Abstract
The Gal4p family of yeast zinc cluster proteins comprises over 50 members that are putative transcriptional regulators. For example, Pdr1p and Pdr3p activate multidrug resistance genes by binding to pleiotropic drug response elements (PDREs) found in promoters of target genes such as PDR5, encoding a drug efflux pump involved in resistance to cycloheximide. However, the role of many zinc cluster proteins is unknown. We tested a panel of strains carrying deletions of zinc cluster genes in the presence of various drugs. One deletion strain (Deltardr1) was resistant to cycloheximide, whereas eight strains showed sensitivity to the antifungal ketoconazole or cycloheximide. Unnamed zinc cluster genes identified in our screen were called RDS for regulators of drug sensitivity. RNA levels of multidrug resistance genes such as PDR16, SNQ2, and PDR5 were decreased in many deletion strains. For example, cycloheximide sensitivity of a Deltastb5 strain was correlated with decreased RNA levels and promoter activity of the PDR5 gene. We tested if activation of PDR5 is mediated via a PDRE by inserting this DNA element in front of a minimal promoter linked to the lacZ gene. Strikingly, activity of the reporter was decreased in a Deltastb5 strain. The purified DNA binding domain of Stb5p bound to a PDRE in vitro. Mutations in the PDRE known to affect binding of Pdr1p/Pdr3p showed similar effects when assayed with Stb5p. These results strongly suggest that Stb5p is a transcriptional activator of multidrug resistance genes. Thus, we have identified new regulators of drug sensitivity in the family of zinc cluster proteins.
Highlights
Multidrug or pleiotropic drug resistance (PDR)1 is a phenomenon found in various organisms, ranging from prokaryotes to eukaryotes, such as yeast and humans
Pdr1p and Pdr3p activate multidrug resistance genes by binding to pleiotropic drug response elements (PDREs) found in promoters of target genes such as PDR5, encoding a drug efflux pump involved in resistance to cycloheximide
Many members are putative proteins of unknown function. We determined whether these zinc cluster genes play a role in multidrug resistance by testing the ability of strains carrying deletions of these genes to grow in the presence of six different drugs: cycloheximide, ketoconazole, chloramphenicol, 4-nitroquinoline N-oxide (4-NQO), rhodamine 6-G, and oligomycin
Summary
Strains—The wild-type strain used was BY4742 (MAT␣ his3⌬1 leu2⌬0 lys2⌬0 ura3⌬0; Ref. 31). Deletions for a number of strains were verified by Southern blot analysis (see list below). Reporters PDRE3-lacZ, PDRE3A-lacZ, and PDRE3B-lacZ are high copy (2-m) URA3-marked plasmids containing a single Pdr1/Pdr3p binding site inserted upstream of minimal CYC1 promoter driving lacZ transcription [36]. Southern blot analysis was performed as described [37], and the probe was obtained by purifying a KANR fragment by digesting pFA6 [34] with ClaI. Electrophoretic Mobility Shift Assay (EMSA)—A DNA fragment encoding the DNA-binding domain of Stb5p (amino acids 1–163) was amplified by PCR using the oligonucleotides CGGGATCCATGGATGGTCCCAATTTTGC and GGAATTCCTTGGTACGTCTTGGGGCTC and genomic DNA (isolated from strain YPH499; Ref. 38) as a template. Oligonucleotides for PDRE3B were TCGAAAAAGAGAAATGTCTCCGCAGAACTCTTCTACGCCG and its complement TCGACGGCGTAGAAGAGTTCTGCGGAGACATTTCTCTTTT (mutations are in bold characters and underlined)
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
