Abstract

Here we are testing the specific primers NEM06FWD2/NEM06REV2 and nem06FWD1/ nem06REV1 for the R6m-1 resistance gene to root-knot nematodes Meloidogyne spp. in breeding samples of sugar beet. Sugar beet plants of domestic and foreign breeding lines were the object of the study. To identify the relationship between R6m-1 gene, which is localized on the chromosome 1 and controls the stable level of the kinase activity signal, with sugar beet resistance to phytopathogens, PCR-analysis of 10 sugar beet samples were carried out using 2 pairs of molecular genetic markers. DNA amplification revealed a fragments ~500 bp and ~100 bp in length and as a result of sequencing of nucleotide sequences of R6m-1 gene region with subsequent alignment by Geneious Prime program, 3 single nucleotide substitutions (A/G, G/C, and G/A) in the resistant MS11018 genotype and one nucleotide substitution (A/G) and 3 deletions in a foreign hybrid Humber were identified. It can be assumed that these SNPs can form resistance by amino acid substitutions in the polypeptide chain. Finally, possibility to differentiate homozygous and heterozygous genotypes for this allele was shown.

Highlights

  • Введение Сахарная свекла (Beta vulgaris L.) является наиболее важным источником сахарозы (ФАО — 2012)

  • foreign breeding lines were the object of the study

  • which is localized on the chromosome 1

Read more

Summary

Нуклеотидные замены в гене устойчивости к галловым нематодам сахарной свеклы

Цель работы – апробация специфических праймеров NEM06FWD2/NEM06REV2 и nem06FWD1/nem06REV1 для изучения гена устойчивости R6m-1 к галловым нематодам (Meloidogyne spp.) в селекционных образцах сахарной свеклы. Материалом для исследования служили растения сахарной свеклы отечественной и зарубежной селекции. Для выявления связи гена R6m-1, локализованного на хромосоме 1 и контролирующего стабильный уровень работы сигнальных киназ, с устойчивостью сахарной свеклы к фитопатогенам, проведен ПЦР-анализ 10 образцов сахарной свеклы с использованием 2 пар молекулярно-генетических маркеров. Что указанные SNPs могут формировать устойчивость путем замен аминокислоты в полипептидной цепи. Что применяемые маркеры позволяют также дифференцировать гомозиготные и гетерозиготные генотипы по данному аллелю. For citation: Hussein A.S., Nalbandyan A.A., Fedulova T.P., Kryukova T.I., Fomina A.S., Moiseenko A.V. Nucleotide substitutions in the resistance gene to root-knot nematodes in sugar beet.

VEGETABLE PRODUCTION
TGACGGGTTGTCAATATGC TCCATTTCCTGACCTACAATTATT

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call

Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.