Absence Of Divalent Metal Ions Research Articles

Recombinant production and characterization of a metal ion-independent Lysophospholipase from a hyperthermophilic archaeon Pyrococcus abyssi DSM25543

Genome sequence of Pyrococcus abyssi DSM25543 contains a coding sequence (PAB_RS01410) for α/β hydrolase (WP_010867387.1). Structural analysis revealed the presence of a consensus motif GXSXG and a highly conserved catalytic triad in the amino acid sequence of α/β hydrolase that were characteristic features of lysophospholipases. A putative lysophospholipase from P. abyssi with its potential applications in oil degumming and starch processing was heterologously produced in E. coli Rosetta (DE3) pLysS in soluble form followed by its purification and characterization. The recombinant enzyme was found to be active at temperature of 40–90 °C and pH 5.5–7.0. However, the enzyme exhibited its optimum activity at 65 °C and pH 6.5. None of the metal ions (Mn2+, Mg2+, Ni2+, Cu2+, Fe2+, Co2+, Zn2+ and Ca2+) being tested had stimulatory effect on lysophospholipase activity. Km and Vmax for hydrolysis of 4-nitrophenyl butyrate were calculated to be 1 ± 0.089 mM and 1637 ± 24.434 U/mg, respectively. It is the first report on the soluble production and characterization of recombinant lysophospholipase from P. abyssi which exhibits its lipolytic activity in the absence of divalent metal ions. Broad substrate specificity, activity and stability at elevated temperatures make recombinant lysophospholipase an ideal candidate for potential industrial applications.

In vitro Selection of Chemically Modified DNAzymes.

DNAzymes are in vitro selected DNA oligonucleotides with catalytic activities. RNA cleavage is one of the most extensively studied DNAzyme reactions. To expand the chemical functionality of DNA, various chemical modifications have been made during and after selection. In this review, we summarize examples of RNA‐cleaving DNAzymes and focus on those modifications introduced during in vitro selection. By incorporating various modified nucleotides via polymerase chain reaction (PCR) or primer extension, a few DNAzymes were obtained that can be specifically activated by metal ions such as Zn2+ and Hg2+. In addition, some modifications were introduced to mimic RNase A that can cleave RNA substrates in the absence of divalent metal ions. In addition, single modifications at the fixed regions of DNA libraries, especially at the cleavage junctions, have been tested, and examples of DNAzymes with phosphorothioate and histidine‐glycine modified tertiary amine were successfully obtained specific for Cu2+, Cd2+, Zn2+, and Ni2+. Labeling fluorophore/quencher pair right next to the cleavage junction was also used to obtain signaling DNAzymes for detecting various metal ions and cells. Furthermore, we reviewed work on the cleavage of 2′‐5′ linked RNA and L‐RNA substrates. Finally, applications of these modified DNAzymes as biosensors, RNases, and biochemical probes are briefly described with a few future research opportunities outlined at the end.

Molecular Basis for Ser/Thr Specificity in PKA Signaling.

cAMP-dependent protein kinase (PKA) is the major receptor of the second messenger cAMP and a prototype for Ser/Thr-specific protein kinases. Although PKA strongly prefers serine over threonine substrates, little is known about the molecular basis of this substrate specificity. We employ classical enzyme kinetics and a surface plasmon resonance (SPR)-based method to analyze each step of the kinase reaction. In the absence of divalent metal ions and nucleotides, PKA binds serine (PKS) and threonine (PKT) substrates, derived from the heat-stable protein kinase inhibitor (PKI), with similar affinities. However, in the presence of metal ions and adenine nucleotides, the Michaelis complex for PKT is unstable. PKA phosphorylates PKT with a higher turnover due to a faster dissociation of the product complex. Thus, threonine substrates are not necessarily poor substrates of PKA. Mutation of the DFG+1 phenylalanine to β-branched amino acids increases the catalytic efficiency of PKA for a threonine peptide substrate up to 200-fold. The PKA Cα mutant F187V forms a stable Michaelis complex with PKT and shows no preference for serine versus threonine substrates. Disease-associated mutations of the DFG+1 position in other protein kinases underline the importance of substrate specificity for keeping signaling pathways segregated and precisely regulated.

Effect of the Substrate Structure and Metal Ions on the Hydrolysis of Undamaged RNA by Human AP Endonuclease APE1.

Human apurinic/apyrimidinic (AP) endonuclease APE1 is one of the participants in the DNA base excision repair. The main biological function of APE1 is to hydrolyze the phosphodiester bond on the 5′-side of the AP sites. It has been shown recently that APE1 acts as an endoribonuclease and can cleave mRNA, thereby controlling the level of some transcripts. The sequences of CA, UA, and UG dinucleotides are the cleavage sites in RNA. In the present work, we performed a comparative analysis of the cleavage efficiency of model RNA substrates with short hairpin structures in which the loop size and the location of the pyrimidine–purine dinucleotide sequence were varied. The effect of various divalent metal ions and pH on the efficiency of the endoribonuclease reaction was analyzed. It was shown that site-specific hydrolysis of model RNA substrates depends on the spatial structure of the substrate. In addition, RNA cleavage occured in the absence of divalent metal ions, which proves that hydrolysis of DNA- and RNA substrates occurs via different catalytic mechanisms.

Novel Bisimidazole-Containing Peptidomimetic Molecules for Мetal-Independent RNA Cleavage: Synthesis and Solid-Phase Screening Method

Novel bisimidazole-containing peptidomimetic molecules, which can efficiently cleave RNA in the absence of divalent metal ions have been synthesized. The thymidine 5'-monophosphate derivatives modified with these peptidomimetics have been obtained on CPG (controlled pore glass) using a solid phase azide-alkyne cycloaddition. The ability of all synthesized derivatives to cleave RNA has been demonstrated by a solid-phase screening method. The resulting conjugates have provided a 20–100% cleavage of the RNA target in 18 hours. The results allow us to consider the described strategy as a useful approach for the rapid selection of potentially promising peptidomimetic molecules in order to synthesize reactive constructs on their basis.

Unraveling structural insights of ribokinase from Leishmania donovani

Ribokinase (RK) is an ATP dependent sugar kinase that enables the entry of ribose in the metabolism. Leishmania accumulates ribose into the cytosol through hydrolysis of nucleosides and by transport from the extracellular environment. Activation by RK is critical to mobilize the ribose into the metabolism of Leishmania. To understand the catalytic role, the crystal structure of RK (LdRK) from L. donovani was determined in the apo and complex forms with several nucleotides (ATP, AMPPCP and ADP) in the presence of Na+ ion. The dual insertion of five amino acid stretches makes LdRK structurally unique from other reported structures of RKs. The structure of LdRK-ATP provided the basis for positioning of γ-phosphate of ATP by conserved -GAGD- motif. Liganded and unliganded structures of LdRK exists in similar conformation, which suggests binding of nucleotides does not make any significant conformational changes in nucleotide-bound structures. Substitution of a conserved asparagine with phenylalanine in ribose binding pocket differentiates the LdRK from other RKs. Glycerol molecule bound in the substrate binding pocket mimics the enzyme-substrate interactions but in turn, hampers the binding of ribose to LdRK. Comparative structural analysis revealed the flexibility of γ-phosphate, which adopts multiple conformations in the absence of divalent metal ion and ribose. Similar to other RKs, LdRK is also dependent on monovalent as well as divalent cations for its catalytic activity.

PH-Driven RNA Strand Separation under Prebiotically Plausible Conditions

Replication of nucleic acids in the absence of genetically encoded enzymes represents a critical process for the emergence of cellular life. Repeated separation of complementary RNA strands is required to achieve multiple cycles of chemical replication, yet thermal denaturation under plausible prebiotic conditions is impaired by the high temperatures required to separate long RNA strands and by concurrent degradation pathways, the latter accelerated by divalent metal ions. Here we show how the melting temperature of oligoribonucleotide duplexes can be tuned by changes in pH, enabling the separation of RNA strands at moderate temperatures. At the same time, the risk of phosphodiester bond cleavage is reduced under the acid denaturation conditions herein described, both in the presence and in the absence of divalent metal ions. Through a combination of ultraviolet and circular dichroism thermal studies and gel electrophoresis, we demonstrate the relevance of geological pH oscillations in the context of the RNA strand separation problem. Our results reveal new insights in the field of prebiotic chemistry, supporting plausible geochemical scenarios in which non-enzymatic RNA replication might have taken place.

Mechanistic role of nucleobases in self-cleavage catalysis of hairpin ribozyme at ambient versus high-pressure conditions.

Ribozymes catalyze the site-specific self-cleavage of intramolecular phosphodiester bonds. Initially thought to act as metalloenzymes, they are now known to be functional even in the absence of divalent metal ions and specific nucleobases directly participate in the self-cleavage reaction. Here, we use extensive replica exchange molecular dynamics simulations to probe the precise mechanistic role of nucleobases by simulating precatalytic reactant and active precursor states of a hairpin ribozyme along its reaction path at ambient as well as high-pressure conditions. The results provide novel key insights into the self-cleavage of ribozymes. We find that deprotonation of the hydroxyl group is crucial and might be the penultimate step to the self-cleavage. The G8 nucleobase is found to stabilize the activated precursor into inline arrangement for facile nucleophilic attack of the scissile phosphate only after deprotonation of the hydroxyl group. The protonated A38 nucleobase, in contrast, mainly acts a proton donor to the O5'-oxygen leaving group that eventually leads to the self-cleavage. Indeed, systematic high-pressure simulations of catalytically relevant states confirm these findings and, moreover, provide support to the role of ribozymes as piezophilic biocatalysts with regard to their relevance in early life under extreme conditions in the realm of RNA world hypothesis.

Selective Alkylation of C-Rich Bulge Motifs in Nucleic Acids by Quinone Methide Derivatives.

A quinone methide precursor featuring a bis-cyclen anchoring moiety has been synthesized and its capacity to alkylate oligonucleotide targets quantified in the presence and absence of divalent metal ions (Zn(2+) , Ni(2+) and Cd(2+) ). The oligonucleotides were designed for testing the sequence and secondary structure specificity of the reaction. Gel electrophoretic analysis revealed predominant alkylation of C-rich bulges, regardless of the presence of divalent metal ions or even the bis-cyclen anchor. This C-selectivity appears to be an intrinsic property of the quinone methide electrophile as reflected by its reaction with an equimolar mixture of the 2'-deoxynucleosides. Only dA-N1 and dC-N3 alkylation products were detected initially and only the dC adduct persisted for detection under conditions of the gel electrophoretic analysis.

HOP2-MND1 modulates RAD51 binding to nucleotides and DNA.

The HOP2-MND1 heterodimer is required for progression of homologous recombination in eukaryotes. In vitro, HOP2-MND1 stimulates the DNA strand exchange activities of RAD51 and DMC1. We demonstrate that HOP2-MND1 induces changes in the conformation of RAD51 that profoundly alter the basic properties of RAD51. HOP2-MND1 enhances the interaction of RAD51 with nucleotide cofactors and modifies its DNA binding specificity in a manner that stimulates DNA strand exchange. It enables RAD51 DNA strand exchange in the absence of divalent metal ions required for ATP binding and offsets the effect of the K133A mutation that disrupts ATP binding. During nucleoprotein formation HOP2-MND1 helps to load RAD51 on ssDNA restricting its dsDNA-binding and during the homology search it promotes dsDNA binding removing the inhibitory effect of ssDNA. The magnitude of the changes induced in RAD51 defines HOP2-MND1 as a “molecular trigger” of RAD51 DNA strand exchange.

Fluorescent peptide sensors for tyrosylprotein sulfotransferase activity

Tyrosine sulfurylation is a post-translational modification important for protein–protein interactions in the extracellular space that are instrumental in cell adhesion, cell signaling, immune responses, and pathogen recognition of host cells. Tyrosine sulfurylation is catalyzed by the tyrosylprotein sulfotransferases (TPSTs), and in humans there are two isoforms: hTPST1 and hTPST2. The study of hTPST function and the development of small molecule probes to examine the role of hTPSTs in cell biology have been delayed by the absence of a continuous direct assay for hTPST activity. We have developed a fluorescent peptide-based assay to directly monitor tyrosine sulfurylation in real time. TPST-mediated tyrosine sulfurylation of the peptides disrupts fluorophore quenching and results in increased fluorescence emission. The assay can be used to study TPST enzymatic activity, and we show that recombinant hTPSTs are active in the absence of divalent metal ions and that optimal activity is at pH 6.0. We further show that the assay can also be used to identify inhibitors of tyrosine sulfurylation. A clear understanding of hTPST function in normal cell biology and in disease states will require the identification of small molecule inhibitors or probes to modulate enzymatic activity, and our results will facilitate that process.

Fe2+ and Cu2+ Increase the Production of Hyaluronic Acid by Lactobacilli via Affecting Different Stages of the Pentose Phosphate Pathway

This study aimed at optimizing the production of hyaluronic acid by Lactobacillus acidophilus FTDC 1231 using response surface methodology and evaluating the effects of divalent metal ions along the production pathway using molecular docking. Among different divalent metal ions that were screened, only iron (II) sulphate and copper (II) sulphate significantly (P < 0.05) affected the production of hyaluronic acid. Subsequent optimization yielded hyaluronic acid at concentration of 0.6152 mg/mL in the presence of 1.24molL(-1) iron (II) sulphate and 0.16molL(-1) of copper (II) sulphate (103% increase compared to absence of divalent metal ions). Data from molecular docking showed Fe(2+) improved the binding affinity of UDP-pyrophophorylase towards glucose-1-phosphate, while Cu(2+) contributed towards the interaction between UDP-glucose dehydrogenase and UDP-glucose. We have demonstrated that lactobacilli could produce hyaluronic acid at increased concentration upon facilitation by specific divalent metal ions, via specific targets of enzymes and substrates along pentose phosphate pathway.

The influence of divalent metal ions on low pH induced LacDNA structural changes as probed with UV resonance Raman spectroscopy

UV (275 nm) resonance Raman spectra of LacDNA 22-mer duplex [d(TAATGTGAGTTAGCTCACTCAT) · d(ATGAGTGAGCTAACTCACATTA)], which contain protein binding sites within the E. coli lac promoter, were measured at two pH values (6.4 and 3.45) in the absence and presence of Mn2+ and Ca2+ metal ions, respectively. Also, the UV (275 nm) resonance Raman markers of the corresponding oligonucleotide d(TAATGTGAGTTAGCTCACTCAT) and of its complementary anti-sense strand d(ATGAGTGAGCTAACTCACATTA) were established and tentatively assigned. Large changes in the UV (275 nm) resonance Raman spectra of LacDNA duplex were observed at pH 3.45 as compared with the corresponding spectrum at pH 6.4, in the absence of divalent metal ions and at low concentrations of Ca2+ ions, respectively. Major changes comprise: adenine protonation, GC base pair protonation, DNA bases unstacking and changes in the hydrogen bonding strength between the strands of different LacDNA complexes, respectively. Divalent metal ions (Mn2+ and Ca2+) were found to inhibit LacDNA protonation even at low concentrations. Manganese(II) ions are much more effective in this regard, as compared with calcium(II) ions. Binding of Mn2+ ions to N7 of guanine and, possibly, in a lesser extent to adenine was observed as judging from the difference Raman bands at 1315, 1354 and 1493 cm−1. Copyright © 2013 John Wiley & Sons, Ltd.

2,6-Bis(functionalized) purines as metal-ion-binding surrogate nucleobases that enhance hybridization with unmodified 2′-O-methyl oligoribonucleotides

The capacity of three different purine bases, viz. 2,6-bis(3,5-dimethylpyrazol-1-yl)purine, 2-(3,5-dimethylpyrazol-1-yl)adenine and 2,6-bis(2-acetyl-1-methylhydrazino)purine, to form metal-ion mediated base pairs with the native nucleobases has been examined. For this purpose, ribonucleosides derived from these bases were incorporated into an intrastrand or a 3'-terminal position of short 2'-O-methyl oligoribonucleotides and the hybridization properties of these base modified oligomers in the absence and presence of three different metal ions (Cu(2+), Zn(2+) and Pd(2+)) were studied by UV- and CD-spectrometry. The first two bases were found to stabilize short oligonucleotide duplexes when incorporated into the 3'-termini of both strands, even in the absence of divalent metal ions but especially in the presence of Cu(2+). The highest melting temperature determined for such a duplex was 71.8 °C, nearly 30 °C higher than the T(m) of the respective solely Watson-Crick paired duplex. Despite the dramatic stabilizing effect of the terminal metallo-base pairs, these short modified oligonucleotides retained sequence-selectivity for the internal Watson-Crick base pairs: two internal mismatches dropped the melting temperature to 10-11 °C. In an internal position, only 2,6-bis(3,5-dimethylpyrazol-1-yl)purine, which in the absence of metal ions was destabilizing, exhibited metal-ion-dependent stabilization of duplex formation with unmodified 2'-O-methyl oligoribonucleotides. The melting temperature in the presence of Cu(2+) was increased from 6 to 14 °C, depending on the identity of the opposite base.

Structure of a metal-independent bacterial glycosyltransferase that catalyzes the synthesis of histo-blood group A antigen

Histo-blood group antigens (HBGAs) are a source of antigenic variation between individuals that modulates resistance and susceptibility to pathogens and is a barrier to the spread of enveloped viruses. HBGAs are also produced by a few prokaryotes where they are synthesized by glycosyltransferases (GTs) related to human HBGA synthases. Here we report the first structure of a bacterial GT of this family, from an intestinal resident, Bacteroides ovatus. Unlike its mammalian homologues and other GTs with similar folds, this protein lacks a metal-binding Asp-X-Asp motif and is fully active in the absence of divalent metal ions, yet is strikingly similar in structure and in its interactions with substrates to structurally characterized mammalian metal-dependent mammalian homologues. This shows how an apparently major divergence in catalytic properties can be accommodated by minor structural adjustments and illustrates the structural underpinnings of horizontal transfer of a functional gene from prokaryotes to vertebrates.

Two Distinct Catalytic Strategies in the Hepatitis Delta Virus Ribozyme Cleavage Reaction

The hepatitis delta virus (HDV) ribozyme and related RNAs are widely dispersed in nature. This RNA is a small nucleolytic ribozyme that self-cleaves to generate products with a 2',3'-cyclic phosphate and a free 5'-hydroxyl. Although small ribozymes are dependent on divalent metal ions under biologically relevant buffer conditions, they function in the absence of divalent metal ions at high ionic strengths. This characteristic suggests that a functional group within the covalent structure of small ribozymes is facilitating catalysis. Structural and mechanistic analyses have demonstrated that the HDV ribozyme active site contains a cytosine with a perturbed pK(a) that serves as a general acid to protonate the leaving group. The reaction of the HDV ribozyme in monovalent cations alone never approaches the velocity of the Mg(2+)-dependent reaction, and there is significant biochemical evidence that a Mg(2+) ion participates directly in catalysis. A recent crystal structure of the HDV ribozyme revealed that there is a metal binding pocket in the HDV ribozyme active site. Modeling of the cleavage site into the structure suggested that this metal ion can interact directly with the scissile phosphate and the nucleophile. In this manner, the Mg(2+) ion can serve as a Lewis acid, facilitating deprotonation of the nucleophile and stabilizing the conformation of the cleavage site for in-line attack of the nucleophile at the scissile phosphate. This catalytic strategy had previously been observed only in much larger ribozymes. Thus, in contrast to most large and small ribozymes, the HDV ribozyme uses two distinct catalytic strategies in its cleavage reaction.

Entropy and Mg2+ control ligand affinity and specificity in the malachite green binding RNA aptamer

The binding of small molecule targets by RNA aptamers provides an excellent model to study the versatility of RNA function. The malachite green aptamer binds and recognizes its ligand via stacking and electrostatic interactions. The binding of the aptamer to its original selection target and three related molecules was determined by isothermal titration calorimetry, equilibrium dialysis, and fluorescence titration. The results reveal that the entropy of complex formation plays a large role in determining binding affinity and ligand specificity. These data combined with previous structural studies show that metal ions are required to stabilize the complexes with non-native ligands whereas the complex with the original selection target is stable at low salt and in the absence of divalent metal ions.

Overexpression of FurA in Anabaena sp. PCC 7120 Reveals New Targets for This Regulator Involved in Photosynthesis, Iron Uptake and Cellular Morphology

Previous genomic analyses of the filamentous nitrogen-fixing cyanobacterium Anabaena sp. PCC 7120 have identified three ferric uptake regulator (Fur) homologs with low sequence identities and probably different functions in the cell. FurA is a constitutive protein that shares the highest homology with Fur from heterotrophic bacteria and appears to be essential for in vitro growth. In this study, we have analysed the effects of FurA overexpression on the Anabaena sp. phenotype and investigated which of the observed alterations were directly operated by FurA. Overexpression of the regulator led to changes in cellular morphology, resulting in shorter filaments with rounded cells of different sizes. The furA-overexpressing strain showed a slower photoautotrophic growth and a marked decrease in the oxygen evolution rate. Overexpression of the regulator also decreased both catalase and superoxide dismutase activities, but did not lead to an increase in the levels of intracellular reactive oxygen species. By combining phenotypic studies, reverse transcription-PCR analyses and electrophoretic mobility shift assays, we identified three novel direct targets of FurA, including genes encoding a siderophore outer membrane transporter (schT), bacterial actins (mreBCD) and the PSII reaction center protein D1 (psbA). The affinity of FurA for these novel targets was markedly affected by the absence of divalent metal ions, confirming previous evidence of a critical role for the metal co-repressor in the function of the regulator in vivo. The results unravel new cellular processes modulated by FurA, supporting its role as a global transcriptional regulator in Anabaena sp. PCC 7120.

Influence of Mg+2 and Cu+2 on the Interaction Between Quinolone and Calf Thymus DNA

Mg(+2) and Cu(+2) have different binding capacities to quinolone drugs and have different binding modes with calf thymus DNA. Using the method of absorption and fluorescence spectroscopy, the influence of Mg(+2) and Cu(+2) on the binding between calf thymus DNA and each of four quinolone drugs has been studied. The results show that both Mg(+2) and Cu(+2) can bind with the four drugs. In the absence of divalent metal ions, quinolone drugs interact with DNA double helix by forming hydrogen bonds between the carboxyl and carbonyl groups of the drugs and the phosphate groups of the DNA bases, and the binding capacity shows a close relationship with the drug structures. The two metal ions show different influences on the binding between the drug and DNA, which depends on the type of ion, concentration of the metal ions and the structure of drugs. Mg(+2) in lower concentrations (0.01 mM to 3.0 mM) can act as a bridge between the carboxyl group/carbonyl group of the drug and the phosphate group of the DNA by electrostatic interaction, while Cu(+2) can act as an intermediary ion between carboxyl group/carbonyl group of the drug and the DNA bases by a co-ordinate bond. Both actions can increase the interaction of the π electron between the condensed rings of the drugs and the DNA bases. In some conditions, Cu(+2) can weaken the binding between the drug and the DNA by competitive inhibition if there is a site on the drug that can directly bind both DNA bases and Cu(+2).

Mononuclear and dinuclear mechanisms for catalysis of phosphodiester cleavage by alkaline earth metal ions in aqueous solution

In biological systems, enzymes often use metal ions, especially Mg(2+), to catalyze phosphodiesterolysis, and model aqueous studies represent an important avenue of examining the contributions of these ions to catalysis. We have examined Mg(2+) and Ca(2+) catalyzed hydrolysis of the model phosphodiester thymidine-5'-p-nitrophenyl phosphate (T5PNP). At 25 degrees C, we find that, despite their different Lewis acidities, these ions have similar catalytic ability with second-order rate constants for attack of T5PNP by hydroxide (k(OH)) of 4.1x10(-4)M(-1)s(-1) and 3.7x10(-4)M(-1)s(-1) in the presence of 0.30M Mg(2+) and Ca(2+), respectively, compared to 8.3x10(-7)M(-1)s(-1) in the absence of divalent metal ion. Examining the dependence of k(OH) on [M(2+)] at 50 degrees C indicates different kinetic mechanisms with Mg(2+) utilizing a single ion mechanism and Ca(2+) operating by parallel single and double ion mechanisms. Association of the metal ion(s) occurs prior to nucleophilic attack by hydroxide. Comparing the k(OH) values reveals a single Mg(2+) catalyzes the reaction by 1800-fold whereas a single Ca(2+) ion catalyzes the reaction by only 90-fold. The second Ca(2+) provides an additional 10-fold catalysis, significantly reducing the catalytic disparity between Mg(2+) and Ca(2+).