Abstract

BackgroundCentromere protein H (CENP-H) is one of the fundamental components of the human active kinetochore. Recently, CENP-H was identified to be associated with tumorigenesis. This study was aimed to investigate the clinicopathologic significance of CENP-H in tongue cancer.MethodsRT-PCR, real time RT-PCR and Western blot were used to examine the expression of CENP-H in tongue cancer cell lines and biopsies. CENP-H protein level in paraffin-embedded tongue cancer tissues were tested by immunohistochemical staining and undergone statistical analysis. CENP-H-knockdown stable cell line was established by infecting cells with a retroviral vector pSuper-retro-CENP-H-siRNA. The biological function of CENP-H was tested by MTT assay, colony formation assay, and Bromodeoxyuridine (BrdU) incorporation assay.ResultsCENP-H expression was higher in tongue cancer cell lines and cancer tissues (T) than that in normal cell and adjacent noncancerous tongue tissues (N), respectively. It was overexpressed in 55.95% (94/168) of the paraffin-embedded tongue cancer tissues, and there was a strong correlation between CENP-H expression and clinical stage, as well as T classification. CENP-H can predict the prognosis of tongue cancer patients especially those in early stage. Depletion of CENP-H can inhibit the proliferation of tongue cancer cells (Tca8113) and downregulate the expression of Survivin.ConclusionThese findings suggested that CENP-H involves in the development and progression of tongue cancer. CENP-H might be a valuable prognostic indicator for tongue cancer patients within early stage.

Highlights

  • Centromere protein H (CENP-H) is one of the fundamental components of the human active kinetochore

  • CENP-H expression is elevated in human tongue cancer cells and primary tongue cancers Western blot analyses on normal tongue mucosa epithelial cells (TEC) and two tongue cancer cell lines (TSCCa and Tca8113) revealed that CENP-H protein was highly expressed in cancer cells, while it was only weakly detected in TEC cells (Figure 1A)

  • The quantitative PCR showed that the CFiEgNuPre-H3protein expression in paraffin-embedded tongue cancer tissue samples and its prognostic value CENP-H protein expression in paraffin-embedded tongue cancer tissue samples and its prognostic value. (A) Representative images of CENP-H protein expression examined by immunohistochemistry (IHC)

Read more

Summary

Introduction

Centromere protein H (CENP-H) is one of the fundamental components of the human active kinetochore. CENP-H was identified to be associated with tumorigenesis. This study was aimed to investigate the clinicopathologic significance of CENP-H in tongue cancer. The kinetochore is a large protein complex assembled on centromere DNA and kinetochore dysfunction is an important source for chromosome instability [1,2]. More than 60 kinetochore proteins have been identified in yeast in recent years [3,4,5]. Multiple kinetochore proteins have (page number not for citation purposes). Journal of Experimental & Clinical Cancer Research 2009, 28:74 http://www.jeccr.com/content/28/1/74. RT-PCR Real-time PCR CENP-H GAPDH CENP-H GAPDH. TGCAAGAAAAGCAAATCGAA CCACCCATGGCAAATTCCATG GCA CCTTATTTTGGGGAGTAAAGT CAAT GACTCATGACCACAGTCCATG C. ATCCCAAGATTCCTGCTGTG TCTAGACGGCAGGTCAGGTCC AC ACAAATGCACAGAAGTATTCC AAAT AGAGGCAGGGATGATGTTCTG FAM-TTCCTTAAGGGCAGGATCCTTAMRA

Objectives
Methods
Results
Discussion
Conclusion
Full Text
Paper version not known

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call

Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.