Neolithic site of Nanzuo in Qingyang, Gansu

Tolerance of foxtail, proso and pearl millets to saflufenacil

Millets have substantial benefits as a drought-resistant crop, yield good productivity in the areas with water scarcity, possesses remarkable edibles and nutritive values. Nutritional quality of food is the most important parameter for maintaining human health and complete physical wellbeing. Since nutritional wellbeing is the driving force for development and maximization of human genetic potential. Therefore the study was undertaken to investigate the nutrient composition of selected minor millet. The mean moisture content of millet ranged from 8.0 to 10.1 percent. Among the minor millet proso (12.3g/100g) and foxtail millet (12.0g/100g) showed the highest protein content than other millets and lowest was in barnyard millet (6.3g/100g). Fat and ash content in millets ranged from 0.9 to 4.4g/100g and 1.3 to 2.0g/100g respectively. The highest crude fiber content was recorded in barnyard millet (9.9g/100g), followed by kodo millet (9.2g/100g) and lowest in proso millet (2.3g/100g). Carbohydrate content in finger millet was significantly higher (76.3g/100g), followed by proso millet (74.0g/100g) and least was recorded in foxtail millet (67.0g/100g). The energy value of selected millets ranged from 330 to 362 Kcal. Results showed that ‘F’ value indicated a significant difference to exist among the selected millets for all the nutrients studied (p≤0.05).
 Millets have substantial benefits as a drought-resistant crop, yield good productivity in the areas with water scarcity, possesses remarkable edibles and nutritive values. Nutritional quality of food is the most important parameter for maintaining human health and complete physical wellbeing. Since nutritional wellbeing is the driving force for development and maximization of human genetic potential. Therefore the study was undertaken to investigate the nutrient composition of selected minor millet. The mean moisture content of millet ranged from 8.0 to 10.1 percent. Among the minor millet proso (12.3g/100g) and foxtail millet (12.0g/100g) showed the highest protein content than other millets and lowest was in barnyard millet (6.3g/100g). Fat and ash content in millets ranged from 0.9 to 4.4g/100g and 1.3 to 2.0g/100g respectively. The highest crude fiber content was recorded in barnyard millet (9.9g/100g), followed by kodo millet (9.2g/100g) and lowest in proso millet (2.3g/100g). Carbohydrate content in finger millet was significantly higher (76.3g/100g), followed by proso millet (74.0g/100g) and least was recorded in foxtail millet (67.0g/100g). The energy value of selected millets ranged from 330 to 362 Kcal. Results showed that ‘F’ value indicated a significant difference to exist among the selected millets for all the nutrients studied (p≤0.05).

Deciphering responses of bacterial communities to environmental change, and understanding how communities assemble in response to environmental change, are important subjects. The assembly processes governing the rhizosphere bacterial communities of minor grain crops are rarely explored based on regional scales, especially in terms of the environmental adaptation. Here, we investigated the environmental thresholds and phylogenetic signals for ecological preferences of rhizosphere bacterial communities of three minor grain crop taxa across complex environmental gradients to reflect their environmental adaptation. Additionally, we reported environmental factors affecting their community assembly processes based on a large‐scale soil survey in agricultural fields across northern China using high‐throughput sequencing. The results demonstrated a narrower range of environmental thresholds and weaker phylogenetic signals for the ecological traits of rhizosphere bacteria in proso millet than in foxtail millet and sorghum fields. The proso millet rhizosphere community was the most phylogenetically clustered. Null model analysis indicated that homogeneous selection belonging to deterministic processes governed the sorghum rhizosphere community, whereas dispersal limitation belonging to stochastic processes was the critical assembly process in the foxtail millet and proso millet. Mean annual temperature was the decisive factor for adjusting the balance between stochasticity and determinism of the foxtail millet, proso millet and sorghum rhizosphere communities. A higher temperature resulted in stochasticity in the proso millet and sorghum communities. For the foxtail millet community, the deterministic assembly increased with an increase in temperature. These results contribute to the understanding of rhizosphere‐associated bacterial community assembly processes in agro‐ecosystems on a large scale.Highlights Proso millet rhizosphere bacterial taxa exhibited weaker environmental adaptation than foxtail millet and sorghum taxa. Determinism governed the sorghum rhizosphere community, whereas stochasticity was the critical assembly process in the foxtail and proso millet. Mean annual temperature mediated balance between stochastic and deterministic processes.

BACKGROUND: Millets are a group of variable small seeded grass, widely grown around the world as cereals crop. The finger millet had more moisture and calcium content. Whereas, fat content was least when compared to three other different millets. Foxtail millets had more protein content, pearl millets had more zinc and proso millets had more carbohydrate and fat content. AIM: To determine the proximate constituent and micronutrient content of finger millet, foxtail millet, pearl millet and proso millet. OBJECTIVES: To analyse the moisture, carbohydrate, fat, and protein content of finger millet, foxtail millet, pearl millet, proso millet by standard methods of AOAC. To analyse the calcium and zinc content of finger millet, foxtail millet, pearl millet, proso millet by atomic absorption spectrophotometer.MATERIALS AND METHODS: Proximate analysis of samples (moisture content, carbohydrate, protein, fat, calcium and zinc) was performed by standard methods of Association of Official Analytical Chemist (AOAC).RESULTS AND CONCLUSION: The mean values of finger millet for moisture content (12.86 ± 0.95) had highest and fat content (1.58 ± 0.36) was least. In foxtail millet protein content (12.94 ± 0.87) was highest and in pearl millet zinc content (3.29 ± 0.47) was highest. In proso millet fat content (12.80 ± 0.30) and carbohydrate content 75.06 ± 7.3) was highest when compared to the other millet. Calcium (344.45 ± 2.62) had highest in finger millet whereas pearl millet zinc content (3.29 ± 0.47) was highest when compared to the other millets. Hence, the study results can be useful for informing the people to select the different millets depending upon the nutritional needs.

A factorial arrangement of three millets species (Panicum miliaceum, Pennisetum glaucum, and Setaria italica) and two sowing dates with three replications were used in a completely randomized design to evaluate the radiation use efficiency and its relationship with dry matter accumulation. Leaf area index was used in daily intervals to calculate daily intercepted radiation. Light extinction coefficient was calculated as the slope of regression line between log transformed fraction of intercepted radiation and leaf area index during growing season. Radiation use efficiency was calculated as the slope of linear regression between cumulative intercepted radiation and cumulative biomass during growing season. Results showed that light extinction coefficient and radiation use efficiency for proso, pearl and foxtail millets were 0.75, 0.66, 0.57 and 1.43, 1.83, 1.74 g/MJ in terms of total radiation, respectively. Differences in biomass production were not significant between proso and pearl millets. Proso millet had higher intercepted radiation, but lower radiation use efficiency in comparison with pearl millet. Foxtail millet had lower intercepted radiation than proso and pearl millets, but its radiation use efficiency was higher than pearl millet. Total biomass of foxtail millet was lower than other species. Results indicated that proso and pearl millets can produce more biomass than foxtail millet.

Proso and foxtail millets are regionally important dryland crops for the semiarid portions of the Central Great Plains. However, few herbicides are registered for use in either crop. The efficacy of carfentrazone was studied in proso millet from 2003 through 2005 at the University of Nebraska High Plains Agricultural Laboratory located near Sidney, NE, and in foxtail millet in 2004 and 2005 at the University of Wyoming Sustainable Agriculture Research and Extension Center near Lingle, WY. Carfentrazone was applied POST at 9.0, 13.5, and 18.0 gai/ha with combinations of 2,4-D amine, prosulfuron, and dicamba. Although leaves of treated plants exhibited localized necrosis, leaves emerging after treatment were healthy. Grain and forage yields were not affected by the application of carfentrazone. Dicamba and 2,4-D amine provided visual control of 30% or less for buffalobur. Adding carfentrazone to one or both of these herbicides improved buffalobur control to 85% or greater. Carfentrazone applied at 18.0 g/ha improved Russian thistle, kochia, and volunteer sunflower control in 2003, when plants were drought-stressed, but did not help with these and other weeds during wetter years. Carfentrazone provides proso millet producers with a way to selectively control buffalobur, a noxious weed in several western states. In foxtail millet, carfentrazone provides POST broadleaf weed control with little risk for serious crop injury. Crop injury has been a concern with 2,4-D, which is currently the only other herbicide registered for use in foxtail millet.

Influence of malted buckwheat, foxtail and proso millet flour incorporation on the physicochemical, protein digestibility and antioxidant properties of gluten-free rice cookies

This study was done to understand the corresponded relations between plant characters and cultivation methods by using the five native millets (Setaria italica Beauv., Panicum miliaceum L., Echinochloa utilis Ohwi et Yabuno, Sorghum bicolor Moench, Eleusine coracana Gaertn.) collected in Gifu prefecture in 1974 to 1975. As the first step for this purpose, the relations between plant characters and the environmental conditions in the places where authors had investigated to find the above materials was discussed in this paper. In addition to the discriptions of the geographical distribution and natural environmental conditions of collected samples, here are results of the seed germination test which was conducted under the various temperatures (15°C, 25°C, 35°C and 45°C). 1) Distribution and natural environments: Most of Echinochloa utilis were cultivated in Hida area which situated at the high elevation (500-1, 300 m) and Sorghum bicolor were distributed at the low or middle elevation (100-600 m) Mino area. Other two crops, i.e. Setaria italica and Panicum miliaceum had been grown over all areas of Gifu prefecture. Temperature, rainfall and water holding capacity of the soil in the sampling plots were investigated to grasp the environmental conditions of the crops and obtained main values were as follows: As to mean minimum temperature at the sowing time and accumulated temperature during cultivation period, the values of the sowed areas of Echinochloa utilis were the lowest (7-10°C, 2, 720-3, 920°C) and those of Sorghum bicolor were the highest (10-14°C, 3, 540-4, 150°C) of all the samples. Total rainfall during the same period was 1, 060-1, 750 mm in Echinochloa utilis, 1, 150-1, 750 mm in Panicum miliaceum, 1, 210-1, 750 mm in Setaria italica and Sorghum bicolor. Moisture ratios at pF=3.0 to determine water holding capacity of the soil were 17-32% in Panicum miliaceum, 16-42% in Setaria italica and Sorghum bicolor, 22-60% in Echinochloa utilis, respectively. Eleucine coracana showed the similar tendency to Sorghum bicolor on the above environmental conditions though thc number of cultivation examples for this crop was only three in this survey. 2) Germination test: Germination percentage of each strain reached almost 100% and average required days for germination was mostly one day at 25°C and 35°C. In the case of Echinochloa utilis, the germination rate and average required days for germination at 15°C was 42.8-88.0% and 4.1-4.8 days but those of Sorghum bicolor was 4.0-28.0% and 5.3-6.2 days respectively. On the other case of 45°C, Sorghum bicolor showed 85.2-96.0% of germination percentage, but those of Setaria italica and Panicum miliaceum were indicated 22.8-72.0% and 32.0-62.8% respectively. As far as plant growth at 8 days after germination was concerned, maximum values of plant height of Echinochloa utilis and Panicum miliaceum were found at 35°C and those of root length were gained at 25°C. In the case of Sorghum bicolor and Setaria italica, both of maximum values on plant height and root length were obtained at 25°C. On the while, dry matter weight of Sorghum bicolor was the heaviest in 35°C but those of the rest crops were maximum in 25°C. Among the strains of Echinochloa utilis, Setaria italica and Panicum miliaceum used in this experiment, it was tended that the dry matter weight of strains in the higher elevation was the heavier than those of lower elevation at 15°C. From the above results, it was manifest that the geographical distribution of the used native millets coincided with the plant character, their temperature response at the early growth stages including germination, and also suggested that the ability of crops for cold resistance was one of the most important factors to determine the crops cultivated in the high land.

In northern China, the Yangshao cultural period (5000–3000 BC) was a critical timespan in the establishment of agricultural economies and the emergence of social complexity. We present the results of archeobotanical analysis from 58 soil samples collected from 12 recently investigated sites located in the Luoyang Basin, and recovered 5290 carbonized plant remains from 9 sites dating to the Late Yangshao period. We compared our novel dataset with previous archeobotanical date, compiling a total of 196 samples from 58 sites in central and western Henan Province. During the Early Yangshao period (5000–4200 BC), a nascent, extensive agricultural economy based primarily on broomcorn millet, with lesser foxtail millet and rice, was developing in small settlements (<0.2 km2) in the loess tablelands and valleys of western Henan province. However, the population pressure—rather than environmental degradation—drove the “foxtail millet-broomcorn millet substitution” during the Middle Yangshao period (4200–3500BC). The intensive agriculture based mainly on foxtail millet facilitated the development of social complexity in the region, as demonstrated by the emergence of size-graded agricultural settlements of medium (0.2–0.6 km2) and large (> 0.6 km2) scale. Notably, millets tend to be less ubiquitous in these larger settlements compared to smaller ones, with differences in millet ubiquity between sites increasing over time. The local surface hydrology influenced by paleoclimatic changes prompted the spread of agriculture from higher loess tablelands and valleys during the early Yangshao period into more marginal loess tablelands and plains by the Middle and Late Yangshao periods. Rice cultivation is concentrated in valley areas and appears to have been closely tied to environments with better hydrothermal conditions. Our research shows that climatic conditions during the Holocene fostered the development of agriculture during the Yangshao Culture period and that the distribution of settlements throughout this time was influenced by highly localized geomorphologic environments delimiting the distribution of crops. The rise of agriculture promoted the formation of complex and stratified economies in the Yangshao Culture period and it was the intensification and elaboration of these new economic and social systems that led to later transformation in agricultural structures and settlement sizes.

During the Middle-to-Late Neolithic period (7000–3800 BP), Shaanxi Province served as a critical juncture in the transmission of crops. Foxtail millet (Setaria italica), broomcorn millet (Panicum miliaceum), and rice (Oryza sativa) spread westwards into the Gansu–Qinghai region and southwards into the Sichuan basin, whilst wheat (Triticum aestivum) and barley (Hordeum vulgare) were transmitted through the Shaanxi region to the middle and lower Yellow River regions. Neolithic settlements are found in all three of the main geomorphic settings in Shaanxi: the Loess Plateau, plains, and mountainous areas. While the extent to which crop diffusion and distribution were influenced by environmental changes has previously been highlighted, the strategies of crop utilization in different geomorphic contexts have not been specified. Based on crop-remains data from 33 archaeological sites in Shaanxi, this study uses statistical modeling and ArcGIS-based spatial analysis to investigate prehistoric crop utilization in Shaanxi during the Neolithic period and its environmental determinants. Our results indicate the following: (1) The dominant crops in the Neolithic Shaanxi were foxtail millet and broomcorn millet, with the proportion of foxtail millet increasing over time. (2) The Guanzhong Plain was the earliest region in Shaanxi to adopt millet and rice (~7000–3800 BP). Subsequently, millet and rice had influenced the Qinba Mountains by ~5000 BP at the latest. By ~3800 BP, millet had affected the entire northern Shaanxi Plateau, with rice only found at the Shimao site around 4000 BP. Finally, wheat and barley influenced the Guanzhong region and the Qinba region in Shaanxi around 4000 BP. In addition, rice, wheat, and barley mainly enhanced agricultural diversity in the Guanzhong Plain and Qinba Mountains but had limited impact in the Northern Plateau, where cattle and sheep have enriched subsistence strategies since about 4500 BP. (3) Environmental factors affected the distribution of crops to different extents—elevation and river proximity had minimal effects on foxtail millet and broomcorn millet but significantly influenced the presence of rice, wheat, and barley. These factors led to a spatial pattern where millet dominated in the Northern Plateau, while the Guanzhong Plain and Qinba Mountains developed mixed farming systems incorporating all four seed types. This study provides new insights into the environmental mechanisms influencing crop diffusion and prehistoric human adaptation during the Neolithic period in Shaanxi.

A field experiment was conducted during summer season of 2022 at Tamil Nadu Agricultural University, Coimbatore to study the influence of millet based intercropping systems on growth and productivity of castor under irrigated situation. The experiment was laid out in randomized block design and replicated thrice. The treatment consist of nine cropping systems viz., castor + foxtail millet (1:3), castor + proso millet (1:3), castor + little millet (1:3), castor + kodo millet (1:3), paired row castor + foxtail millet (2:4), paired row castor + proso millet (2:4), paired row castor + little millet (2:4), paired row castor + kodo millet (2:4), sole castor. Experimental results revealed that the different millet based cropping systems significantly influenced growth and productivity of castor. Sole castor was recorded the highest growth, yield parameters and seed yield (20.98 q/ha). Among the millet based intercropping systems, maximum values of growth parameters viz., plant height (170.20 cm), number of branches/plant (7.90), stem girth (8.70 cm) and dry matter production (29.83 q/ha) were recorded in the paired row castor + proso millet (2:4) and it was on par with paired row castor + foxtail millet (2:4). Similarly, yield and yield attributing characters viz., number of spike/plant (28.2), number of capsule/ spike (55.8), highest length of primary branch (40.1 cm) and seed yield (20.03 q/ha) was obtained in paired row castor + proso millet (2:4) and it was comparable paired row castor + foxtail millet (2:4). The economic study revealed that the higher net return and benefit cost ratio was obtained from paired row castor + foxtail millet (2:4) (₹. 74,842.00 and 2.30) and paired row castor + proso millet (2:4) ((₹. 72,702.00 and 2.26). From this study, it was concluded that proso millet and foxtail millet were indentified to be compatible intercrops with castor for improved productivity.

Rice stripe virus (RSV; genus Tenuivirus) is a serious threat to rice production in Korea (2). In 1965, a disease outbreak was observed on rice in South Korea, with plants showing yellow stripe symptoms (2). Reoccurrence of RSV in rice was observed again in 1980 in Gyeonggi and Chungcheong. In 2001, RSV was estimated to be infecting approximately 4,663 ha of rice in the provinces of Gyeonggi and Gangwha and approximately 5,000 ha of riceland in the provinces of Buan and, Seocheon (3). Proso millet (Panicum miliaceum L.) is grown as a cereal grain crop and used mainly for human food in South Korea (1). In June 2009, proso millet plants that displayed yellow stripe symptoms were collected at Sinjeon-Myeon, Gangjin-Gun, and Jeollanam-do provinces, where an outbreak of RSV in rice was reported. Diseased plants tested positive to RSV with an ELISA Kit (KisanBio, Seoul, Korea). Total RNA was extracted from leaf tissue with an RNeasy Plant Mini Kit (Qiagen Inc., Valencia, CA). RSV coat protein specific-primers were produced (5' TGTGGAACATAGTCCCACAGTAAGT 3'(upstream), 5' CTAAGCCGCAACCATTCCTCCAGT 3'(downstream). Reverse transcription-PCR confirmed the presence of a 494-bp product as predicted for the presence of RSV. The coat protein of RSV isolates collected from proso millet, rice, and foxtail millet in the same area was also sequenced. Results confirmed that phylogenetic relationships were of high homology: 98.9% between RSV isolates from rice and foxtail millet, 99.2% between isolates from rice (GenBank Accession No. JN245626) and proso millet (GenBank Accession No. JN245627); 99.6% between rice and foxtail millet (GenBank Accession No. JN245628); and 99.6% between foxtail millet and proso millet. In addition, sequence comparisons showed 96 to 99% identity with known RSV sequences available in GenBank (Accession No. X53563) (4). To our knowledge, this is the first report of RSV of proso millet in South Korea. The finding of this disease confirms further spread of the virus within the northern part of South Korea and the need for research to develop more effective management options to reduce the impact of RSV in proso millet.

Feeding behavior and development response of the perilla seed bugs (Nysius sp.) (Heteroptera: Lygaeidae) on multiple crop seeds combinations

Investigation of the ultrastructural characteristics of foxtail and broomcorn millet during carbonization and its application in archaeobotany

Millets and pulses are the most important dryland crops grown in both Kharif and Rabi seasons in the semi-arid regions of the country for food, feed and animal fodder. These crops also show considerable resilience to changing climate (drought, heat and nutrient stresses). For diversification of Pearl millet-Chickpea rotation, adoption of small millets (finger millet, foxtail millet, proso millet, little millet, brown top millet, barnyard millet, and kodo millet) in addition to pearl millet may be viable option.A field experiment was carried out at CCS Haryana Agricultural University, Hisar, Haryana, India during 2022-23 in randomized block design in Kharif and Rabi season, replicated thrice with eight treatments (foxtail millet, little millet, browntop millet, proso millet, kodo millet, barnyard millet, finger millet and pearl millet) in Kharif season and eight crop rotations (foxtail millet- Indian mustard, little millet- Indian mustard, browntop millet- Indian mustard, proso millet- Indian mustard , kodo millet- Indian mustard, barnyard millet - Indian mustard, finger millet Indian mustard and pearl millet - Indian mustard) in Rabi season to evaluate yield and economic performance eight millet based crop rotations with Indian mustard. During Kharif season among all millets (foxtail millet, little millet, browntop millet, proso millet, kodo millet, barnyard millet, finger millet and pearl millet) tested, Pearlmillet was found most suitable, which produced significantly higher grain yield (2462 kg/ha), biological yield (10066 kg/ha), net energy returns (121552 MJ/ha), Energy intensiveness (14.0 MJ/USD), human energy profitability (133.3 MJ/ha) compared to all other millets. In Rabi season Indian mustard sown after Pearl millet recorded significantly higher seed yield (3492 kg/ha), biological yield (20666 kg/ha), net returns (Rs. 120471/ha) and B:C (2.97) compared to other crop rotations but Indian mustard sown after foxtail millet recorded higher net energy returns (250664 MJ/ha), energy ratio (25.50), energy profitability (24.50 MJ/ha) and human energy profitability (267.8 MJ/ha).