Abstract
The complete nucleotide sequence of the cytosol 5S ribosomal ribonucleic acid of the trypanosomatid protozoan Crithidia fasciculata has been determined by a combination of T1-oligonucleotide catalog and gel sequencing techniques. The sequence is: GAGUACGACCAUACUUGAGUGAAAACACCAUAUCCCGUCCGAUUUGUGAAGUUAAGCACC CACAGGCUUAGUUAGUACUGAGGUCAGUGAUGACUCGGGAACCCUGAGUGCCGUACUCCCOH. This 5S ribosomal RNA is unique in having GAUU in place of the GAAC or GAUC found in all other prokaryotic and eukaryotic 5S RNAs, and thought to be involved in interactions with tRNAs. Comparisons to other eukaryotic cytosol 5S ribosomal RNA sequences indicate that the four major eukaryotic kingdoms (animals, plants, fungi, and protists) are about equally remote from each other, and that the latter kingdom may be the most internally diverse.
Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
