Abstract
Sequence-specific High Mobility Group Box Factors Recognize 10–12-Base Pair Minor Groove Motifs
Highlights
Sequence-specific high mobility group (HMG) box factors bind and bend DNA via interactions in the minor groove
Footprinting with a deletion mutant of Ste11 reveals a novel interaction between the 3 base pairs of the extended DNA motif and amino acids C-terminal to the HMG domain
The TR box was considerably longer than the 6 – 8-bp motifs reported for other HMG box proteins [2]
Summary
Recombinant HMG Box Proteins—Production of glutathione S-transferase fusion protein Ste113 (Ste amino acids 1–113) [26], MalEMatMc-HMG fusion protein [7], and the His-tagged HMG boxes of Sox4 [14] and Tcf1 [29] have been described elsewhere. PCR-mediated Site Selection—A random probe was generated by labeling primer A (5Ј GTTACCGCGGATCCGAATTCCC 3Ј) with [32P]ATP using T4 polynucleotide kinase and subsequent annealing of this primer A to primer BSS (5Ј CTCGGTACCTCGAGTGAAGCTTGANNNNNNNNNNNNNNNNNNGGGAATTCGGATCCGCGGTAAC 3Ј, where N is A/C/G/T). MatMc, Sox, and Tcf HMG domain proteins were subjected to a gel retardation assay, as described previously [11]. The probe was purified on a 5% polyacrylamide gel and subsequently electroeluted. New gel retardation reactions were repeated using recombinant protein and “enriched” random probe. Oligonucleotides were purified on a 10% non-denaturing polyacrylamide gel and electroeluted. The recombinant Ste, MatMc, Sox, and Tcf proteins (50 ng) together with 1 g of poly[d(I-C)] were incubated and electrophoresed as described above. 100,000 cpm of methylated probe was used in a 5-fold scale up of the gel retardation binding reaction. The cold oligonucleotides consisted either of the optimal Ste oligonucleotide described above or a non-optimal oligonucleotide
Sign-in/Register to view highlights & summary Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
