Abstract
Here we characterize the properties and expression pattern of Siglec-9 (sialic acid-binding Ig-like lectin-9), a new member of the Siglec subgroup of the immunoglobulin superfamily. A full-length cDNA encoding Siglec-9 was isolated from a dibutyryl cAMP-treated HL-60 cell cDNA library. Siglec-9 is predicted to contain three extracellular immunoglobulin-like domains that comprise an N-terminal V-set domain and two C2-set domains, a transmembrane region and a cytoplasmic tail containing two putative tyrosine-based signaling motifs. Overall, Siglec-9 is approximately 80% identical in amino acid sequence to Siglec-7, suggesting that the genes encoding these two proteins arose relatively recently by gene duplication. Binding assays showed that, similar to Siglec-7, Siglec-9 recognized sialic acid in either the alpha2,3- or alpha2, 6-glycosidic linkage to galactose. Using a specific mAb, Siglec-9 was found to be expressed at high or intermediate levels by monocytes, neutrophils, and a minor population of CD16(+), CD56(-) cells. Weaker expression was observed on approximately 50% of B cells and NK cells and minor subsets of CD8(+) T cells and CD4(+) T cells. These results show that despite their high degree of sequence similarity, Siglec-7 and Siglec-9 have distinct expression profiles.
Highlights
Sialic acid-binding immunoglobulin-like lectins (Siglecs)1 are transmembrane sialic acid-binding proteins of the immunoglobulin (Ig) superfamily characterized by the presence of an N-terminal V-set Ig-like domain and variable numbers of C2 set domains [1]
The presence of one or more immune receptor tyrosine-based inhibitory motifs (ITIMs) has been described in a growing number of other leukocyte membrane receptors, many of which are tightly linked to CD33-related Siglecs on chromosome 19q13.4, in a region known as the leukocyte receptor cluster [12]
Taylor and co-workers [13] showed that the tyrosine residues of both motifs in CD33 can be phosphorylated by Src-like kinases following antibody-induced cross-linking and that this leads to recruitment of SHP-1 and SHP-2
Summary
Sialic acid-binding immunoglobulin-like lectins (Siglecs)1 are transmembrane sialic acid-binding proteins of the immunoglobulin (Ig) superfamily characterized by the presence of an N-terminal V-set Ig-like domain and variable numbers of C2 set domains [1]. When expressed at the cell surface, Siglec-9 exhibits sialic acid-dependent binding to human red blood cells and synthetic sialoglycoconjugates. For Siglec-9-Fc, a HindIII-BamHI fragment encoding the leader peptide of human CD33 [17] was cloned into the corresponding sites of pEE14-3C-Fc. The resulting vector was designated pEE14-33L-3C-Fc. cDNA encoding the extracellular region (not including the leader peptide) of Siglec-9 was amplified by PCR using the following forward and reverse primers (5Ј to 3Ј): CTCGGATTCCAAGTAAACTGCTGCACGATGC and CCCGGATCCACTTACCTGTTGATGTGGCTTTGCTCTGCAA.
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
