HC-Pro, a potyvirus RNA silencing suppressor, cancels cycling of Cucumber mosaic virus in Nicotiana benthamiana plants
The mixed infection of Cucumber mosaic virus (CMV) and a potyvirus has been known to increase CMV titer in Nicotiana benthamiana plants, resulting in synergistic viral symptoms. We found that among three potyviruses--Potato virus Y (PVY), Turnip mosaic virus (TuMV), and Clover yellow vein virus (C1YVV)--synergistic effects on CMV (or a recombinant CMV vector) titers were most efficiently induced by a co-infection with PVY in N. benthamiana plants. In addition, the helper component-proteinase (HC-Pro) gene of PVY expressed by transgenic plants, which is a viral RNA silencing suppressor, was sufficient to cancel the cycling pattern of CMV titer, resulting in increased levels of overall CMV accumulation. Surprisingly, we found that the levels of CMV and the foreign protein expressed from the CMV vector were much higher in the HC-Pro-transgenic plants than the levels detected in the plants mixed-infected with CMV and PVY. The mechanism for canceling the cyclic infection of CMV by the HC-Pro protein alone is discussed in view of the interaction between RNA silencing and HC-Pro, as well as the possible involvement of the 3a protein.
- Dissertation
- 10.14264/uql.2019.495
- Jan 1, 2003
- The University of Queensland
Dysfunctional viral movement protein (MP) genes have been shown to give broad spectrum resistance when expressed in transgenic plants. Transgenic tobacco lines were generated expressing dysfunctional MP of Cucumber mosaic virus (CMV) strain Fny, modified by polymerase chain reaction-site directed mutagenesis. The transgenic lines were molecularly analysed, and challenged with CMV isolates belonging to subgroups I and II. However, unexpectedly none of the transgenic MP lines conferred resistance, irrespective of transgene copy number and of the accumulation of putative dysfunctional MP. In addition, hybrid lines expressing two different modified MPs were also susceptible to CMV infection.As a first step towards studying the mechanism of post-transcriptional gene silencing (PTGS)-based immunity to Potato virus Y (PVY) and its suppression by CMV, accumulation pattern of CMV and PVY were studied in infected tobacco plants. CMV was detected in all leaves, but concentrated in young leaves. On the other hand, PVY mostly accumulated in older systemic leaves. Dual infection of CMV and PVY benefited both viruses, resulting in higher virus titres and more severe symptoms. CMV aided PVY movement to the top part of the plant.CMV and PVY co-inoculation of PVY-immune transgenic tobacco plants, expressing a sense- or a dsRNA-transgene, showed that CMV induced the breakage of PTGS-based immunity to PVY. Increased time intervals between CMV and subsequent PVY inoculations resulted in an increasing proportion of initially immune plants becoming infected with PVY. Immunity was broken in 100% of initially immune transgenic plants when PVY was inoculated on a leaf newly emerged following CMV inoculation. This confirmed the proposed mode of action of PTGS suppression by CMV 2b protein through preventing the initiation of PTGS. Interestingly, PVY failed to establish a long term systemic infection, despite the initial immunity breakdown and continued presence of CMV in all leaves. Attempts to re-inoculate PVY on the youngest leaves failed indicating a highly resistant state of these transgenic plants in the presence of CMV.Molecular information on Australian CMV isolates is limited. Six Australian CMV isolates were characterised to determine their experimental host range, disease symptoms, and evolutionary relatedness. Host differentials and differentiating symptoms were identified for each isolate. Phylogenetic analyses based on the sequences of RNA 3, and sequence analyses of the 2b gene placed the isolates into the known 3 CMV subgroups.The CMV 2b protein is involved in virus movement, pathogenicity, and suppression of plant defence. Two mutants were generated by inserting a stop codon in the 2b and putative 2c genes of Fny-CMV. The CMV 2b mutant infected tobacco plants and moved systemically, but did not cause symptoms, indicating that CMV 2b protein is involved in CMV symptom development. CMV subgroup I isolates encode a putative CMV 2c gene that may function as a modulator of symptom severity, because a 2c mutant had significantly increased symptom severity.To determine whether the 2b gene or its product are involved in the development of disease symptoms and host range specificity, this gene was cloned from five Australian isolates, and moved into the Q-CMV background (Q-CMV RNAs 1 and 3, plus recombinant RNA 2). The 2b genes from Australian CMV isolates which showed distinct host range and disease symptoms in Nicotiana species, sweetcom, tomato, and capsicum, were cloned in an infectious RNA 2 clone of Q-CMV. Inoculation of Nicotiana species and capsicum with recombinant hybrid RNA 2 Q-CMV carrying 2b derived from severe isolates changed Q-CMV symptoms from mild to severe. On the other hand, recombinant Q-CMV carrying 2b derived from mild isolates maintained the mild Q-CMV symptoms. Tomato infected by recombinant hybrid RNA 2 Q-CMV did not show symptoms. However, none of the recombinant hybrid RNA 2 Q-CMV infected sweetcom, which indicates that 2b is not sufficient to overcome CMV resistance in sweet com. These results indicate that the 2b protein is a determining factor in the severity of disease symptoms in a host specific manner. Diagnostic RT- PCR restriction fragment assays were developed to confirm the source of 2b gene in the recombinant Q-CMV.
- Research Article
13
- 10.4454/jpp.v98i1.065
- Mar 17, 2016
- Journal of Plant Pathology
A survey for apple viruses was conducted in October of 2014 in Shanxi, Gansu, Sichuan, Liaoning and Hebei provinces of China. A total of 189 leaf samples with mosaic symptoms and five symptomless samples were collected and tested for viruses. Apple mosaic virus (ApMV) (Lakshmi et al., 2011; Robertson, 2012) was not detected by RT-PCR with total RNA and primers ApMV-F (5’-CGTGAGGAAGTTTAGGTTG-3’)/ApMV-R (5’-GCCTCCTAATCGGGGCATCAA-3’). Neither were Tobacco mosaic virus (TMV), Turnip mosaic virus (TuMV), Potato virus Y (PVY) and Potato virus X (PVX) by a multiplex RT-PCR assay previously developed in our laboratory, with the exception of Cucumber mosaic virus (CMV), for which a partial fragment (322 bp) of the coat protein (CP) gene was amplified from 153 symptomatic samples using specific primers CMV-F (5’-GATAAGAAGCTTGTTTCGCG-3’)/CMV-R (5’-GCTCGATGTCGACATGAAGT-3’). To confirm these preliminary results, primer pair CMV-CP-F (5’-A TGGACAAA TCTGAA TCAACC-3’)/ CMV-CP-R (5’-TCAGACTGGGAGCACCCC-3’) were designed to amplify a 657 bp CMV CP amplicon by simplex RT-PCR. The expected product was obtained from each sample identified as positive by multiplex RT-PCR. Five amplicons were randomly selected for cloning and sequencing (GenBank accession Nos. KP307919-KP307922 and KP641344). Sequence alignments showed the highest CMV sequence identity at the nucleotide level (97.3% to 99.2%) of the five isolates with that of a CMV isolate from tobacco in Sichuan province (KJ746016). Phylogenetic analysis indicated the five isolates cluster into CMV subgroup I. Using the CMV-specific monoclonal antibody 3C12 (Yu et al., 2005), the 153 symptomatic samples were positive for CMV in ELISA. No virus was detected in the five symptomless samples. To our knowledge, this is the first report of CMV infecting apple in China.
- Book Chapter
2
- 10.1016/b978-0-12-411584-2.00010-x
- Jan 1, 2014
- Plant Virus–Host Interaction
Chapter 10 - Synergism in plant–virus interactions: A case study of CMV and PVY in mixed infection in tomato
- Research Article
5
- 10.1007/s12298-021-00925-3
- Jan 1, 2021
- Physiology and Molecular Biology of Plants
The online version contains supplementary material available at 10.1007/s12298-021-00925-3.
- Research Article
40
- 10.3186/jjphytopath.55.296
- Jan 1, 1989
- Japanese Journal of Phytopathology
Dual infection of turnip mosaic virus (TuMV) and cucumber mosaic virus (CMV) causes a severe mosaic disease in Japanese radish plants. This paper deals with the interactions between these viruses in radish plants. TuMV caused mild mosaic symptoms of Japanese radish plants by itself, but CMV did not. Plants inoculated with both viruses displayed more severe mosaic symptoms than plants inoculated only with TuMV. Indirect ELISA tests indicated that CMV accumulation was significantly enhanced in the presence of TuMV, but TuMV levels were little affected by co-infection with CMV. The enhanced accumulation of CMV in plants infected with TuMV as well as CMV was evident in systemically infected leaves rather than the inoculated cotyledons and this suggested that systemic transport and spread of CMV in radish plants were enhanced in the presence of TuMV.
- Research Article
2
- 10.4454/jpp.v95i4sup.020
- Dec 1, 2012
- Journal of Plant Pathology
In August 2011, unusual virus-like symptoms consisting of distinct bright yellow spots, mottling (calico), mosaic, narrow leaves and stunting were observed on greenhouse-grown pepino (Solanum muricatum) plants in Usak (western Turkey). Leaf tissue from 10 symptomatic plants was sampled and analyzed by DAS- ELISA using commercial kits to Pepino mosaic virus (PepMV), Alfalfa mosaic virus (AMV), Cucumber mosaic virus (CMV), To- bacco mosaic virus (TMV), Tomato spotted wilt virus (TSWV), Tomato ringspot virus (ToRSV), Potato virus X (PVX), Potato virus Y (PVY), Potato virus M (PVM) and Potato virus S (PVS) (Bioreba, Switzerland). DAS-ELISA results revealed that four samples were infected by CMV, five by AMV and one by both CMV and AMV. There were no reactions with the antisera to PepMV, TMV, TSWV, ToRSV, PVX, PVY, PVM and PVS. The presence of AMV and CMV was confirmed by RT-PCR using to- tal RNA extracted from infected pepino leaves (Foissac et al., 2001) and specific primers designed to amplify a fragment of the coat protein gene of AMV (Martinez et al., 2004) (AMVcoat-F: GTGGTGGGAAAGCTGGTAAA; AMVcoat-R: CACCCAGT GGAGGTCAGCATT) and CMV (Faggioli et al., 2001) (CMV- coat-F: AACATAGCAGAGATGGCGG, CMVcoat-R: ACTCT- TAACCACCCAACCTT). PCR products of the expected size (700 bp for AMV and 280 bp for CMV) were obtained from plants that were DAS-ELISA positive for AMV and CMV, re- spectively. To our knowledge, this is the first report of natural co- occurrence of AMV and CMV in pepino in Turkey.
- Research Article
50
- 10.1371/journal.pone.0136062
- Aug 27, 2015
- PLoS ONE
We compared infection of Nicotiana benthamiana plants by the positive-sense RNA viruses Cucumber mosaic virus (CMV), Potato virus Y (PVY), and by a Potato virus X (PVX) vector, the latter either unaltered or expressing the CMV 2b protein or the PVY HCPro suppressors of silencing, at 25°C vs. 30°C, or at standard (~401 parts per million, ppm) vs. elevated (970 ppm) CO2 levels. We also assessed the activities of their suppressors of silencing under those conditions. We found that at 30°C, accumulation of the CMV isolate and infection symptoms remained comparable to those at 25°C, whereas accumulation of the PVY isolate and those of the three PVX constructs decreased markedly, even when expressing the heterologous suppressors 2b or HCPro, and plants had either very attenuated or no symptoms. Under elevated CO2 plants grew larger, but contained less total protein/unit of leaf area. In contrast to temperature, infection symptoms remained unaltered for the five viruses at elevated CO2 levels, but viral titers in leaf disks as a proportion of the total protein content increased in all cases, markedly for CMV, and less so for PVY and the PVX constructs. Despite these differences, we found that neither high temperature nor elevated CO2 prevented efficient suppression of silencing by their viral suppressors in agropatch assays. Our results suggest that the strength of antiviral silencing at high temperature or CO2 levels, or those of the viral suppressors that counteract it, may not be the main determinants of the observed infection outcomes.
- Research Article
41
- 10.1094/mpmi-06-11-0170
- Jan 1, 2012
- Molecular Plant-Microbe Interactions®
Mixed infection of Cucumber mosaic virus (CMV) and Turnip mosaic virus (TuMV) induced more severe symptoms on Nicotiana benthamiana than single infection. To dissect the relationships between spatial infection patterns and the 2b protein (2b) of CMV in single or mixed infections, the CMV vectors expressing enhanced green fluorescent or Discosoma sp. red fluorescent proteins (EGFP [EG] or DsRed2 [Ds], respectively were constructed from the same wild-type CMV-Y and used for inoculation onto N. benthamiana. CMV2-A1 vector (C2-A1 [A1]) has a functional 2b while CMV-H1 vector (C2-H1 [H1]) is 2b deficient. As we expected from the 2b function as an RNA silencing suppressor (RSS), in a single infection, A1Ds retained a high level of accumulation at initial infection sites and showed extensive fluorescence in upper, noninoculated leaves, whereas H1Ds disappeared rapidly at initial infection sites and could not spread efficiently in upper, noninoculated leaf tissues. In various mixed infections, we found two phenomena providing novel insights into the relationships among RSS, viral synergism, and interference. First, H1Ds could not spread efficiently from vasculature into nonvascular tissues with or without TuMV, suggesting that RNA silencing was not involved in CMV unloading from vasculature. These results indicated that 2b could promote CMV to unload from vasculature into nonvascular tissues, and that this 2b function might be independent of its RSS activity. Second, we detected spatial interference (local interference) between A1Ds and A1EG in mixed infection with TuMV, between A1Ds (or H1Ds) and TuMV, and between H1Ds and H1EG. This observation suggested that local interference between two viruses was established even in the synergism between CMV and TuMV and, again, RNA silencing did not seem to contribute greatly to this phenomenon.
- Research Article
6
- 10.1094/pdis.2001.85.4.447c
- Apr 1, 2001
- Plant disease
Flue-cured tobacco is an important crop in Henan Province, China. During the 2000 growing season, many tobacco plants showed various degrees of mottling, mosaic, vein clearing, or vein necrosis in most of the counties. Some plants even died at an early stage of growth. A survey was conducted in May-June in several tobacco-growing counties, and the incidence of symptomatic plants in individual fields ranged from 10 to 85%. The most widely planted tobacco varieties, NC89, K326, and K346, were highly susceptible. Symptomatic plants were collected from Jiaxian and Xiangcheng counties and samples were tested by enzyme-linked immunosorbent assay for Tobacco mosaic virus (TMV), Cucumber mosaic virus (CMV), Potato virus Y (PVY), and Potato virus X (PVX). Of 65 samples tested, 21 were positive for only PVY, 16 positive for only CMV, one each was positive for only TMV or PVX. Nineteen samples were doubly infected with various combinations of these viruses and six were infected with combinations of three viruses. The causal agent(s) in the remaining sample could not be determined. In total, CMV was detected in 40 samples, PVY in 38, PVX in 10, and TMV in 7 samples. TMV and CMV used to be the most important viruses and PVY occurred only rarely. But PVY has become prevalent in Henan and in neighboring Shandong province (2). CMV and TMV were reported to be the most prevalent viruses in Shanxi (1) and Fujian Provinces (3). Because resistant varieties are not available, and mixed infections are more common, the results presented here explain why huge damage is occurring in tobacco crops in recent years. Some varieties are partially resistant to TMV and CMV but the varieties commonly grown are highly susceptible to PVY. Therefore, breeding for resistance to viruses, especially to PVY, is urgent to control the occurrence of tobacco viral diseases.
- Research Article
2
- 10.14601/phytopathol_mediterr-9010
- Mar 26, 2012
- Phytopathologia Mediterranea
Cucumber mosaic virus (CMV) has been reported from potato production areas in Europe, USA, Japan and more frequently in regions with warm climates such as Egypt, India, Saudi Arabia and Syria. As it is considered as an uncommon virus in potato, the characterization of potato isolates of CMV is far behind those from other hosts. In addition to potato, CMV is a common virus infecting many crops in Syria, but nothing is known about its molecular characteristics. The present study aimed to characterize Syrian CMV isolates collected from potato and neighboring tobacco fields. All potato isolates of CMV (total of four) co-infected potato plants with Potato virus Y (PVY) which is the most frequent potato virus in Syria. According to the sequence analyses of the coat protein (CP) coding region, three potato and three tobacco CMV isolates were found to be closely related regardless of the host species or geographic origin, and all belonged to the IA strain subgroup of CMV. A potato CMV isolate, PoCMV7-5, readily infected solanaceous plants in which it induced systemic infection, but was less infectious to other hosts including those of Leguminosae and Cucurbitaceae . When inoculated on potato plants, PoCMV7-5 alone or with various PVY strains was able to cause local but not systemic infection in all potato cultivars inoculated. PoCMV7-5 contained heterogeneous variants of satellite RNA which varied in length due to A or/and T deletion/insertion at approximate nucleotide position 225‒240. This is the first report on CMV satellite RNA from potato.
- Dissertation
- 10.31390/gradschool_disstheses.2703
- Jan 1, 1974
The epidemiology of several viruses known to infect bell peppers was studied in two pepper producing areas of Louisiana. The St. James area has a history of severe losses due to virus diseases which fre quently infect 100% of the pepper plants. TI!.is is in sharp contrast to the Hanmond area in which virus-infected peppers are seldom found. Viruses were identified by mechanical transmission to indicator hosts and by serology. In the St. James area, tomato spotted wilt virus (TSWV) was found to spread primarily in April and infect up to 5% of the plants in a given field. Peppers infected with cucumber mosaic virus (CMV), potato virus Y (PVY), and tobacco etch virus (TEV) were not detected until the 1st of May, but these three aphid transmitted viruses spread rapidly and quite often entire fields were infected by the middle of June. TSWV was the only virus found infecting bell peppers in the Hammond area, and then only in an occasional plant. Eighteen indigenous plant species found in the vicinity of bell pepper fields in the St. James area were shown by mechanical trans mission to be infected with one or more of the four viruses (TEV, PVY, CMV, and TSWV). Three of the 18 weed hosts; Medicago arabica (L.) Huds., Melilotis officinalis (L.) Lam., and Rudbekia amplexicaulis Vahl.; shown to be infected with CMV and PVY; CMV, PVY, and TEV; and CMV, PVY, TJW, and TSWV; respectively, were abundant near pepper fields at the time infection occurred in the peppers. Solanum nigrum L. was shown to be infected with CMV, PVY, and TEV; although this species is not widespread, several dense stands were found in disturbed sites around the area. Furthermore,.[. nigrum has been reported to be an annual, but it was shown to act as a perennial in St. James by resprouting from semi-woody stems and root-stocks. A survey of field borders in the St. James area and in the "virus-free" Hanmond area was made to compare the population densities of the 18 identified weed hosts. Only nine of the 18 weed species were detected by the survey in the Hamnond area; none of the four species mentioned above were found. Attempts to transmit viruses from the known weed host species that do occur in Hanmond resulted in a single transmission of TSWV. Populations of alate aphids in pepper fields were determined by trapping them on yellow
- Research Article
54
- 10.1016/s0166-0934(97)00149-3
- Dec 1, 1997
- Journal of Virological Methods
Simultaneous detection of cucumber mosaic virus, tomato mosaic virus and potato virus Y by flow cytometry
- Research Article
15
- 10.1007/s10327-019-00845-x
- Feb 26, 2019
- Journal of General Plant Pathology
To protect against infection, plants have evolved multi-layered defense systems such as RNA silencing, salicylic acid (SA)-mediated resistance, resistance (R) protein-conferred resistance and defense priming. Antiviral defense systems seem to act in a coordinated manner in response to viral infection, but the underlying mechanisms are unknown except in a limited number of specific virus–plant combinations. Cucumber mosaic virus (CMV) infection of Arabidopsis thaliana is a well-known sophisticated pathosystem often used to investigate antiviral defense reactions. On the basis of extensive studies on the interaction between CMV and A. thaliana, RNA silencing plays a key role in suppressing CMV infection in the host plant. However, several strains of CMV are able to overcome the RNA silencing system by producing an RNA silencing suppressor protein. If the virulent CMV strain is indeed able to overcome basal antiviral RNA silencing, host plants carrying the R gene exhibit a resistance response, generally accompanied by necrotic local lesions at the primary infection sites. RCY1, which encodes an NB-LRR class R protein, was isolated from A. thaliana and identified as the first R gene conferring resistance to CMV. SA-dependent and -independent signaling pathways also seem to be associated with CMV resistance, while in A. thaliana, resistance induced by a plant activator treatment is thought to activate defense priming against a broad range of pathogens. In this review, we summarize current knowledge on the multiple defense systems of A. thaliana against CMV infection.
- Research Article
- 10.1186/s12985-026-03081-w
- Jan 25, 2026
- Virology journal
Cucumber mosaic virus (CMV) is vectored by aphids. Infection of Arabidopsis thaliana plants with CMV affects their attractiveness to aphids (Myzus persicae) and the performance of aphids confined on these plants. CMV-induced changes in plant-aphid interactions ('viral manipulation') may promote transmission. M. persicae, an efficient CMV vector is a 'generalist', i.e., it has many plant hosts. A. thaliana is also exploited by crucifer-specialist aphids including Lipaphis erysimi (an efficient CMV vector) and Brevicoryne brassicae (a poor CMV vector). We explored the hypothesis that CMV-induced viral manipulation of aphid behaviour would exert stronger effects on M. persicae than on crucifer-specialists. M. persicae, B. brassicae and L. erysimi were released in microcosms and allowed to choose to settle on either CMV-infected or mock-inoculated plants. Initial experiments showed that as systemic CMV infection developed in A. thaliana, aphids of M. persicae were decreasingly likely to settle on infected plants. In subsequent experiments, using plants at 14 days post-infection, it was found that aphids of M. persicae were faster to choose between infected and uninfected plants than specialist aphids, but that both the generalist and specialists were less likely to settle on CMV-infected plants. Olfactometry showed that volatiles emitted by CMV-infected plants attracted M. persicae, and although the specialists showed no significant preferences, greater numbers of aphids of all three species responded when CMV-infected plant volatiles were presented to them. As CMV infection develops, A. thaliana becomes less susceptible to aphid colonisation, however, plants continue to emit attractive olfactory cues. This is consistent with a model in which aphids are attracted to infected plants but discouraged from settling (e.g., by gustatory cues), which encourages aphids to carry CMV to non-infected plants. CMV appears to be more successful in manipulating the interactions of A. thaliana with the generalist aphid M. persicae, than with the crucifer specialists B. brassicae or L. erysimi.
- Research Article
5
- 10.4314/njb.v33i1.11
- Oct 30, 2017
- Nigerian Journal of Biotechnology
Tomato and pepper are important vegetable crops grown in Nigeria, accounting for 50% of the African production. Pathogen diversity is a prerequisite for breeding resistant cultivars, as a means of improving the production. A survey for virus disease incidence on field grown pepper and tomato was carried out in three state of southwestern part of Nigeria, and a total of 135 leaf samples comprising 58 tomato and 77 pepper leaf samples were collected from farmers’ fields. Infecting viruses were detected using specific polyclonal antibodies were used in enzyme-linked immunosorbent assay (ELISA). Four viruses, Potato virus Y (PVY), Tomato mosaic virus (ToMV), Cucumber mosaic virus (CMV), and Pepper veinal mottle virus (PVMV) were detected. In tomato the distribution of viruses was 5.2% (CMV), 5.2% (PVY) and 39.7% for PVMV, respectively. Leaf samples of pepper had incidence rate of 19.5%, 3.9% and 67.5% for CMV, ToMV and PVMV respectively. TSWV and TYLCV were not detected in any of the samples tested. The most prevalent virus on tomato and pepper was PVMV which was also the most prevalent virus in Osun, Ogun and Oyo States in Southwest Nigeria; similarly, CMV was detected in pepper crops in all the states surveyed and the most prevalent after PVMV in the three states. Mixed viral infections were few, PVY + PVMV occurring only in one tomato leaf sample while PVMV + CMV occurred on three pepper leaf samples. The control of aphid vectors that transmit these viruses and good sanitary practices against soil borne ToMV would minimize disease incidences and subsequent yield loss. Keywords : Tomato, Pepper, virus distribution, PVMV, CMV, PVY