Abstract
Systemic and local posttraumatic responses are often monitored on mRNA expression level using quantitative real-time PCR (qRT-PCR), which requires normalisation to adjust for confounding sources of variability. Normalisation requests reference (housekeeping) genes stable throughout time and divergent experimental conditions in the tissue of interest, which are crucial for a reliable and reproducible gene expression analysis. Although previous animal studies analysed reference genes following isolated trauma, this multiple-trauma gene expression analysis provides a notable study analysing reference genes in primarily affected (i.e. bone/fracture callus and hypothalamus) and secondarily affected organs (i.e. white adipose tissue, liver, muscle and spleen), following experimental long bone fracture and traumatic brain injury. We considered tissue-specific and commonly used top-ranked reference candidates from different functional groups that were evaluated applying the established expression stability analysis tools NormFinder, GeNorm, BestKeeper and RefFinder. In conclusion, reference gene expression in primary organs is highly time point as well as tissue-specific, and therefore requires careful evaluation for qRT-PCR analysis. Furthermore, the general application of Ppia, particularly in combination with a second reference gene, is strongly recommended for the analysis of systemic effects in the case of indirect trauma affecting secondary organs through local and systemic pathophysiological responses.
Highlights
Systemic and local posttraumatic responses are often monitored on mRNA expression level using quantitative real-time PCR, which requires normalisation to adjust for confounding sources of variability
While the NormFinder algorithm calculates the stability value according to the inter- and intra-group variation, GeNorm defines the reference gene stability value (M) through pairwise variation, both aiming for the lowest value representing the highest expression stability
BestKeeper generates the coefficient of correlation (r) and a standard deviation (SD) of the crossing point (Cp) which is analogue to the Ct
Summary
Systemic and local posttraumatic responses are often monitored on mRNA expression level using quantitative real-time PCR (qRT-PCR), which requires normalisation to adjust for confounding sources of variability. Reference gene expression in primary organs is highly time point as well as tissue-specific, and requires careful evaluation for qRT-PCR analysis. Systemic and local posttraumatic gene response is commonly monitored on mRNA expression level[12,13,14,15], using the cost-efficient, easy to adapt and widely established method of quantitative real-time reverse transcriptionpolymerase chain reaction (qRT-PCR). The time-consuming identification of suitable housekeeping genes for the qRT-PCR data normalisation remains essential for each newly designed study, in order to allow an accurate analysis. Structural protein of the cytoskeleton, involved in cell structure, integ- F: TTGCTGACAGGATGCAGAAG rity, motility and intercellular signalling
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
