Serum Response Factor Activity Research Articles

SRF’ing Around the Clock

Central circadian clock oscillators, located in the suprachiasmatic nucleus (SCN) of the hypothalamus, align peripheral clock systems with geosynchronous time. Gerber et al. (2013) identify actin polymerization and serum response factor (SRF) activation as key steps linking the central master clock to peripheral oscillators.

Silodosin Inhibits Noradrenaline-Activated Transcription Factors Elk1 and SRF in Human Prostate Smooth Muscle

BackgroundThe transcription factors Elk1 and serum response factor (SRF) are central regulators of cell cycle and phenotype in various cell types. Elk1 is activated by phosphorylation (serine-383), while activation of SRF requires its co-factor, myocardin. Activation of Elk1 and SRF results in binding to specific DNA sequences in promoter regions, and may be induced by adrenergic receptor activation in different organs.ObjectiveTo examine the effects of adrenergic stimulation on Elk1 and SRF in the human prostate and the ability of the highly selective α1A-adrenoceptor antagonist, silodosin, on transcription factor activation.MethodsProstate tissue was obtained from patients undergoing radical prostatectomy. Expression of Elk1, SRF, and myocardin was estimated by Western blot and immunohistochemistry. Colocalizations were studied by double immunofluorescence staining. Noradrenaline- (NA-) and phenylephrine- (PE-) induced phosphorylation of Elk1 was assessed by Western blot analysis using a phospho-specific antibody. NA-induced activation of Elk1 and SRF was investigated by electrophoretic mobility shift assay (EMSA).ResultsImmunoreactivity for Elk1, SRF, and myocardin was observed in stromal cells of tissues from each patient. In fluorescence stainings, SRF colocalized with myocardin and α-smooth muscle actin (αSMA). Stimulation of prostate tissues with PE (10 µM) or NA (30 µM) increased the phosphorylation of Elk1 at serine-383. NA-induced Elk1 activation was confirmed by EMSA, where a NA-induced binding of Elk1 to the DNA sequence TTTGCAAAATGCAGGAATTGTTTTCACAGT was observed. Similarly, NA caused SRF binding to the SRF-specific DNA sequence CCATATTAGGCCATATTAGG. Application of silodosin (3 µM) to prostate tissues reduced the activity of Elk1 and SRF in NA-stimulated tissues.ConclusionsSilodosin blocks the activation of the two transcription factors, Elk1 and SRF, which is induced by noradrenaline in the human prostate. A role of α1-adrenoceptors beyond smooth muscle contraction may be considered, which includes a function in transcriptional regulation.

Induction of Megakaryocyte Differentiation Drives Nuclear Accumulation and Transcriptional Function of MKL1 Via Actin Polymerization and RhoA Activation

Abstract 3440 Background:How components of the cytoskeleton regulate complex cellular responses is fundamental to understanding cellular function. Megakaryocyte Leukemia 1 (MKL1), an activator of serum response factor (SRF) transcriptional activity, plays critical roles in muscle, neuron, and megakaryocyte differentiation. Regulation of MKL1 subcellular localization is one mechanism by which a cell can control SRF activity with MKL1 localization to the nucleus being critical for its function as a transcriptional activator. MKL1 subcellular localization is cell-type specific; MKL1 is predominantly cytoplasmic in unstimulated fibroblasts and some muscle cell types until it is sequestered in the nucleus following actin polymerization. In contrast, MKL1 is constitutively localized to the nucleus in neuronal cells. Objective:We tested the hypothesis that MKL1 subcellular localization is tightly regulated in megakaryocytic cells during induction of maturation. Methods and Results:Using a human erythroleukemia (HEL) cell line, we systematically dissected the events that occur after 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced megakaryocytic differentiation to assess the relationships between RhoA activation, actin polymerization, MKL1 subcellular localization, and upregulation of SRF-target genes essential for megakaryocyte differentiation. In response to treatment with TPA, the percentage of HEL cells with predominantly nuclear localization went from <5% to over 50% in 2 hours. We found that TPA triggered RhoA activation and subsequent actin polymerization, each of which was necessary for MKL1 nuclear accumulation. In the absence of TPA, activation of RhoA and actin polymerization by calpeptin and Jasplakinolide, respectively, resulted in a statistically significant (p<.001) increase in MKL1 nuclear localization. Conversely, in cells exposed to TPA, Rho inhibition and actin depolymerization by a cell permeable C3 Transferase and Latrunculin B, respectively, caused a decrease in MKL1 nuclear localization (p<.01). Interference with MKL1 transcriptional activity using either dominant negative MKL1 (lacking the transcriptional activation domain) or the MKL1 chemical inhibitor CCG-1423 was sufficient to prevent TPA-induced expression of the SRF target genes MYL9, MYH9, and MMP9, all of which are necessary for proper megakaryocyte differentiation and maturation. Finally, we used timelapse microscopy to analyze the subcellular movement of a GFP tagged MKL1 in primary megakaryocytes. As predicted, Rho activation and actin polymerization were sufficient to drive MKL1 to the nucleus. Importantly, exposure of primary megakaryocytes to the physiological agonist thrombopoietin (TPO) stimulated MKL1 nuclear localization within minutes. Conclusions:Subcellular localization and regulation of MKL1 in megakaryocytes is dependent on RhoA activity and actin organization, similar to its regulation in fibroblasts and smooth muscle cells. Induction of megakaryocytic differentiation of HEL cells with TPA and primary megakaryocytes with TPO promotes MKL1 nuclear localization and downstream gene activation. This report broadens our knowledge of the mechanisms of action by which TPO promotes megakaryocyte differentiation. Disclosures:No relevant conflicts of interest to declare.

Salt, skeletons, and suicide. Focus on “Hyperosmotic stress regulates the distribution and stability of myocardin-related transcription factor, a key modulator of the cytoskeleton”

high NaCl and other sources of hypertonicity are cellular stresses that span evolution. A protective response common to most organisms is cellular accumulation of compatible organic osmolytes, driven by increased transcription of transporters and synthesizing enzymes. In mammalian cells the

Phosphoinositide 3-Kinase C2β Regulates RhoA and the Actin Cytoskeleton through an Interaction with Dbl

The regulation of cell morphology is a dynamic process under the control of multiple protein complexes acting in a coordinated manner. Phosphoinositide 3-kinases (PI3K) and their lipid products are widely involved in cytoskeletal regulation by interacting with proteins regulating RhoGTPases. Class II PI3K isoforms have been implicated in the regulation of the actin cytoskeleton, although their exact role and mechanism of action remain to be established. In this report, we have identified Dbl, a Rho family guanine nucleotide exchange factor (RhoGEF) as an interaction partner of PI3KC2β. Dbl was co-immunoprecipitated with PI3KC2β in NIH3T3 cells and cancer cell lines. Over-expression of Class II phosphoinositide 3-kinase PI3KC2β in NIH3T3 fibroblasts led to increased stress fibres formation and cell spreading. Accordingly, we found high basal RhoA activity and increased serum response factor (SRF) activation downstream of RhoA upon serum stimulation. In contrast, the dominant-negative form of PI3KC2β strongly reduced cell spreading and stress fibres formation, as well as SRF response. Platelet-derived growth factor (PDGF) stimulation of wild-type PI3KC2β over-expressing NIH3T3 cells strongly increased Rac and c-Jun N-terminal kinase (JNK) activation, but failed to show similar effect in the cells with the dominant-negative enzyme. Interestingly, epidermal growth factor (EGF) and PDGF stimulation led to increased extracellular signal-regulated kinase (Erk) and Akt pathway activation in cells with elevated wild-type PI3KC2β expression. Furthermore, increased expression of PI3KC2β protected NIH3T3 from detachment-dependent death (anoikis) in a RhoA-dependent manner. Taken together, these findings suggest that PI3KC2β modulates the cell morphology and survival through a specific interaction with Dbl and the activation of RhoA.

Regulation of serum response factor by miRNA‐200 and miRNA‐9 modulates oligodendrocyte progenitor cell differentiation

Serum response factor (SRF) is a transcription factor that transactivates actin-associated genes and has been implicated in oligodendrocyte (OL) differentiation. To date, it has not been investigated in cerebral ischemia. We investigated the dynamics of SRF expression after stroke in vivo and the role of SRF in OL differentiation in vitro. Using immunohistochemistry, we found that SRF was upregulated in OLs and OL precursor cells (OPCs) after stroke. Moreover, upregulation of SRF was concurrent with downregulation of the micro-RNAs (miRNAs) miR-9 and the miR-200 family in the ischemic white matter region, the corpus callosum. Inhibition of SRF activation by CCG-1423, a specific inhibitor of SRF function, blocked OPCs from differentiating into OLs. Overexpression of miR-9 and miR-200 in cultured OPCs suppressed SRF expression and inhibited OPC differentiation. Moreover, co-expression of miR-9 and miR-200 attenuated activity of a luciferase reporter assay containing the Srf 3' untranslated region. Collectively, this study is the first to show that stroke upregulates SRF expression in OPCs and OLs, and that SRF levels are mediated by miRNAs and regulate OPC differentiation.

Myocardin-A enhances expression of promyogenic genes without depressing telomerase activity in adipose tissue-derived mesenchymal stem cells

BackgroundThe stromal compartment of adult adipose tissue consists of mesenchymal stem cells (MSCs) characterized by co-expression of myocardin-A (McA) and telomerase reverse transcriptase (TERT). ObjectiveThis study aims at testing the growth and myogenic regenerative properties of adipose tissue-derived MSCs, and the outcome of McA and TERT overexpression or suppression. Methods and resultsTERT and/or McA in murine MSCs derived from adult adipose tissue were transduced with cDNA and co-immunoprecipitated with specific antibodies. The MSCs with TERT or TERT plus McA overexpressed were highly proliferative. Bioluminescence resonance energy transfer assay evidenced close interactions between TERT and McA in MSCs co-transfected with TERT and McA, which expressed the stem cell oncogene Oct-4, and promyogenic genes GATA-4, Nkx2.5, MLC2v, Mef2c, DTEF and McA. The increased myogenic gene expression depended on TERT and McA expression as siRNAs for TERT and McA diminished the TERT activities. The co-transfected MSCs also developed a stronger activity of serum response factor, a key factor for expression of cardiomyogenic genes. McA overexpression did not interfere with TERT-mediated proliferative effects, and rather slightly increased proliferation of MSCs. ConclusionsMcA and TERT may interplay in promoting promyogenic gene expression and maintaining growth capacity of MSCs.

A Critical Cell-Intrinsic Role for Serum Response Factor in Glial Specification in the CNS

Astrocytes and oligodendrocytes play crucial roles in nearly every facet of nervous system development and function, including neuronal migration, synaptogenesis, synaptic plasticity, and myelination. Previous studies have widely characterized the signaling pathways important for astrocyte differentiation and unveiled a number of transcription factors that guide oligodendrocyte differentiation in the CNS. However, the identities of the transcription factors critical for astrocyte specification in the brain remain unknown. Here we show that deletion of the stimulus-dependent transcription factor, serum response factor (SRF), in neural precursor cells (NPCs) (Srf-Nestin-cKO) results in nearly 60% loss in astrocytes and 50% loss in oligodendrocyte precursors at birth. Cultured SRF-deficient NPCs exhibited normal growth rate and capacity to self-renew. However, SRF-deficient NPCs generated fewer astrocytes and oligodendrocytes in response to several lineage-specific differentiation factors. These deficits in glial differentiation were rescued by ectopic expression of wild-type SRF in SRF-deficient NPCs. Interestingly, ectopic expression of a constitutively active SRF (SRF-VP16) in NPCs augmented astrocyte differentiation in the presence of pro-astrocytic factors. However, SRF-VP16 expression in NPCs had an inhibitory effect on oligodendrocyte differentiation. In contrast, mice carrying conditional deletion of SRF in developing forebrain neurons (Srf-NEX-cKO) did not exhibit any deficits in astrocytes in the brain. Together, our observations suggest that SRF plays a critical cell-autonomous role in NPCs to regulate astrocyte and oligodendrocyte specification in vivo and in vitro.

Serum Response Factor and cAMP Response Element Binding Protein Are Both Required for Cocaine Induction of ΔFosB

The molecular mechanism underlying induction by cocaine of ΔFosB, a transcription factor important for addiction, remains unknown. Here, we demonstrate a necessary role for two transcription factors, cAMP response element binding protein (CREB) and serum response factor (SRF), in mediating this induction within the mouse nucleus accumbens (NAc), a key brain reward region. CREB and SRF are both activated in NAc by cocaine and bind to the fosB gene promoter. Using viral-mediated Cre recombinase expression in the NAc of single- or double-floxed mice, we show that deletion of both transcription factors from this brain region completely blocks cocaine induction of ΔFosB in NAc, whereas deletion of either factor alone has no effect. Furthermore, deletion of both SRF and CREB from NAc renders animals less sensitive to the rewarding effects of moderate doses of cocaine when tested in the conditioned place preference (CPP) procedure and also blocks locomotor sensitization to higher doses of cocaine. Deletion of CREB alone has the opposite effect and enhances both cocaine CPP and locomotor sensitization. In contrast to ΔFosB induction by cocaine, ΔFosB induction in NAc by chronic social stress, which we have shown previously requires activation of SRF, is unaffected by the deletion of CREB alone. These surprising findings demonstrate the involvement of distinct transcriptional mechanisms in mediating ΔFosB induction within this same brain region by cocaine versus stress. Our results also establish a complex mode of regulation of ΔFosB induction in response to cocaine, which requires the concerted activities of both SRF and CREB.

Targeted Deletion of MicroRNA-22 Promotes Stress-Induced Cardiac Dilation and Contractile Dysfunction

Delineating the role of microRNAs (miRNAs) in the posttranscriptional gene regulation offers new insights into how the heart adapts to pathological stress. We developed a knockout of miR-22 in mice and investigated its function in the heart. Here, we show that miR-22-deficient mice are impaired in inotropic and lusitropic response to acute stress by dobutamine. Furthermore, the absence of miR-22 sensitized mice to cardiac decompensation and left ventricular dilation after long-term stimulation by pressure overload. Calcium transient analysis revealed reduced sarcoplasmic reticulum Ca(2+) load in association with repressed sarcoplasmic reticulum Ca(2+) ATPase activity in mutant myocytes. Genetic ablation of miR-22 also led to a decrease in cardiac expression levels for Serca2a and muscle-restricted genes encoding proteins in the vicinity of the cardiac Z disk/titin cytoskeleton. These phenotypes were attributed in part to inappropriate repression of serum response factor activity in stressed hearts. Global analysis revealed increased expression of the transcriptional/translational repressor purine-rich element binding protein B, a highly conserved miR-22 target implicated in the negative control of muscle expression. These data indicate that miR-22 functions as an integrator of Ca(2+) homeostasis and myofibrillar protein content during stress in the heart and shed light on the mechanisms that enhance propensity toward heart failure.

Tu1351 Functional Consequences of G Protein-Coupled Receptor 68 (GPR68/OGR1) Overexpression in Intestinal Epithelial Cells

Background: A single layer of epithelial cells creates a physical barrier between the external lumen and the internal milieu of the gastrointestinal tract. During inflammation, which is typically associated with a decrease in local pH, the intestinal barrier can be disrupted. Defects in barrier integrity have been implicated in the pathophysiology of inflammatory bowel disease (IBD). However, the molecular mechanisms mediating the responses to changes in pH are not well understood. G-protein-coupled receptor 68 (GPR68), also known as ovarian cancer GPR1 (OGR1), is a proton-sensing receptor, which upon acidification stimulates second messenger signaling, such as intracellular Ca2+ flux, inositol phosphate (IP) formation, and extracellular signal-regulated kinase (ERK) phosphorylation. We have investigated OGR1-mediated signaling pathways in response to lowered pH in intestinal epithelialcells. The colon carcinoma-derived-Caco2 cell monolayers can be used as In Vitro cell culture models of the human intestinal epithelium. Methods/Results: The OGR1 cDNA fragment was generated by PCR, and cloned into the pcDNA3.1 vector carrying a neomycin resistance gene. Clonal selection of stably transfected Caco2s was by limiting dilution or cloning cylinders, using the selection agent G418 (400 mg/ml). OGR1-overexpressing clones were selected by positive mRNA/protein expression and immunofluorescence, and those exhibiting strong IP formation upon acidification were chosen for further studies. The selected Caco2-OGR1 clones showed a typical pH-dependent GPCR response, in both intracellular Ca2+ signaling and label-free assays (EPIC). In addition, they exhibited weak but significant formation of cAMP upon extracellular acidification. When compared to the Caco2 vector control clone, the Caco2-OGR1 clones showed ERK phosphorylation after a pH shift from pH 7.9 to pH 6.8 for 5 minutes, by Western blotting. No pH-dependent phosphorylation remained present after 30 minutes. The Caco2-OGR1 clones exhibited significant serum response factor (SRF) activity at acidic pH but not at alkaline or neutral pH, in dual luciferase assays using SRE-dependent promoter constructs. Consistent with this, mRNA expression of a SRF target gene c-FOS was elevated in parallel. Electric Cell-Substrate Impedance Sensing (ECIS) assays showed tightening of the barrier in the Caco2-OGR1 monolayers at acidic pH, but not at neutral or alkaline pH. Conclusion: We have created Caco2 cell clones stably overexpressing OGR1, and have shown that these serve as valid tools to study OGR1 function and OGR1-mediated signaling. OGR1 overexpression in intestinal epithelial cells enhanced ERK signaling, led to increased tight junction formation, and increased SRF activity. Unravelling OGR1-dependent signaling may aid our understanding of the pathophysiology of IBD.

Morphine Activates the E Twenty Six-Like Transcription Factor-1/Serum Response Factor Pathway via Extracellular Signal-Regulated Kinases 1/2 in F11 Cells Derived from Dorsal Root Ganglia Neurons

Morphine-induced signaling via opioid receptors (ORs) in dorsal root ganglia (DRG) neurons, the spinal cord, and various brain regions has been shown to modulate gene activity. Hitherto, little attention has been paid to extracellular signal-regulated kinases-1/2 (ERK-1/2)-mediated activation of the serum response factor (SRF) and ternary complex factors (TCFs) such as the E twenty six-like transcription factor-1 (ELK-1) in this context. Using TCF/SRF-dependent reporter gene constructs, a specific ERK-1/2 inhibitor and a dominant-negative ELK-1 mutant, we show herein that morphine activates ELK-1 via ERK-1/2 in DRG-derived F11 cells endogenously expressing μ and δ ORs. Previous studies with glioma cell lines such as NG108-15 cells attributed morphine-induced gene expression to the activation of the cAMP-responsive element binding protein (CREB). Thus, we also analyzed morphine-dependent activation of CREB in F11 and NG108-15 cells. In contrast to the CREB stimulation found in NG108-15 cells, we observed an inhibitory effect of morphine in F11 cells, indicating cell type-specific regulation of CREB by morphine. To obtain data about putative target genes of morphine-induced ELK-1/SRF activation, we analyzed mRNA levels of 15 ELK-1/SRF-dependent genes in cultured rat DRG neurons and F11 cells. We identified the early growth response protein-4 (EGR-4) as the strongest up-regulated gene in both cell types and observed ELK-1 activity-dependent activation of an EGR-4-driven reporter in F11 cells. Overall, we reveal an important role of ELK-1 for morphine-dependent gene induction in DRG-derived cells and propose that ELK-1 and EGR-4 contribute to the effects of morphine on neuronal plasticity.

Actin-dependent activation of serum response factor in T cells by the viral oncoprotein tip

Serum response factor (SRF) acts as a multifunctional transcription factor regulated by mutually exclusive interactions with ternary complex factors (TCFs) or myocardin-related transcription factors (MRTFs). Binding of Rho- and actin-regulated MRTF:SRF complexes to target gene promoters requires an SRF-binding site only, whereas MAPK-regulated TCF:SRF complexes in addition rely on flanking sequences present in the serum response element (SRE). Here, we report on the activation of an SRE luciferase reporter by Tip, the viral oncoprotein essentially contributing to human T-cell transformation by Herpesvirus saimiri. SRE activation in Tip-expressing Jurkat T cells could not be attributed to triggering of the MAPK pathway. Therefore, we further analyzed the contribution of MRTF complexes. Indeed, Tip also activated a reporter construct responsive to MRTF:SRF. Activation of this reporter was abrogated by overexpression of a dominant negative mutant of the MRTF-family member MAL. Moreover, enrichment of monomeric actin suppressed the Tip-induced reporter activity. Further upstream, the Rho-family GTPase Rac, was found to be required for MRTF:SRF reporter activation by Tip. Initiation of this pathway was strictly dependent on Tip's ability to interact with Lck and on the activity of this Src-family kinase. Independent of Tip, T-cell stimulation orchestrates Src-family kinase, MAPK and actin pathways to induce SRF. These findings establish actin-regulated transcription in human T cells and suggest its role in viral oncogenesis.

MicroRNA-200c Represses Migration and Invasion of Breast Cancer Cells by Targeting Actin-Regulatory Proteins FHOD1 and PPM1F

MicroRNA-200c (miR-200c) has been shown to suppress epithelial-mesenchymal transition (EMT), which is attributed mainly to targeting of ZEB1/ZEB2, repressors of the cell-cell contact protein E-cadherin. Here we demonstrated that modulation of miR-200c in breast cancer cells regulates cell migration, cell elongation, and transforming growth factor β (TGF-β)-induced stress fiber formation by impacting the reorganization of cytoskeleton that is independent of the ZEB/E-cadherin axis. We identified FHOD1 and PPM1F, direct regulators of the actin cytoskeleton, as novel targets of miR-200c. Remarkably, expression levels of FHOD1 and PPM1F were inversely correlated with the level of miR-200c in breast cancer cell lines, breast cancer patient samples, and 58 cancer cell lines of various origins. Furthermore, individual knockdown/overexpression of these target genes phenocopied the effects of miR-200c overexpression/inhibition on cell elongation, stress fiber formation, migration, and invasion. Mechanistically, targeting of FHOD1 by miR-200c resulted in decreased expression and transcriptional activity of serum response factor (SRF), mediated by interference with the translocation of the SRF coactivator mycocardin-related transcription factor A (MRTF-A). This finally led to downregulation of the expression and phosphorylation of the SRF target myosin light chain 2 (MLC2) gene, required for stress fiber formation and contractility. Thus, miR-200c impacts on metastasis by regulating several EMT-related processes, including a novel mechanism involving the direct targeting of actin-regulatory proteins.

Leiomodin 1, a New Serum Response Factor-dependent Target Gene Expressed Preferentially in Differentiated Smooth Muscle Cells

Smooth muscle cell (SMC) differentiation is defined largely by a number of cell-restricted genes governed directly by the serum response factor (SRF)/myocardin (MYOCD) transcriptional switch. Here, we describe a new SRF/MYOCD-dependent, SMC-restricted gene known as Leiomodin 1 (Lmod1). Conventional and quantitative RT-PCRs indicate that Lmod1 mRNA expression is enriched in SMC-containing tissues of the mouse, whereas its two paralogs, Lmod2 and Lmod3, exhibit abundant expression in skeletal and cardiac muscle with very low levels in SMC-containing tissues. Western blotting and immunostaining of various adult and embryonic mouse tissues further confirm SMC-specific expression of the LMOD1 protein. Comparative genomic analysis of the human LMOD1 and LMOD2 genes with their respective mouse and rat orthologs shows high conservation between the three exons and several noncoding sequences, including the immediate 5' promoter region. Two conserved CArG boxes are present in both the LMOD1 and LMOD2 promoter regions, although LMOD1 displays much higher promoter activity and is more responsive to SRF/MYOCD stimulation. Gel shift assays demonstrate clear binding between SRF and the two CArG boxes in human LMOD1. Although the CArG boxes in LMOD1 and LMOD2 are similar, only LMOD1 displays SRF or MYOCD-dependent activation. Transgenic mouse studies reveal wild type LMOD1 promoter activity in cardiac and vascular SMC. Such activity is abolished upon mutation of both CArG boxes. Collectively, these data demonstrate that Lmod1 is a new SMC-restricted SRF/MYOCD target gene.

MKL2 Functions in the Absence of MKL1 to Promote Megakaryocyte Maturation

Abstract 2336 Background:The transcriptional cofactors, MKL1 and MKL2, are members of the myocardin related factor family, which bind and activate the transcription factor Serum Response Factor (SRF) (Cen et al J Cell Biochem, 2004). Megakaryocytes, large, highly polyploid myeloid cells give rise to platelets, which promote blood clotting in response to tissue damage. The Krause lab has reported a significant decrease in Mk ploidy with a 50% decrease in mature platelets in Mkl1 knockout (KO) mice, indicating that MKL1 may contribute to megakaryocyte maturation (Cheng et al Blood, 2009). The phenotype of the Mk specific (PF4-Cre) Srf conditional KO (SRF PF4-cKO) further supports the importance for the MKL1/SRF pathway in Mk differentiation (Halene et al Blood, 2010); although similar to the Mkl1 KO mouse, the Srf PF4-cKO mouse has a more severe phenotype with a 90% decrease in platelet counts suggesting the presence of compensatory proteins or redundant pathways in Mkl1 KO mice. Objective:This study addresses the hypothesis that MKL2 is critical for normal megakaryocytopoiesis particularly in the absence of MKL1. Methods and Results:Using bone marrow (BM) transplantation, we determined that the Mkl1 KO phenotype (decreased megakaryocyte ploidy and decreased platelets) is cell autonomous. Lethally irradiated WT recipients of Mkl1 KO BM cells had a 50% decrease in platelet count, as well as significantly decreased ploidy indicated by the percentage of Mk with 2N (60% and 40% in the recipients of Mkl1 KO vs WT BM, respectively, p<0.0001). Transduction of Mkl1 KO donor BM cells with retrovirus encoding MKL1 cDNA rescued the ploidy phenotype. Although the Mkl1 KO mice are thrombocytopenic, their bleeding times are not significantly increased. In vitro studies show that MKL2 and MKL1 activate the same promoters in luciferase assays and have similar subcellular localization patterns, suggesting redundancy.To assess MKL2’s compensatory function in Mkl1 KO mice, we crossed Mkl2F/F mice with PF4-Cre mice to induce Mkl2 deletion in the Mk compartment (Mkl2 PF4-cKO). The Mkl2 PF4-cKO mice were mated onto the Mkl1 KO background to create double KO (DKO) megakaryocytes. The megakaryocyte ploidy and platelet counts (decreased by 90%) of DKO mice are more severe than the Mkl1 KO and comparable to the Srf PF4-Cre cKO mice In addition, bleeding times were significantly increased compared to WT and Mkl1 KO mice (p<0.0001). Electron microscopy and immunofluorescence of DKO megakaryocytes and platelets indicate abnormal cytoskeletal and membrane organization with decreased granule complexity. These morphological changes are consistent with abnormal in vitro platelet activation in response to ADP or thrombin. Conclusions:Our investigation reveals that both MKL1 and MKL2 are important for megakaryocyte differentiation, and that MKL2 mitigates the phenotype of MKL1 deficient megakaryocytes. The Mkl1 KO/Mkl2 PF4-cKO (DKO) mice phenocopy the Srf PF4-cKO mice suggesting that SRF activity in megakaryocyte differentiation is dependent on the myocardin related transcription factor family of proteins. Disclosures:No relevant conflicts of interest to declare.

LARG links histamine-H1-receptor-activated Gq to Rho-GTPase-dependent signaling pathways

Activation of heterotrimeric G proteins, such as G12/13 and Gq, by cell surface receptors is coupled to the regulation of numerous cellular functions controlled by activated Rho GTPases. Previous studies have implicated the Rho guanine nucleotide exchange factor (RhoGEF) leukemia-associated RhoGEF (LARG) as a regulatory protein receiving stimulatory inputs from activated Gα12/13 and Gαq. However, the molecular mechanisms of the Gαq-mediated LARG activation are not fully understood and the structural elements of LARG involved in this process have remained unclear. In the present work, the specific coupling of the histamine H1 receptor (HRH1) exogenously expressed in COS-7 cells to Gq, but not to G12/13, was used to conduct a detailed analysis of receptor- and Gαq-mediated LARG activation and to define its structural requirements. The results show that HRH1-mediated activation of the strictly Rho-dependent transcriptional activity of serum response factor requires the PDZ domain of LARG and can be mimicked by activated GαqQ209L. The functional interaction between activated Gαq and LARG requires no more than the catalytic DH–PH tandem of LARG, and is independent of PLCβ activation and distinct from the mechanisms of Gαq-mediated p63RhoGEF and PLCβ3 activation. Activated Gαq physically interacts with the relevant portions of LARG in COS-7 cells and histamine causes activation of LARG in native HeLa cells endogenously expressing HRH1, Gq, and LARG. This work is the first positive demonstration of a stimulatory effect of LARG on the ability of a strictly Gq-coupled receptor to cause activation of a Rho-GTPase-dependent signaling pathway.

Shape-Induced Terminal Differentiation of Human Epidermal Stem Cells Requires p38 and Is Regulated by Histone Acetylation

Engineered model substrates are powerful tools for examining interactions between stem cells and their microenvironment. Using this approach, we have previously shown that restricted cell adhesion promotes terminal differentiation of human epidermal stem cells via activation of serum response factor (SRF) and transcription of AP-1 genes. Here we investigate the roles of p38 MAPK and histone acetylation. Inhibition of p38 activity impaired SRF transcriptional activity and shape-induced terminal differentiation of human keratinocytes. In addition, inhibiting p38 reduced histone H3 acetylation at the promoters of SRF target genes, FOS and JUNB. Although histone acetylation correlated with SRF transcriptional activity and target gene expression, treatment with the histone de-acetylase inhibitor, trichostatin A (TSA) blocked terminal differentiation on micro-patterned substrates and in suspension. TSA treatment simultaneously maintained expression of LRIG1, TP63, and ITGB1. Therefore, global histone de-acetylation represses stem cell maintenance genes independent of SRF. Our studies establish a novel role for extrinsic physical cues in the regulation of chromatin remodeling, transcription, and differentiation of human epidermal stem cells.

Delayed stress fiber formation mediates pulmonary myofibroblast differentiation in response to TGF-β.

Myofibroblast differentiation induced by transforming growth factor-β (TGF-β) and characterized by de novo expression of smooth muscle (SM)-specific proteins is a key process in wound healing and in the pathogenesis of fibrosis. We have previously shown that TGF-β-induced expression and activation of serum response factor (SRF) is required for this process. In this study, we examined the signaling mechanism for SRF activation by TGF-β as it relates to pulmonary myofibroblast differentiation. TGF-β stimulated a profound, but delayed (18-24 h), activation of Rho kinase and formation of actin stress fibers, which paralleled SM α-actin expression. The translational inhibitor cycloheximide blocked these processes without affecting Smad-dependent gene transcription. Inhibition of Rho kinase by Y-27632 or depolymerization of actin by latrunculin B resulted in inhibition TGF-β-induced SRF activation and SM α-actin expression, having no effect on Smad signaling. Conversely, stabilization of actin stress fibers by jasplakinolide was sufficient to drive these processes in the absence of TGF-β. TGF-β promoted a delayed nuclear accumulation of the SRF coactivator megakaryoblastic leukemia-1 (MKL1)/myocardin-related transcription factor-A, which was inhibited by latrunculin B. Furthermore, TGF-β also induced MKL1 expression, which was inhibited by latrunculin B, by SRF inhibitor CCG-1423, or by SRF knockdown. Together, these data suggest a triphasic model for myofibroblast differentiation in response to TGF-β that involves 1) initial Smad-dependent expression of intermediate signaling molecules driving Rho activation and stress fiber formation, 2) nuclear accumulation of MKL1 and activation of SRF as a result of actin polymerization, and 3) SRF-dependent expression of MKL1, driving further myofibroblast differentiation.

The miR-143/145 Cluster Is a Novel Transcriptional Target of Jagged-1/Notch Signaling in Vascular Smooth Muscle Cells

Activation of Notch signaling by Jagged-1 (Jag-1) in vascular smooth muscle cells (VSMC) promotes a differentiated phenotype characterized by increased expression of contractile proteins. Recent studies show that microRNAs (miR)-143/145 regulates VSMC phenotype. The serum response factor (SRF)/myocardin complex binds to CArG sequences to activate miR-143/145 transcription, but no other regulators are known in VSMC. Using miR arrays, we found miR-143/145 induced following expression of a constitutively active Notch1 intracellular domain (N1ICD). We hypothesized that miR-143/145 is required for Jag-1/Notch-induced VSMC differentiation. Activation of Notch receptors by Jag-1 caused CBF1-dependent up-regulation of miR-143/145, increased differentiation, and decreased proliferation. Conversely, inhibiting basal Notch signaling decreased steady state levels of miR-143/145. Using SRF knockdown, we found that Jag-1/Notch induction of miR-143/145 is SRF independent, although full acquisition of contractile markers requires SRF. Using miR-143/145 promoter reporter constructs we show Jag-1/Notch increases promoter activity, and this is dependent on intact CBF1 consensus sites within the promoter. Chromatin immunoprecipitation (ChIP) assays revealed that N1ICD-containing complexes bind to CBF1 sites in the miR-143/145 promoter. We also identified N1ICD complex binding to CBF1 sites within the endogenous human miR-143/145 promoter. Using miR-143/145-interfering oligonucleotides, we demonstrate that Jag-1/Notch signaling requires induction of both miR-143 and miR-145 to promote the VSMC contractile phenotype. Thus, miR-143/145 is a novel transcriptional target of Jag-1/Notch signaling in VSMC. We propose miR-143/145 as activated independently by Jag-1/Notch and SRF in parallel pathways. Multiple pathways converging on miR-143/145 provides potential for fine-tuning or amplification of VSMC differentiation signals.