Abstract
Small nucleolar RNAs (snoRNAs) orchestrate the modification and cleavage of pre-rRNA and are essential for ribosome biogenesis. Recent data suggest that after nucleoplasmic synthesis, snoRNAs transiently localize to the Cajal body (in plant and animal cells) or the homologous nucleolar body (in budding yeast) for maturation and assembly into snoRNPs prior to accumulation in their primary functional site, the nucleolus. However, little is known about the trans-acting factors important for the intranuclear trafficking and nucleolar localization of snoRNAs. Here, we describe a large-scale genetic screen to identify proteins important for snoRNA transport in Saccharomyces cerevisiae. We performed fluorescence in situ hybridization analysis to visualize U3 snoRNA localization in a collection of temperature-sensitive yeast mutants. We have identified Nop4, Prp21, Tao3, Sec14, and Htl1 as proteins important for the proper localization of U3 snoRNA. Mutations in genes encoding these proteins lead to specific defects in the targeting or retention of the snoRNA to either the nucleolar body or the nucleolus. Additional characterization of the mutants revealed impairment in specific steps of U3 snoRNA processing, demonstrating that snoRNA maturation and trafficking are linked processes.
Highlights
The findings presented here have increased our understanding of the key factors in snoRNA maturation and transport
We have identified factors required for the accumulation of a snoRNA in the nucleolar body (Nop4, Prp21, and Tao3) and for the trafficking of a snoRNA from the nucleolar body to the nucleolus (Sec14 and Htl1)
A plausible explanation for the specific link between U3 RNA and Prp21 is the unique presence of an intron in this snoRNA
Summary
The gsp temperature-sensitive mutant was described previously [60, 98]. Fluorescence in situ hybridization (FISH) analysis and immunofluorescence analysis in yeast were performed as previously described [60]. The antisense deoxyoligonucleotide probes against yeast U3 snoRNA (5ЈATTCAGTGGCTCTTTTGAAGAGTCAAAGAGTGACGATTC CTATAGAAATGA3Ј) and poly(A) mRNA [oligo(dT)50] were synthesized by Operon Technologies with a single Cy3 label at the 5Ј end. After the cells were permeabilized with 0.5% IGEPAL, hybridization was performed with 150 ng of Cy3-labeled probe overnight at 37°C. Indirect immunofluorescence was performed following the FISH analysis as described previously [98], with a 1:1,000 dilution of anti-Nop1p (A66) monoclonal antibody [3] or a 1:5,000 dilution of anti-Nsr1p monoclonal antibody (C21) and a 1:100 dilution of Cy2-conjugated anti-mouse secondary antibodies (Jackson ImmunoResearch Laboratories). Images were acquired at a magnification of ϫ100 (Plan Apochromat objective, numerical aperture 1.4) with a cooled charge-coupled device Retiga Exi Fast 1394 camera (Qimaging, Burnaby, British Columbia, Canada) and IPLab Spectrum software
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
