16SrIV Group Research Articles

Detection and characterization of palm lethal decline phytoplasmas, subgroups 16SrIV-A and -D, in Phoenix canariensis and Syagrus romanzoffiana in Puebla, Mexico

Phytoplasma subgroups 16SrIV-A and -D are the agents associated with two diseases that significantly threaten palm cultivation in the Americas, namely lethal yellowing (LY) and Texas Phoenix palm decline (TPPD), respectively. Recently, in Puebla State, Mexico, several Phoenix canariensis Chabaud and Syagrus romanzoffiana (Cham.) Glassman palms used as ornamentals began to show symptoms resembling those of TPPD and LY. Therefore, the present study aimed to demonstrate the spread of group 16SrIV phytoplasmas to Puebla, Mexico. Ten symptomatic individuals of both palms were sampled and a nested PCR assay with primer pair P1/P7 followed by LY16Sf/LY16Sr was performed to detect phytoplasma presence. A fragment of about 1.4 kb was amplified in six palms, three (of four) P. canar­iensis and three (of six) S. romanzoffiana. Sequence analysis of the amplicons revealed that the phytoplasma isolates from Puebla were members of group 16SrIV, subgroups – A (one isolate from P. canariensis) and -D (rest of isolates). This study reports the first occurrence of TPPD and LY on ornamental palm species in the state of Puebla, Mexico.

Detection of different groups of phytoplasma in palm species of Puerto Rico

Palm trees play important cultural, ecological, and economic roles in the tropics. Native palm species such as the royal palm, Roystonea borinquena O.F. Cook, are extensively planted in landscapes and urban areas of Hispaniola, Puerto Rico and the Virgin Islands. Worldwide, palms are affected by a disease commonly known as lethal yellowing, linked to the presence of phytoplasmas. Coconut Lethal Yellowing (CLY) is the most devastating disease of palms, associated with the 16SrIV phytoplasma group in the Americas. In Puerto Rico, palms displayed symptoms such as leaf chlorosis or yellowing, inflorescence and fruit necrosis, and eventual death. The objective of this research was to identify and characterize phytoplasmas in palms and their potential insect vectors, focusing on a native palm, R. borinquena. To fulfill this objective, 69 palms belonging to the species: Cocos nucifera (n=15), Gaussia attendata (n=1), Leucothrinax morrisii (n=1), Pseudophenix sargentii (n=1), Roystonea borinquena (n=50) and Washingtonia robusta (n=1) were sampled within three transects across the island. Ninety percent of palms sampled displayed typical lethal yellowing symptoms. In addition, 12 different insect species (Auchenorrhyncha: Fulgoroidea) that could act as potential phytoplasma vectors were sweep-collected from palms and grasses near the study area. The 16S ribosomal region of phytoplasmas was amplified using nested polymerase chain reaction (PCR) and subjected to restriction fragment length polymorphism (RFLP) analyses to allow their ribosomal grouping. Overall, 17 palm samples were positive to phytoplasmas. These are C. nucifera (n = 1), L. morrisii (n = 1) and R. borinquena (n = 15). Phytoplasmas detected belong to six ribosomal groups: 16SrII, 16SrIII, 16SrIV, 16SrVI, 16SrIX and 16SrX. The most frequent phytoplasma detected (59%) is enclosed in the 16SrII group. Samples from nine royal palms (R. borinquena) and one key thatch palm (L. morrisii) were positive to the 16SrII-related group. Only one insect specimen, the cixiid Haplaxius crudus collected from a phytoplasma positive R. borinquena palm, was positive for a 16SrII-related group phytoplasma. Another significant epidemiological finding was the detection of a phytoplasma related to CLY in the 16SrIV group in one individual of R. borinquena. This native species is the most abundant palm on the island. To our knowledge this is the first report of a phytoplasma related to the 16SrII group in R. borinquena in Puerto Rico and the world. Detection for the first time of other phytoplasmas related to 16Sr groups -III, -IX and -X in palms deserves further studies.

Detection of 16SrIV-A phytoplasma DNA in Colpoptera sp. (Hemiptera: Nogodinidae) insects in Yucatan Peninsula, Mexico.

Lethal yellowing (LY) is a disease that affects coconut and other palm species. It is associated to phytoplasmas of the group 16SrIV and the only reported insect vector for this pathogen so far is Haplaxius crudus. H. crudus is present in Mexico and has been associated to 16SrIV phytoplasmas, however, it was not detectable during a LY outbreak in the coast of Yucatan, Mexico, suggesting the existence of other vector species. To test this hypothesis a survey of insects was carried out and a total of 3074 insects were captured during a year of monthly sampling. Ten taxonomic orders were identified in this sample, Hemiptera being the most abundant (N=2094), and these were classified into nine families. The leafhopper Colpoptera sp. from to the Nogodinidae family was de most abundant representing 56% of the total number of insects sampled and 23% of these samples resulted positive for LY phytoplasma by PCR detection. The BLAST comparison, virtual RFLP and phylogenetic analyses of the sequenced amplicons relate the detected phytoplasma to the subgroup 16SrIV-A. The findings presented herein suggest that Colpoptera sp. could be considered as a new putative vector of the LY-causing phytoplasmas in Mexico and a candidate for further research.

Sweet Potato (Ipomea batatas L.): A New Alternative Host of Two Phytoplasmas Associated with Coconut Lethal Yellowing Disease in Côte d’Ivoire

Aims: Coconut Lethal Yellowing Disease has been threatening coconut plantations in Côte d'Ivoire for ten years and has destroyed more than 400 ha. The destruction of the coconut palm leads to phytoplasmas conservation on other plants grown in association or near of the disease outbreaks. Thus, the search for possible alternative host species was conducted.
 Methodology: Surveys were carried out in infected coconut plantations, in order to describe symptoms associated with phytoplasma infections and to collect leaf samples of plant species other than coconut. Symptomatic and non-symptomatic leaves of sweet potato (Ipomea batatas L.) were collected for DNA extraction. The extracted DNA was subjected to molecular characterization.
 Results: Mosaic and leaf reduction symptoms were observed on sweet potato leaves. From these samples, two phytoplasma strains were associated. Molecular analysis showed the presence of the endemic phytoplasma strain belonging to the 16SrXXII-B subgroup ʺCandidatus Phytoplasma palmicolaʺ. Sequencing and phylogenetic analysis also revealed the presence of a new phytoplasma strain, sharing 99% similarity with 16SrIV group strains ʺCandidatus Phytoplasma palmaeʺ.
 Conclusion: The detection of these strains confirms sweet potato for the very first time, as an alternative host for coconut lethal yellowing phytoplasmas in Côte d'Ivoire.

First report of strains related to the phytoplasma associated with Tanzanian Lethal Decline on Cocos nucifera on the western coast of Madagascar.

Madagascar is a high diversity hotspot in the world, and palms are highly represented with nearly 200 endemic species (Rakotoarinivo et al., 2014). Coconut tree (Cocos nucifera) could have been introduced in Madagascar by Austronesians around AD 400 or 700 (Beaujard, 2011). Sporadic coconut trees showing very severe wilt were observed in 2016 in three localities of the western and northern coast of the island: Katsepy (Sample MG16-001), Antsohyhi (MG16-004 and MG16-005) and Ambaritsatrana (MG16-010). Symptoms correspond on a severe ascendant wilt of the leaves, associated with necrosis of the inflorescences and absence of nuts and death of all trees was confirmed eventually. We investigated the implication of phytoplasma because of the apparent similarity in the symptomatology with Coconut Lethal Yellowing Disease and Coconut Lethal Decline occurring in East Africa (Mpunami et al., 1999), and because the western coast of Madagascar faces the Mozambican channel only 400 km apart from areas along the East African coast where those two diseases occur. Symptomatic (n=4) and asymptomatic (n=6) coconut trees were sampled by stem drilling. DNA was extracted from sawdust samples using a modified CTAB protocol (Mpunami et al., 1999). A direct polymerase chain reaction (PCR) targeting the 16S rRNA gene plus Internal transcribed spacer with the P1-1T (AAGAGTTTGATCCTGGCTCAGGAT)/P7 primers (Schneider et al., 1998) amplified a product of about 1.8 kb for MG16-001 and MG16-005 samples only, while the four DNA extracts from symptomatic trees showed a 1.2 kb amplicon by nested PCR using R16F2n/R16R2 primer pairs in the second round (Lee et al., 1998). Amplification of the secA gene using the primer pair secAFor1/secARev3 (Hodgetts et al., 2008) was performed in a single round and gave a product of 850 bp exclusively for the symptomatic tree DNAs. All amplicons were double strand sequenced (Genewiz, UK). Corresponding high quality sequences were deposited in GenBank and submitted to Blastn on NCBI. The partial 16S rRNA gene sequences (accessions MN264629 to MN264632) obtained using R16F2n/R16R2 primers presented the highest similarity (from 99.47 to 99.56%) to the reference sequence for the phytoplasma associated with the Tanzanian Lethal Decline (GenBank accession X80117). This genetic proximity of the Malagasy strains was confirmed by the partial secA gene sequences (accessions MN267853 to MN267856) presenting the highest similarity (from 89.92 to 90.70%) to the Tanzanian Lethal Decline phytoplasma secA gene partial sequence (Genbank accession KJ462071). Full-length 16S rRNA gene sequences of MG16-001 and MG16-005 strains (accessions MN388765 and MN388766) were submitted to iPhyClassifier virtual RFLP tool (Zhao et al., 2009). The iPhyClassifier tool confirmed that Malagasy strains are related to the reference strain X80117 but belong to a different 16Sr subgroup (similarity coefficient from 0.90 to 0.93, Dev. 1). Both Malagassy strains and LDT phytoplasma should be assigned to a new 16Sr group since X80117 is itself erroneously assigned to 16SrIV group while the closest reference sequence AF509322, 16SrIV-A, shared only a similarity of 0.83 (Dev. 1). Occurrence of a phytoplasma associated with a lethal yellowing type syndrome in Madagascar could represent a dangerous threat to coconut crops that play an important socio-economic role in the coastal areas, but also to the many endemic palm species already on high extinction risk.

'Candidatus Phytoplasma dypsidis', a novel taxon associated with a lethal wilt disease of palms in Australia

A phytoplasma was initially detected in Dypsis poivriana by nested and real-time PCR from the botanical gardens in Cairns, Queensland, Australia in 2017. Further surveys in the Cairns region identified phytoplasma infections in eight additional dying ornamental palm species (Euterpe precatoria, Cocos nucifera, Verschaffeltia splendida, Brassiophoenix drymophloeodes, Burretiokentia hapala, Cyrtostachys renda, Reinhardtia gracilis, Carpoxylon macrospermum), a Phoenix species, a Euterpe species and two native palms (Archontophoenix alexandrae). Analysis of 16S rRNA gene sequences showed that this phytoplasma is distinct as it shared less than 97.5 % similarity with all other 'Candidatus Phytoplasma' species. At 96.3 % similarity, the most closely related formally described member of the provisional 'Ca. Phytoplasma' genus was 'Ca. Phytoplasma noviguineense', a novel taxon from the island of New Guinea found in monocotyledonous plants. It was slightly more closely related (96.6-96.8 %) to four palm-infecting strains from the Americas, which belong to strain group 16SrIV and which have not been assigned to a formal 'Candidatus Phytoplasma' species taxon. Phylogenetic analysis of the 16S rRNA gene and ribosomal protein genes of the phytoplasma isolate from a dying coconut palm revealed that the phytoplasma represented a distinct lineage within the phytoplasma clade. As the nucleotide identity with other phytoplasmas is less than 97.5 % and the phylogenetic analyses show that it is distinct, a novel taxon 'Candidatus Phytoplasma dypsidis' is proposed for the phytoplasma found in Australia. Strain RID7692 (GenBank accession no. MT536195) is the reference strain. The impact and preliminary aspects of the epidemiology of the disease outbreak associated with this novel taxon are described.

English

In 2015, a disease of unknown origin appeared in Torreon, Coahuila, in the Northeast of Mexico, causing great mortality in Phoenix palms, especially in Phoenix canariensis. Until early 2019, around 1300 palms died from this disease. The aim of this study was to determine its etiology. The symptoms registered in affected palms were similar to those described for Texas Phoenix Palm Decline (TPPD). Phytoplasmas were detected in samples from nine P. canariensis individuals using a TaqMan/real-time PCR assay specific for group 16SrIV detection. DNA of positive samples was amplified by nested PCR using primer pair P1/P7 followed by LY16Sf/LY16-23Sr and R16F2n/R16R2. In silico analysis of the sequences obtained revealed the presence of phytoplasmas associated with TPPD, belonging to subgroup 16SrIV-D. This is the first report of a disease associated with subgroup 16SrIV-D phytoplasmas in the Northeast of Mexico, further extending the known geographical range of this pathogen.   Key words: Texas Phoenix palm decline, 16SrIV-D phytoplasmas, nested polymerase chain reaction (PCR), sequence analysis.

Haplaxius crudus (Hemiptera: Cixiidae) Transmits the Lethal Yellowing Phytoplasmas, 16SrIV, to Pritchardia pacifica Seem. & H.Wendl (Arecaceae) in Yucatan, Mexico.

Lethal yellowing (LY) affects several palm species in the Americas. It is caused by 16SrIV group phytoplasmas. In Florida (USA), LY was shown to be transmitted by the planthopper Haplaxius crudus ( Van Duzee ) (Hemiptera, Cixiidae) to different palm species, including Pritchardia pacifica Seem . & H. Wendl . (Arecaceae) in insect-proof cage experiments in the 1980s, a result that had never been reproduced later. LY has destroyed many coconut plantations as well as other palm species in the Caribbean and Mexico. In order to evaluate if H. crudus is a vector of LY phytoplasmas in Mexico, experiments were carried out in Yucatan (Mexico). Several H. crudus from palms infected by LY in the field were introduced into cages containing young P. pacifica palms. These insects were able to transmit 16SrIV group phytoplasmas to P. pacifica palms. According to DNA sequences comparative analysis, virtual restriction fragment length polymorphism, and phylogenetic analysis, the phytoplasmas detected in these infected P. pacifica were of subgroups A and D. All of ten P. pacifica palms infected with the subgroup D phytoplasmas developed symptoms of LY and died, whereas only one of two palms infected with subgroup A developed LY symptoms and died. This is the first time, more than 30years later, that the role of H. crudus as a vector of LY is confirmed.

A review on subgroup classification of phytoplasmas enclosed in group 16Sr IV

The ribosomal grouping and subgrouping system provides a means for the provisional classification of phytoplasmas. Within this system, the group 16SrIV mainly includes phytoplasma strains associated with lethal yellowing diseases. While subgroups 16SrIV-A, -B, -C and -D are well established and formally recognized in the scientific literature, the same cannot be said for subgroup 16SrIV-E. At least two different groups of sequences have been proposed to designate a 16SrIV-E subgroup, neither of which is included in the database of the widely used online tool for phytoplasma classification known as iPhyClassifier. This confusion lead to difficulties in identifying new strains, subgroup-specific host listing errors, and could result in the omission or duplication of previous work. The designation of a reference sequence for subgroup 16SrIV-E is thereby proposed. In addition, palm-pathogenic phytoplasma diversity in the Americas is discussed, and evidence is provided for new 16SrIV subgroups to be established to accommodate sequences reported from Jamaica and Mexico that cannot be classified into any of the previously reported subgroups.

Simultaneous detection of coconut lethal yellowing phytoplasmas (group 16SrIV) by real-time PCR assays using 16Sr- and GroEL-based TaqMan probes

Lethal yellowing (LY) represents a serious threat to coconut in Mexico, Central America and the Caribbean islands. It is caused by a phytoplasma of group 16SrIV, and particularly subgroups -A and -D have been the major phytoplasmas affecting coconut palms grown in the southeast of Mexico. Therefore, is important to reliably detect the 16SrIV group of phytoplasmas not only for diagnosis purposes but also to improve the understanding of pathogen-plant-vector pathosystems. The 16S ribosomal operon genes have been particularly used as the targets for probes and primers for universal phytoplasma detection. However, its conservative nature has imposed the search of non-ribosomal genes to support a finer characterization and differentiation of phytoplasmas, particularly those closely related and one alternative has been the GroEL gene for the specific detection of subgroups 16SrIV-A and 16SrIV-D. Sensitive, rapid and reliable singleplex and duplex assays were developed based on real-time PCR (TaqMan) targeting both the GroEL gene and 16S rRNA. The assay performed with higher sensitivity compared to conventional nested-PCR when analysing DNA extracts obtained from LY symptom bearing palms. The LY 16S TaqMan probe assays amplified DNA from both subgroups, while the LY GroEL TaqMan probe assay only amplified DNA from subgroup 16SrIV-A. The duplex TaqMan probe assay is a novel option for the simultaneous detection and quantification of LY phytoplasmas of 16Sr subgroups -A and -D, which are the phytoplasmas that predominantly affect palms in Mexico.

Distribution of lethal yellowing and associated phytoplasma strains in Jamaica, Mexico and other countries in the region

The relentless spread of the fatal disease lethal yellowing (LY) throughout the coconut growing areas is having a serious impact on many vulnerable communities. Phytoplasmas from the 16SrIV group are the associated agents. These obligated phytopathogenic mollicutes systemically colonize phloem tissues inducing numerous biochemical and physiological changes leading to symptom development and ultimate death of coconut palms. Large numbers of coconut trees succumbed to the disease over the past three decades. There are different subgroups of the 16SrIV phytoplasmas affecting palms in the Americas. It is important for these to be properly identified along with the epidemiology of the disease. The effective molecular tools used to identify these subgroups show variations in some conserved genomic regions. In the Americas the subgroups have been identified, the current distribution of LY in Jamaica and Mexico and the 16SrIV subgroups occurring in these countries and in other Caribbean countries are described.

Presence of 16SrIV phytoplasmas of subgroups A, D and E in planthopper Haplaxius crudus Van Duzee insects in Yucatán, Mexico.

The present study was carried out to determine if group 16SrIV phytoplasmas, causing lethal yellowing (LY) disease, are present in Haplaxius crudus Van Duzee (Hemiptera: Cixiidae) insects associated with palms in Yucatán, Mexico. Haplaxius crudus feral insects were captured from palm foliage at two locations (Chicxulub Puerto and CICY, Mérida, where LY-type diseases are active) and evaluated individually for the presence of phytoplasma DNA by a group 16SrIV-specific nested PCR assay. The results showed positive detection in H. crudus insects in a proportion of 2.7% (of the total 2726 analyzed) during a 3-year period of study. The percentage of detection was different for each site, 5.9% positive of 799 insects from Mérida and 1.7% of 1927 from Chicxulub Puerto. Positive detections were also obtained in extracts from 5.3 to 1.2% of males and females, respectively. Sequencing and in silico RFLP and phylogenetic analyses of PCR-amplified rDNA products indicated that H. crudus insects from Chicxulub Puerto harbored phytoplasma strains of subgroups 16SrIV-A or 16SrIV-D, whereas in insects from Mérida the strains found were 16SrIV-A, 16SrIV-D or 16SrIV-E. The diversity of subgroup strains detected in H. crudus coincided with strains previously identified in palms showing LY-type disease syndromes in Yucatán thereby implicating H. crudus as a candidate vector of 16SrIV phytoplasmas in this region of Mexico.

Digital PCR Technology for Detection of Palm-Infecting Phytoplasmas Belonging to Group 16SrIV that Occur in Florida.

Phytoplasmas are an economically important group of plant pathogens that negatively impact a wide variety of plants in agricultural and natural ecosystems. In Florida, palm trees are essential elements in the nursery and landscaping industries that suffer from diseases caused by phytoplasmas that are related to each other but are classified in two different subgroups, 16SrIV-A and 16SrIV-D. In this study, a TaqMan assay was developed for digital polymerase chain reaction (dPCR) to detect both palm-infecting phytoplasmas found in Florida. When compared with real-time PCR assays and nested PCR assays, dPCR was capable of detecting the phytoplasmas at much lower concentrations than was possible by using real-time PCR and nested PCR. Additionally, the assay was capable of detecting 16SrIV-B phytoplasma as well as isolates representing the 16SrI and 16SrIII phytoplasma groups. Due to sequence identity of primer annealing regions across diverse phytoplasmas, the assay is likely to be successful for detection of a wide variety of phytoplasmas. The increased sensitivity of this dPCR assay over real-time PCR will allow for earlier detection of phytoplasma infection in palm trees, as well as for screening of salivary glands of candidate insect vector species. These advantages should aid timely management decisions to reduce disease spread and rapid determination of phytoplasma transmission by vectors.

First report of a ‘Candidatus Phytoplasma aurantifolia‘‐related phytoplasma strain associated with yellowing symptoms on pineapple palm in Iran

Pineapple palm, Phoenix canariensis, is one of the most widely grown and appreciated ornamental palms, including in the south of Iran. During the last three years, symptoms resembling nutrient deficiency were observed on pineapple palms in urban landscapes in Ahvaz in southwestern Iran. The symptoms included leaf yellowing in the lower fronds which began from the leaf tips and extended towards the blade and the rachis (Figs. 1, 2, 3). During January 2016, P. canariensis palms were surveyed for phytoplasma. Leaf samples from three diseased and one symptomless palm were collected. The midribs were freeze-dried and then powdered in liquid nitrogen. Total DNA was extracted using a CTAB-based method (Maixner et al., 3). Total DNA was analysed by nested PCR assay using generic primers P1/P7-R16F2n/R16R2 (Deng & Hiruki, 1; Gundersen & Lee, 2). Amplicons of the expected size (c. 1.2 kb) were obtained from all diseased palms, and were purified (GF-1 AmbiClean Kit, Malaysia) and directly sequenced. The partial consensus 16S rDNA sequence was deposited in GenBank (Accession No. KX088466) and compared to those of reference phytoplasmas by BLAST analysis. The consensus 16S rDNA sequence showed 99% sequence identity to members of group 16SrII ‘Candidatus Phytoplasma aurantifolia’. A phylogenetic tree (Fig. 4) based on the 16S rDNA sequences of P. canariensis phytoplasma and those of reference phytoplasmas was constructed using the maximum likelihood algorithm under the TN93+G+I model of the MEGA 6 software (Tamura et al. 4). The P. canariensis phytoplasma (Ahvaz-5 isolate) clustered within the 16SrII phytoplasma group. Restriction mapping of the partial 16SrRNA sequence (1161bp) with typical endonucleases AluI, BamHI, BfaI, BstUI, DraI, EcoRI, HaeIII, HhaI, HinfI, HpaI, HpaII, KpnI, Sau3AI, MseI, RsaI, SspI and TaqI in a virtual digest using Restriction-Mapper V.3 online software (http://www.restrictionmapper.org) showed that the virtual RFLP pattern of the P. canariensis phytoplasma was identical (similarity coefficient 1.00) to the reference pattern of subgroup 16SrII-D (Y10097). Both, the virtual RFLP and phylogenetic analyses confirmed that the P. canariensis phytoplasma is a member of the 16Sr II group, subgroup D. Phoenix canariensis is affected by the Texas phoenix palm decline phytoplasma, a member of the 16SrIV group, in Florida and Texas, USA. To our knowledge, this is the first report of a phytoplasma disease on palm in Iran. The P. canariensis phytoplasma (Ahvaz-5 isolate) is affecting approximately 20% of the pineapple palms in Ahvaz. The identification of this phytoplasma will contribute to improving the future management of the disease.

Phytoplasmas associated with date palm in the continental USA: three 16SrIV subgroups

Only one major group of phytoplasmas, namely group 16SrIV, has been identified in date palms in the continental United States, and only in the states of Florida and Texas where date palms are used for aesthetic purposes in the landscape and not for date production. While strains belonging to three 16SrIV group have been detected in Florida date palms (16SrIV-A, 16SrIV-D and 16SrIV-F), only subgroup 16SrIV-D strains have been detected in Texas date palms. The subgroup 16SrIV-D phytoplasmas identified in Florida and Texas appear to be genetically the same. Field symptoms caused by this group of phytoplasmas in date palms is described, along with the molecular techniques used to detect the phytoplasma in palm tissue and to identify the subgroup detected. Preventive management in the landscape is based on use of resistant palm material and liquid trunk injection of the antibiotic oxytetracycline HCl into susceptible palms.

Occurrence of 16SrIV Subgroup A Phytoplasmas in Roystonea regia and Acrocomia mexicana Palms with Lethal Yellowing‐like Syndromes in Yucatán, Mexico

Abstract The lethal yellowing (LY) disease and LY‐type syndromes affecting several palm species are associated with 16SrIV phytoplasmas in the Americas. In Mexico, palms of the species Roystonea regia and the native Acrocomia mexicana were found to exhibit LY‐type symptoms, including leaf decay, starting with mature leaves, necrosis and atrophy of inflorescences. DNA extracts obtained from these palms could be amplified by nested‐PCR using phytoplasma‐universal primer pair P1/P7 followed by LY‐group‐specific primer pair LY16Sr/LY16Sf. Blast analysis of the sequences obtained revealed an identity of 100% for R. regia and 99.27% for A. mexicana with 16SrIV‐A strain associated with LY in Florida, USA (Acc. AF498309). Computer‐simulated RFLP analysis showed that the patterns for the phytoplasma DNA of the two palm species were highly similar to that for 16SrIV subgroup A strain. A neighbour‐joining tree was constructed, and the sequences of the two palm species clustered in the same clade of group 16SrIV subgroup A. The results therefore support that LY‐type syndromes observed in palms of R. regia and A. mexicana in the Yucatan region of Mexico are associated with 16SrIV subgroup A phytoplasmas.

FIRST REPORT OF A 16Sr IV GROUP PHYTOPLASMA ASSOCIATED WITH LETHAL YELLOWING IN AGAVE TEQUILANA

Mexico, which is considered the origin and the biodiversity center of the family Agavaceae, hosts 117 of the 155 known species. Agave tequilana Weber cv. Azul is a national icon and the most widely cultivated species for the production of tequila, a widely known alcoholic beverage. In spring 2013, a disease of A. tequilana was observed in Tala, (Jalisco, Mexico) which greatly reduced its availability for tequila production. Affected plants showed extensive chlorosis, followed by yellowing and necrosis of stem and leaf tissues. As the disease progressed, leaves collapsed and hung downwards around the central head. To investigate the possibility of a phytoplasma infection, DNA was extracted according to Lee et al. (1993) from 25 symptomatic and 25 symptomless plants. A nested PCR was performed using two universal primer sets specific for the phytoplasma 16S rRNA gene, i.e. R16mF2/R16mR1 followed by R16F2n/R16R2 (Gundersen and Lee, 1996). The expected 1,200 bp product was obtained from 88% of the symptomatic plants. The PCR products were cleaned with a Wizard kit (Promega, USA) and cloned in Escherichia coli using a TOPO-TA cloning kit (Invitrogen, USA) in accordance with manufacturer’s instructions. When nucleotide sequences of the amplified products (accession Nos KJ156364, KJ156365) were compared with those available in GenBank, it was found that the agave phytoplasma was most similar (99.98%) to the Texas phoenix palm phytoplasma (USA, JF791816) and Sabal mexicana decline phytoplasma (Mexico, GU473588). Phylogenetic and putative restriction site analysis of 16Sr DNA indicated that the phytoplasma associated with A. tequilana is closely related to the lethal yellows 16SrIV group. To our knowledge, this is the first report of a 16SrIV group phytoplasma associated with a disease of A. tequilana.

A new wilt disease of banana plants associated with phytoplasmas in Papua New Guinea (PNG)

Nested PCR indicated a possible causal relationship between presence of phytoplasmas and unusual wilt symptoms in cooking banana plants in PNG. Sequence analysis showed that phytoplasmas from diseased banana plants in four Provinces were unique, but most closely related to a phytoplasma associated with a new lethal disease of coconuts in PNG’s Madang Province, related to phytoplasmas in the 16SrIV group.

Occurrence of a 16SrIV Group Phytoplasma not Previously Associated with Palm Species in Yucatan, Mexico.

The occurrence of 16SrIV group phytoplasmas in palm species Sabal mexicana and Pseudophoenix sargentii is reported here for the first time. Palm trees showed leaf decay and leaf yellowing syndromes, respectively. An amplification product (1.4 kb) was obtained in symptomatic S. mexicana (18 of 21) and symptomatic P. sargentii (1 of 1) palm trees sampled in different locations in Yucatan State, Mexico; five of the positive S. mexicana and the positive P. sargentii trees died. The identity of the phytoplasmas from these species was determined by restriction fragment length polymorphism profiling with restriction enzymes AluI and HinfI, showing there could be two phytoplasma strains of the 16SrIV group. In one S. mexicana palm, the profile was the same as observed with these enzymes for phytoplasmas of 16SrIV-A subgroup, previously associated with Cocos nucifera palm trees and, in the rest of the trees, including the P. sargentii palm, the profile was for phytoplasmas of the 16SrIV-D subgroup. These identities were supported by analyses of the amplicons obtained by nested polymerase chain reaction by nucleotide-nucleotide BLAST analysis. Geographical distribution of the association S. mexicana/16SrIV group phytoplasmas was found widely dispersed in Yucatan State. A potential role of S. mexicana palm trees as a permanent source of phytoplasma inoculum is suggested. In addition to P. sargentii, other palm species (Thrinax radiata and C. nucifera) coexisting with S. mexicana trees were also sampled and analyzed.

First report of a 16SrXIV, ‘Candidatus Phytoplasma cynodontis’ group phytoplasma associated with coconut yellow decline in Malaysia

The coconut palm (Cocos nucifera) is an important perennial oil crop cultivated throughout Malaysia and is used for its aesthetic appeal in landscapes. Symptoms of yellow decline have been observed in a plantation in Selangor, similar to those caused by phytoplasma groups of the lethal yellowing (16SrIV) type recorded from the Americas, Caribbean and Africa, and similar also to Stolbur (16SrXII) associated with Kalimantan wilt in Indonesia. Although not widespread, this is the first report on such symptoms in coconut in Malaysia. The lower canopy foliage initially turns light yellow and eventually light-brown, spreading rapidly to the younger leaves. Also severe chlorosis of the emerging spear leaf, inflorescence necrosis, premature nut fall, and gradual collapse of fronds occur, and immature palms generally die within 5 months of initial symptom appearance. Samples were collected from 20 affected and five symptomless Malayan red dwarf coconut palms. Malayan yellow dwarf and some Malayan tall coconuts exhibited similar symptoms, but were not tested in this study. Total DNA was extracted and assayed in a nested PCR with universal phytoplasma primer pairs P1/P7 followed by either R16F2/R16R2 or fU5/ rU3. Products of the expected size (approximately 1200 bp and 880 bp, respectively) were amplified from 8/20 plants with symptoms but not from any symptomless coconut palms. Amplification also failed when the LY (16SrIV) specific primers LY16Sf/LY16Sr were used for nested PCR on P1/P7 first round PCR samples (Harrison et al., 2002), as well as when LY non-ribosomal specific primers LYC24F/LYC24R (Harrison et al ., 1994) were used, indicating that the phytoplasma was not from the 16SrIV group. The phytoplasma 16SrDNA was cloned and sequenced (GenBank Acc. No. EU328159) and showed the highest homology (99%) with those of Bermuda grass white leaf phytoplasma from Thailand (AF248961) and Malaysia (EU294011), members of the 16SrXIV ‘ Candidatus Phytoplasma cynodontis’ group. This group has previously been found associated with a decline disease in date palm in Sudan (Cronje et al ., 2000). However, this is the first report of a 16SrXIV phytoplasma associated with yellow decline in Malaysia.