Abstract
Salmonella enterica is a zoonotic pathogen which can readily pass from animal to man through the consumption of contaminated food. This study was designed to determine molecular characterization of Salmonella and antibiotic resistance profiles of Salmonella recovered from internal organs of dead turkey. A total of 40 internal organ samples from dead turkey were collected from different turkey farms in Dinajpur district. Among the samples 12 (30%) were positive for Salmonella. Salmonella virulence factors were determined using the polymerase chain reaction assays targeting the virulence gene &16S rRNA gene region was amplified with the universal primers, forward primer- 27F (5'AGAGTTTGATCCTGGCTCAG 3') and reverse primer- 1492R (5' TACCTTGTTACGACTT 3'). PCR amplification band was found at 1470 bp. Among the different serotypes, Salmonella enterica was identified by using phylogenetic tree analysis. Antibiotic resistance analysis indicates that Salmonella spp. were 100% sensitive to Azithromycin, Kanamycin, Norfloxacin and Chloramphenicol. The isolates were 100% resistant to Cefradine, Cloxacillin, Bacitracin, Levofloxacin, Amoxicillin, Nalidixic acid and Tetracycline. In conclusion, this study provides that the isolated Salmonella spp. were found to AMR in response to variety of multi drugs. Salmonella enterica can cause a wide range of illnesses, ranging from gastroenteritis to acute, life-threatening enteric fever for turkey. This study suggests that turkeys may act as a reservoir for these strains which can be transferred to humans.
 Asian J. Med. Biol. Res. June 2019, 5(3): 219-225
Highlights
Salmonellosis is one of the most prevalent infectious foodborne diseases in the world (McCarthy et al, 2009).The primary reservoir of Salmonella for humans is the intestinal tract of poultry .The turkey is a large bird in the genus Meleagris, which is not native to Bangladesh
Cultural characteristics Cultural characteristics of each type of bacteria isolated from internal organ of turkey were studied for the examination of size, shape, colony characteristics, and pigment production in various solid media
Salmonellosis occur due to linked with foodborne outbreaks, live animal contact, poor hygiene, and environmental exposure
Summary
Salmonellosis is one of the most prevalent infectious foodborne diseases in the world (McCarthy et al, 2009).The primary reservoir of Salmonella for humans is the intestinal tract of poultry .The turkey is a large bird in the genus Meleagris, which is not native to Bangladesh. They grow faster and become suitable for slaughter purpose earlier like broiler chickens and quails. Avian pathogenic Salmonella strains are the etiologic agents of salmonellosis in birds and are an important problem for the turkey industry (Soon et al, 2008). Salmonella strains cause a number of diseases in domestic turkey, leading to disease and death, or to a decrease in egg and meat production or
Sign-in/Register to view highlights & summary Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
