Abstract
Background Human papillomavirus (HPV) 16 and HPV 18 account for 75% of all cervical cancers. The L1 gene, encoding the major surface protein (MSP), is used to classify HPV types (lineages and sublineages), genotypes, and intratypic variants. Therefore, this study aimed to investigate the lineages, sublineages, genetic variabilities, and mutation effects on transcription factor binding sites by using partial sequences of the HPV 16 and HPV 18 long control regions (LCRs) in these samples. Materials and Methods After DNA isolation from 56 positive samples, the LCR of HPV 16 and HPV 18 were amplified using specific primers, and phylogenetic trees were drawn through MEGA X. Compared to the reference sequences, single nucleotide polymorphisms (SNPs) were identified. The transcription binding sites were also evaluated using the online PROMO database. Results The LCRs of 52 samples were successfully sequenced. Overall, 81.58% of all HPV 16 variants belonged to the D1 sublineage, followed by A4 (13.16%), A1 (2.63%), and C1 (2.63%) sublineages. All HPV 18 isolates belonged to A sublineage, 92.85% to A3 sublineage, and 7.15% to A4 sublineage. Out of 27 SNPs in the HPV 16 LCR, A7382T, T7384G, C7387T, C7393G, A7431G, T7448C, and C7783A were HPV 16-specific. Also, among 14 SNPs in the HPV 18 LCR, C7577A and A7943T were not previously reported. An insertion (C) between 7432 and 7433 positions was identified in all studied HPV 16 variants. Besides, most of the HPV 16 mutations were embedded in the YY1, TFIID, Oct-2, and NF-1 binding sites, while c-Fos and MBF1, as the most common binding sites, were affected by HPV 18 LCR mutations. Conclusion The present results showed that D1 and A3 were the dominant sublineages of HPV 16 and HPV 18, respectively. Therefore, women infected with these variants need to be examined in further longitudinal studies to obtain more information about the oncogenic potential of these dominant variants in Iran. Besides, YY1, TFIID, Oct-2, NF-1, c-Fos, and MBF1 were the most frequent binding sites, which were influenced by the mutations.
Highlights
Human papillomavirus (HPV) 16 and HPV 18 are wellknown viruses, responsible for cervical cancer and associated with some other cancers [1]
Due to the importance of long control regions (LCRs) in the viral life cycle and reports of mutations in some nucleotide positions of the LCR, causing changes in the viral oncogenic potency [14, 15], this study aimed to identify variants in Iranian women with normal Pap smear results, according to the partial sequences of the LCR, containing the enhancer and E2 binding sites for both HPV genotypes
DNA was isolated from inPrep samples using the High Pure Viral Nucleic Acid Kit (Roche, Germany), according to the manufacturer’s instructions. e target regions of HPV 16 and HPV 18 LCRs (a 530-bp region with nucleotides 7,336 to 7,866 and GenBank Accession NC_001526.4 for HPV 16; and a 555-bp region with nucleotides 7465 to 58 and GenBank Accession NC_001357.1 for HPV 18) were amplified by nested polymerase chain reaction (PCR) and conventional PCR. e HPV 16 primers included 5′CTTGTGTAACTATTGTGTCATGC3′ and 5′AGTTGCTTGTAAATGTGTAACCC3 as outer primers and 5′CAACACCTACTAATTGTGTTGTGG3′ and 5′AAATCGGTTTGCACACACCCATGT3′ as inner primers
Summary
Human papillomavirus (HPV) 16 and HPV 18 are wellknown viruses, responsible for cervical cancer and associated with some other cancers [1]. While HPV 16 variants differ in terms of oncogenic potency (A3, A4, and D sublineages are associated with a high risk of cervical cancer) [3, 6], there is inconsistent information on HPV 18. In the latest study on HPV 18 variants, no preferred cervical cancer risk was observed among HPV 18 variants [5]. E L1 gene, encoding the major surface protein (MSP), is used to classify HPV types (lineages and sublineages), genotypes, and intratypic variants. Erefore, this study aimed to investigate the lineages, sublineages, genetic variabilities, and mutation effects on transcription factor binding sites by using partial sequences of the HPV 16 and HPV 18 long control regions (LCRs) in these samples. YY1, TFIID, Oct-2, NF-1, c-Fos, and MBF1 were the most frequent binding sites, which were influenced by the mutations
Sign-in/Register to view highlights & summary Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callMore From: The Canadian journal of infectious diseases & medical microbiology = Journal canadien des maladies infectieuses et de la microbiologie medicale
Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
