on chromosome 19 (ch-19). Recombinant AAV (rAAV) vectors retain the ability to integrate but have apparently lost this ability to target. In this report, we characterize the terminal-repeat-mediated integration for wild-type (wt), rAAV, and in vitro systems to gain a better understanding of these differences. Cell lines latent for either wt or rAAV were characterized by a variety of techniques, including PCR, Southern hybridization, and fluorescence in situ hybridization analysis. More than 40 AAV-rAAV integration junctions were cloned, sequenced, and then subjected to comparison and analysis. In both immortalized and normal diploid human cells, wt AAV targeted integration to ch-19. Integrated provirus structures consisted of head-to-tail tandem arrays with the majority of the junction sequences involving the AAV inverted terminal repeats (ITRs). No complete viral ITRs were directly observed. In some examples, the AAV p5 promoter sequence was found to be fused at the virus-cell junction. Data from dot blot analysis of PCR products were consistent with the occurrence of inversions of genomic and/or viral DNA sequences at the wt integration site. Unlike wt provirus junctions, rAAV provirus junctions mapped to a subset of non-ch-19 sequences. Southern analysis supported the integration of proviruses from two independent cell lines at the same locus on ch-2. In addition, provirus terminal repeat sequences existed in both the flip and flop orientations, with microhomology evident at the junctions. In all cases with the exception of the ITRs, the vector integrated intact. rAAV junction sequence data were consistent with the occurrence of genomic rearrangement by deletion and/or rearrangement-translocation at the integration locus. Finally, junctions formed in an in vitro system between several AAV substrates and the ch-19 target site were isolated and characterized. Linear AAV substrates typically utilized the end of the virus DNA substrate as the point of integration, whereas products derived from AAV terminal repeat hairpin structures in the presence or absence of Rep protein resembled AAV-ch-19 junctions generated in vivo. These results describing wt AAV, rAAV, and in vitro integration junctions suggest that the viral integration event itself is mediated by terminal repeat hairpin structures via nonviral cellular recombination pathways, with specificity for ch-19 in vivo requiring additional viral components. These studies should have an important impact on the use of rAAV vectors in human gene therapy.

Analysis of recombinant adeno-associated virus packaging and requirements for rep and cap gene products.

Adeno-associated virus (AAV) is a human parvovirus currently being developed as a vector for gene therapy applications. Because the gene transfer vector commonly retains only the AAV terminal repeats, propagation of recombinant AAV (rAAV) requires that the viral replication (Rep) and capsid (Cap) proteins be supplied in trans. In an effort to optimize the production of these vectors, a panel of helper plasmids was constructed to determine if expression of the rep and/or cap genes is a limiting factor for rAAV packaging. Expression of the Rep and Cap proteins was increased by replacing the endogenous AAV promoters, p5 and p40, with the Rous sarcoma virus (RSV) long terminal repeat (LTR) and the cytomegalovirus immediate-early promoter, respectively. Increased synthesis of the Cap proteins resulted in an approximately 10-fold increase in the yield of rAAV, indicating that production of capsid proteins is one limiting factor for rAAV packaging. Expression of the rep gene from the RSV LTR not only failed to increase the yield of rAAV but also prevented activation of p40 transcription with adenovirus infection, resulting in a reduced level of capsid protein synthesis.

A novel 165-base-pair terminal repeat sequence is the sole cis requirement for the adeno-associated virus life cycle.

Adeno-associated virus (AAV) replication is dependent on two copies of a 145-bp inverted terminal repeat (ITR) that flank the AAV genome. This is the primary cis-acting element required for productive infection and the generation of recombinant AAV (rAAV) vectors. We have engineered a plasmid (pDD-2) containing only 165 bp of AAV sequence: two copies of the D element, a unique sequence adjacent to the AAV nicking site, flanking a single ITR. When assayed in vivo, this modified hairpin was sufficient for the replication of the plasmid vector when Rep and adenovirus (Ad) helper functions were supplied in trans. pDD-2 replication intermediates were characteristic of the AAV replication scheme in which linear monomer, dimer, and other higher-molecular-weight replicative intermediates are generated. Compared to infectious AAV clones for replication, the modified hairpin vector replicated more efficiently independent of size. Further analysis demonstrated conversion of the input circular plasmid to a linear substrate with AAV terminal repeat elements at either end as an initial step for replication. This conversion was independent of both Rep and Ad helper genes, suggesting the role of host factors in the production of these molecules. The generation of these substrates suggested resolution of the modified terminal repeat through a Holliday-like structure rather than replication as a mechanism for rescue. Production of replicative intermediates via this plasmid substrate were competent not only for AAV DNA replication but also for encapsidation, infection, integration, and subsequent rescue from the chromosome when superinfected with Ad and wild-type AAV. These studies demonstrate that this novel 165-bp ITR substrate is sufficient in cis for the AAV life cycle and should provide a valuable reagent for further dissecting the cis sequences involved in AAV replication, packaging, and integration. In addition, this novel plasmid vector can be used as a substrate for both rAAV vector production and synthetic plasmid vector delivery.

The adeno-associated virus Rep78 major regulatory protein forms multimeric complexes and the domain for this activity is contained within the carboxy-half of the molecule

The adeno-associated virus (AAV) encoded Rep78 is a multifunctional protein which is able to regulate transcription, is required for AAV DNA replication, and appears necessary for site specific integration of AAV DNA into human chromosome 19. Being analogous to the large T antigen, the replication protein of polyomaviruses which is known to homo-multimerize, it seemed likely that the Rep78 protein would also interact with itself to carry out at least some of its functions. Furthermore, in electrophoretic mobility shift assay studies by many laboratories on Rep78/68 protein interaction with AAV terminal repeat DNA it has been noticed that multiple high bands often result. These data suggest Rep78-Rep78 interaction. In this study it is directly demonstrated that Rep78 is able to form multimeric complexes as measured by West-Western and chemical cross-linking assays. Furthermore, using an amino-truncated Rep78 protein, it is demonstrated that the Rep78 homo-multimerization domain is contained within the carboxy-half of the protein.

Sequence requirements for binding of Rep68 to the adeno-associated virus terminal repeats

We have used reciprocal competition binding experiments with mutant substrates and chemical modification interference assays to precisely define the sequences within the adeno-associated virus (AAV) terminal repeat (TR) that are involved in site-specific binding to the AAV Rep protein. Mutagenesis experiments were done with a 43-bp oligonucleotide which contained the Rep binding element (RBE) within the A stem of the TR. Experiments in which two adjacent base pairs of the RBE were substituted simultaneously with nucleotides that produced transversions identified a 22-bp sequence (CAGTGAGCGAGCGAGCGCGCAG) in which substitutions measurably affected the binding affinity. Although the 22-bp RBE contains the GAGC motifs that have been found in all known Rep binding sites, our results suggest that the GAGC motifs alone are not the only sequences specifically recognized by Rep. The effects of substitutions within the 22-bp sequence were relatively symmetrical, with nucleotides at the periphery of the RBE having the least effect on binding affinity and those in the middle having the greatest effect. Dinucleotide mutations within 18 (GTGAGCGAGCGAGC) of the 22 bp were found to decrease the binding affinity by at least threefold. Dinucleotide mutations within a 10-bp core sequence (GCGAGCGAGC) were found to decrease binding affinity by more than 10-fold. Single-base substitutions within the 10-bp core sequence lowered the binding affinity by variable amounts (up to fivefold). The results of the mutagenesis analysis suggested that the A-stem RBE contains only a single Rep binding site rather than two or more independent sites. To confirm the results of the mutant analysis and to determine the relative contribution of each base to binding, chemical modification experiments using dimethyl sulfate and hydrazine were performed on both the linear A-stem sequence and the entire AAV TR in both the flip and flop hairpinned configurations. Interference assays on the linear A stem identified the 18-bp sequence described above as essential for binding. G, C, and T residues on both strands contributed to binding, and the interference pattern correlated well with the results of the mutagenesis experiments. Interference assays with complete hairpinned TR substrates also identified the 18-bp sequence as important for binding. However, the interference patterns on the two strands within the RBE and the relative contributions of the individual bases to binding were clearly different between the hairpinned substrates and the linear A-stem binding element. Interference assays also allowed us to search for residues within the small internal palindromes of the TR (B and C) that contribute to binding. The largest effect was seen by modification of two T residues within the sequence CTTTG. This sequence was present in the same position relative to the terminal resolution site (trs) in both the flip and flop orientations of the TR. In addition, the interference pattern suggested that the remaining bases within the CTTTG motif as well as other bases within the B and C palindromes make contacts with the Rep protein, albeit with lower affinities. Regardless of whether the TR was in the flip or flop orientation, most of the contact points were clustered in the small internal palindrome furthest away from the trs. We also determined the relative binding affinity of linear substrates containing a complete RBE with hairpinned substrates and found that linear substrates bound Rep less efficiently. Our results were consistent with our previous model that there are three distinct elements within the hairpinned AAV TR that contribute to binding affinity or to efficient nicking at the trs: the A-stem RBE, the secondary structure element which consists of the B and C palindromes, and the trs.