First Report of Broad bean wilt virus 1 in Spain.

Abstract

In late summer 2001, field-grown pepper (Capsicum annuum) plants showing chlorotic blotching in leaves and fruits were observed in Benicarló, Castellón, Spain. Enzyme-linked immunosorbent assays of extracts of these plants with a collection of plant virus antisera showed a positive reaction only with Broad bean wilt virus serotype 1 (BBWV-1) antiserum. To confirm BBWV-1 infection, primers B1 (GCTCTTCCCCATATAACTTTC) and B2 (GTCTCTATCTTCTCTTCTTCC) were designed based on the nucleotide sequence of BBWV-1 isolate PV132 (GenBank Accession No. AB018702), and were used for reverse-transcription polymerase chain reaction analysis. RNAs extracted from symptomatic plants yielded a cDNA product of ~500 bp that was not obtained using RNA extracts from healthy plants. The sequence of this cDNA fragment was determined, and it showed ~80% nucleotide identity with a BBWV-1 genomic region, encompassing part of the two coat proteins genes. Amino acid identities were ~94% with BBWV-1 isolates and ~60% with BBWV-2 isolates. BBWV-1 and BBWV-2 are considered different species of the genus Fabavirus. BBWV-1 and BBWV-2 are distributed worldwide and infect a wide range of plants. In the Mediterranean Basin, BBWV-1 has been serologically identified in Jordan, Lebanon, Syria, Egypt, Tunisia, Morocco (2), and Italy (1), but no nucleotide sequence data is available. To our knowledge, this is the first report of BBWV-1 in Spain.