Abstract
Elongation factors (EFs) Tu and G are GTPases that have important functions in protein synthesis. The low intrinsic GTPase activity of both factors is strongly stimulated on the ribosome by unknown mechanisms. Here we report that isolated ribosomal protein L7/12 strongly stimulates GTP hydrolysis by EF-G, but not by EF-Tu, indicating a major contribution of L7/12 to GTPase activation of EF-G on the ribosome. The effect is due to the acceleration of the catalytic step because the rate of GDP-GTP exchange on EF-G, as measured by rapid kinetics, is much faster than the steady-state GTPase rate. The unique, highly conserved arginine residue in the C-terminal domain of L7/12 is not essential for the activation, excluding an "arginine finger"-type mechanism. L7/12 appears to function by stabilizing the GTPase transition state of EF-G.
Highlights
GTP-binding proteins are involved in a number of important cellular processes, including signal transduction, protein synthesis, and protein export
Our data show that the GTPase activity of Elongation factors (EFs)-G is strongly stimulated by the ribosomal protein L7/12
No stimulation by L7/12 of the GTPase activity of EF-Tu was found, in agreement with an earlier report [41]; our results do not confirm the enhancement by L7/12 of GTP hydrolysis by EF-Tu reported by Donner et al [40]
Summary
EF-G, and EF-Tu were prepared as described previously [22, 34, 35]. Ternary complexes EF-Tu1⁄7GTP1⁄7Phe-tRNAPhe were purified by gel filtration on Superdex 75 [36]. mant-GDP and mant-GTP (2Ј-(or 3Ј)-O-(N-methylanthraniloyl)guanosine 5Ј-diphosphate (or -triphosphate)) were purchased from Molecular Probes. Fluorescence stopped-flow measurements were performed on a SX18MV spectrometer (Applied Photophysics), and the data were evaluated as described previously [37]. Because only single-exponential time courses were observed, the data were treated further in terms of a one-step binding model: EF-G ϩ mant-GXPNEF-G1⁄7mantGXP. For this model, the bimolecular association rate constant and the dissociation rate constant can be determined from the linear concentration dependence of kapp. The following primer pairs were used to generate polymerase chain reaction products for the R74K mutant: (a) GAGCTGCATGTGTCAGAGGTTTTCAC and GACCCAGGCCAGTGGCGCCCTTTACTGCTTTGA, and (b) TCAAAGCAGTAAAGGGCGCCACTGGCCTGGGTC and AATTCTCATGTTTGACAGCTTATCATCGA. Glutathione-Sepharose 4B was used again to separate glutathione S-transferase from L7/12 protein
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
