Abstract
Melanoma cells exhibit increased aerobic glycolysis, which represents a major biochemical alteration associated with malignant transformation; thus, glycolytic enzymes could be exploited to selectively target cancer cells in cancer therapy. Sperm-specific glyceraldehyde-3-phosphate dehydrogenase (GAPDHS) switches glyceraldehyde-3-phosphate to 1,3-bisphosphoglycerate by coupling with the reduction of NAD+ to NADH. Here, we demonstrated that GAPDHS displays significantly higher expression in uveal melanoma (UM) than in normal controls. Functionally, the knockdown of GAPDHS in UM cell lines hindered glycolysis by decreasing glucose uptake, lactate production, adenosine triphosphate (ATP) generation, cell growth and proliferation; conversely, overexpression of GAPDHS promoted glycolysis, cell growth and proliferation. Furthermore, we identified that SOX10 knockdown reduced the activation of GAPDHS, leading to an attenuated malignant phenotype, and that SOX10 overexpression promoted the activation of GAPDHS, leading to an enhanced malignant phenotype. Mechanistically, SOX10 exerted its function by binding to the promoter of GAPDHS to regulate its expression. Importantly, SOX10 abrogation suppressed in vivo tumor growth and proliferation. Collectively, the results reveal that GAPDHS, which is regulated by SOX10, controls glycolysis and contributes to UM tumorigenesis, highlighting its potential as a therapeutic target.
Highlights
We observed that glyceraldehyde-3-phosphate dehydrogenase (GAPDHS) mRNA was highly expressed in uveal melanoma (UM) cells compared with the normal cell lines ARPE-19 and PIG1 (Figure 1B), which is consistent with a previous report that GAPDHS expression is significantly higher in human melanoma cell lines than in normal controls (Sevostyanova et al, 2012)
We identified GAPDHS as a 37-kDa protein by western blot analysis, which is consistent with the results of a previous study (Sevostyanova et al, 2012) in which GAPDHS was reported to be a 37-kDa protein without an N-terminal domain that attaches the enzyme to the cytoskeleton of the sperm flagellum
This protein has unusual properties different from its somatic isoenzymes and could significantly influence metabolism and proliferation (Sevostyanova et al, 2012), and the presence of GAPDHS confers a number of unusual properties compared with those of GAPDH in melanoma
Summary
Metabolic reprogramming is a hallmark of malignant transformation across all cancer types (Ratnikov et al, 2017), and hyperproliferation displayed by cancer cells is partly due to the involvement of aerobic glycolysis [the Warburg effect (Warburg, 1956)], which provides energy and foundation for the biosynthesis of macromolecules (Deberardinis et al, 2008; Lunt and Vander Heiden, 2011; Ratnikov et al, 2017) even Genes Forward primer Reverse primerHK2 GPI PFKL ALDOA TPI GAPDHS PGK1 PGAM1 ENO1 PKM2 GAPDH 18STTGACCAGGAGATTGACATGGG GGAGACCATCACGAATGCAGA GCTGGGCGGCACTATCATT CAGGGACAAATGGCGAGACTA ACTGCCTATATCGACTTCGCC TGTGGGCATCAATGGATTTGG GAACAAGGTTAAAGCCGAGCC GTGCAGAAGAGAGCGATCCG AAAGCTGGTGCCGTTGAGAA AAGGGTGTGAACCTTCCTGG AGGTCGGTGTGAACGGATTTG CGGCGACGACCCATTCGAAC CAACCGCATCAGGACCTCA TAGACAGGGCAACAAAGTGCT TCAGGTGCGAGTAGGTCCG GGGGTGTGTTCCCCAATCTT AAGCCCCATTAGTCACTTTGTAG ACACCATGTATTCCGGGTCAAT GTGGCAGATTGACTCCTACCA CGGTTAGACCCCCATAGTGC GGTTGTGGTAAACCTCTGCTC GCTCGACCCCAAACTTCAGA TGTAGACCATGTAGTTGAGGTCA GAATCGAACCCTGATTCCCCGTC18s was used as a reference primer. Multiple lines of evidence have established that upregulation of a series of metabolic enzymes, such as HK2, GAPDH, LDH, PGAM1, PKM2, and PDK, is linked to malignant growth (HugoWissemann et al, 1991; Mikuriya et al, 2007; Yeh et al, 2008), and interfering with the process of glycolysis has been proposed as an effective way to control tumor growth In addition to these enzymes, it is worth noting that other sperm-specific isoforms of glycolytic enzymes (Welch et al, 2000) are involved in glycolysis in various cancers, and not all the catalytic and regulatory parameters are the same as the somatic isoenzymes. There is limited documentation of the functions of GAPDHS in tumors, and whether GAPDHS modulates glycolysis and tumorigenesis in uveal melanoma (UM) remains to be investigated
Sign-in/Register to view highlights & summary Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
