Fe3O4 Nanozyme-Labeled Lateral Flow Immunochromatography Strips for Rapid Detection of PVX and PVY.

Molecular detection and identification of eight potato viruses in Gansu province of China

Potato germplasm held as field collections accumulate virus infections, making them unsuitable for distribution as planting stock. Elimination of these viruses from in vitro cultures provides healthy materials for germplasm distribution. An in vitro collection of 33 potato cultivars and hybrids was evaluated for five viruses: Potato leafroll virus (PLRV), Potato virus M (PVM), Potato virus S (PVS), Potato virus X (PVX), and Potato virus Y (PVY) by ELISA and RT-PCR. PLRV was not detected in any accessions. Seven accessions were singly infected by PVM, 15 were mix-infected by PVM and PVS, and four by PVM and PVY. One accession had both PVS and PVX, and one was mix-infected by PVM, PVS, and PVY. Two accessions were singly infected by PVY, and three were virus-free. Cryotherapy, chemotherapy, and a combination of both methods were tested on several potato accessions. For cryotherapy of shoot tips, the PVS2-vitrification protocol was used. Chemotherapy using prolonged culture with 100 mg L−1 ribavirin on PVM and PVS eradication was investigated both alone and combined with cryotherapy. Cryotherapy alone eliminated single PVM infection in 38.6% of shoot cultures, but totally virus-free shoots were not found in mix-infected accessions. Treatment with ribavirin alone was only effective for eliminating both PVM and PVS after three subcultures on ribavirin, or ribavirin followed by cryotherapy. Three subcultures on ribavirin followed by cryotherapy resulted in 100% virus-free potato shoots. Future studies will include cultivars infected with PVX and PVY. This is the first report of combined chemo- and cryotherapy for virus elimination in potato.

From a total of 8,135 potato leaves collected from 132 fields in 11 provinces of Iran, the incidence and distribution of Alfalfa mosaic virus (AlMV), Eggplant mottled dwarf virus (EMDV), Potato leafroll virus (PLRV), Potato virus A (PVA), Potato virus M (PVM), Potato virus S(PVS), Potato virus X (PVX), Potato virus Y (PVY), and Tomato yellow fruit ring virus (TYFRV) were assessed using serological and biological methods. Based on enzyme-linked immunosorbent assay (ELISA) results, viruses in decreasing order of incidence in potato were PVS (35.9%), PVY (34.4%), PVA (27.0%), PVX (20.8%), PLRV (13.9%), PVM (9.0%), AlMV (7.0%), TYFRV (5.9%), and EMDV (5.1%). All 132 fields surveyed had some degree of virus infection, ranging from 28.8 to 98.6%, with an overall incidence of 75.2%. The highest and lowest incidence of virus infections among the surveyed provinces occurred in Kerman (93.2%) and Ardabil (56.7%), respectively. Overall, 25.0 and 50.2% of the collected potato samples had single or mixed infections, respectively. High levels of mixed infections were found between PVX and PVS (8.6%), and PVX and PVY (7.6%). Moreover, co-infection of samples with PVS and PVY, PVA and PVS, and PVA and PVY, the aphid-vectored virus/virus combinations, occurred at the highest incidence in almost all provinces surveyed, 15.3, 13.8, and 12.8%, respectively. In this study, Beet curly top virus was detected in symptomatic potato samples collected from some fields in the Kermanshah province.

In Japan, 12 viruses have been identified as causal agents of virus diseases of potato: Alfalfa mosaic virus, Cucumber mosaic virus, Potato aucuba mosaic virus, Potato leafroll virus (PLRV), Potato mop-top virus (PMTV), Potato virus A (PVA), Potato virus M (PVM), Potato virus S (PVS), Potato virus X (PVX), Potato virus Y (PVY), Tomato ringspot virus (ToRSV), and Tomato spotted wilt virus (TSWV). In a preliminary survey for viruses using ELISA, we found numerous virus species in landrace potatoes but only a few, e.g., PVY, in commercial ware potato crops. We have now modified a reverse transcription–polymerase chain reaction–microplate hybridization technique, developed for PVY, PLRV, and PMTV, to assay for the 12 viruses referred to above simultaneously. In leaf samples from 35 landraces, PVM, PVS, PVY, PLRV, PVA, and PVX were detected in 94%, 91%, 80%, 77%, 57%, and 43% of the landraces, respectively. These results indicate that potato landraces can act as a reservoir for these viruses with some landraces being asymptomatic. It is thus important to inspect and test for these viruses in seed potato production.

The most important potato viruses in Uganda are Potato virus Y (PVY), Potato leafroll virus (PLRV), Potato virus X (PVX), Potato virus S (PVS), Potato virus A (PVA) and Potato virus M (PVM). Utilization of R genes in breeding for resistance to viruses has not been explored in Uganda due to limited information on the prevalence of R genes in the available genotypes. This study aimed at identifying potato genotypes with R genes for resistance to potato viruses important in Uganda. The study screened 71 potato accessions from the National Potato Breeding Programme at Kachwekano Zonal Agricultural Research and Development Institute for the presence of resistance genes to viruses using diagnostic molecular markers. The results indicated that 21 out of 71 genotypes had resistance markers, of which nine genotypes, NKRN59.58, Derby, Markies, Sifra, 395017.229, Nakpot 5, 20108.5, Royal and 393220.54, had Ryadg gene for PVY resistance and two genotypes, Kimuri and 319919.3, had Rysto gene for resistance to PVY and PVA. Nine genotypes, 395011.2, Markies, Nakpot 5, 20108.5, Sifra, 20157.6, Royal, 2015.8 and Ambition, had the Nbtbr gene for resistance to PVX. In addition, 14 genotypes, 395011.2, Markies, Nakpot 5, Sarpouna, 393220.54, 391046.14, Sarpomira, 395077.12, Sifra, 20157.6, Royal, Ambition, Kimuri and Caruso, had the Nsadg gene conferring resistance to PVS. Four genotypes, Markies, Sifra, Nakpot 5 and Royal, had the Ryadg, Nbtbr and Nsadg genes for combined resistance to PVY, PVX and PVS. The resistant genotypes could be used as parents to introgress resistance genes into susceptible cultivars.

BackgroundCertification of seed potato as free of viruses is essential for stable potato production. Among more than 30 virus species infecting potato, potato leafroll virus (PLRV), potato virus S (PVS), potato virus X (PVX), and potato virus Y (PVY) predominate worldwide and should be the targets of a high-throughput detection protocol for seed potato quarantine.ResultsWe developed an assay based on one-step real-time multiplex reverse transcription-polymerase chain reaction (mRT-PCR) with melt curve analysis for the four viruses and one internal control, potato elongation factor 1 alpha gene (EF1α). Virus-specific primers were derived from conserved regions among randomly selected representatives considering viral genomic diversity. Our assay simultaneously detected representative Japanese isolates of PLRV, O lineage of PVS, PVX, and NTN strain of PVY. The variability of melting temperature (Tm) values for each virus was confirmed using Japanese isolates, and virus species could be identified by the values of 87.6 for PLRV, 85.9 for PVX, 82.2 (Ordinary lineage) to 83.1 (Andean lineage) for PVS, and 79.4 (NA-N strain) to 80.5 (O strain and NTN strain) for PVY on average. The reliability of calculation was validated by comparing the calculated Tm values and measured Tm values and the values had a strong linear correlation (correlation of determination: R2 = 0.9875). Based on the calculated Tm values, representative non-Japanese isolates could also be identified by our assay. For removing false positives, two criteria were set for the evaluation of result; successful amplification was considered as 30.0 ≥ threshold cycle value, and the virus-specific peak higher than the EF1α-specific peak was considered as positive. According to these criteria, our assay could detect PLRV and PVS from 100-fold dilution of potato leaf homogenate and PVX and PVY from 1000-fold in a model assay.ConclusionThis new high-throughput detection protocol using one-step real-time mRT-PCR was sensitive enough to detect viruses in a 100-fold dilution of singly-virus contaminated homogenate in a model assay. This protocol can detect the four viruses in one assay and yield faster results for a vast number of samples, and greatly save the labor for seed potato quarantine and field surveys.

The Indian economy heavily depends on agriculture. Consequently, it is crucial to detect diseases in the agricultural sector. There is a necessity to identify the disease at the initial stage because farmers struggle to produce crops properly because of several plant diseases. The potato is a vegetatively propagated crop. It is a host to many bacterial fungal and viral diseases. A potato crop can be infected by more than 30 plant viruses, a viroid, and phytoplasmas. Viral diseases are of major concern nowadays in potato crops. Once discovered in the field, virus-infected plants result in declassification or even rejection of the seed lots, which results in a monetary loss. The viruses Potato Virus A (PVA), Potato Virus X (PVX), Potato Virus S (PVS), Potato Virus Y (PVY), Potato Virus M (PVM), Potato leaf roll virus (PLRV), and Tomato leaf curl New Delhi virus are known to infect potatoes in India (ToLCNDV), Potato spindle tuber viroid (PSTVD) and Groundnut bud necrosis virus (GBNV). PVM, PVY, PVA, PVX, and PVS occur commonly. Nowadays many computer vision technologies like machine learning, deep Learning are employed in building a prediction model for the effective, rapid, and accurate detection of potato plant disease. In the proposed work the viral disease considered is Potato Leaf Roll Virus (PLRV), Mosaic Virus, Leaf curl, and tuber diseases Potato Tuber Viroid Disease (PSTVD), Potato Virus Y (PVY) Tuber cracking. The foliar image is initially resized to 256* 256, applied contrast enhancement and then filters are applied for denoising removing high frequency, and smoothing the image then the segmentation using Canny Edge Detection is applied to the blurred image to accurately detect the edges of the leaf and then the suitable features are extracted. The disease is classified using classification methods like Support Vector Machine (SVM) and Random Forest. The Random Forest classifier outperforms all other classifiers and produces a classification accuracy of 98.12%.

Potato (Solanum tuberosum) is a major food source in the whole world including Bangladesh. Viral diseases are the key constraint for sustainable potato production by reducing both quality and quantity. To determine the present status of eight important potato viruses in Bangladesh, tuber samples were collected from three major potato growing regions (Munshiganj, Jessore and Bogra districts) in January–February 2017 and February 2018. Reverse transcription polymerase chain reaction (RT-PCR) with coat protein (CP)-specific primers were used to amplify CP sequences of the respective viruses, and confirmed by sequencing, which were deposited in the GenBank. Results indicated that the tuber samples were subjected to Potato leafroll virus (PLRV), Potato virus X (PVX), Potato virus Y (PVY), Potato virus S (PVS), Potato virus H (PVH), Potato aucuba mosaic virus (PAMV) and Potato virus M (PVM) infection, whereas mixed infections were very common. Phylogenetic analysis revealed that the PLRV from this study was closely related to a Canadian and a Chinese isolate, respectively; PVX was closely related to a Canadian and a Chinese isolate, respectively; PVY was closely related to a Chinese isolate; PVS was closely related to a Chinese and an Iranian isolate, respectively; PAMV was closely related to a Canadian isolate; PVH was closely related to a Huhhot isolate of China; and PVM was closely related to an Indian and an Iranian isolate, respectively. As far as we know, PAMV in this study is the first report in Bangladesh. These findings will provide a great scope for appropriate virus control strategies to virus free potato production in Bangladesh.

Potato plays an important role in food security in Kenya but yields are low (<10 t/ha), and this is partly attributed to the lack of healthy planting material. This study is the first wide-scale survey to determine the occurrence and distribution of common potato pests and diseases in Kenyan seed (certified and quality declared) and ware crops. Potato crops growing on 101 farms in 21 districts were examined. Approximately 36% of plants in farmers’ fields sampled both during the long rains (main potato-growing season) and short rains seasons displayed virus-like disease symptoms. Six viruses (potato leafroll virus (PLRV), Potato virus A (PVA), potato virus M (PVM), potato virus S (PVS), potato virus X (PVX), and potato virus Y (PVY)) were detected using double antibody sandwich enzyme-linked immunosorbent assay in potato samples. Sequencing of polymerase chain reaction products from PVY-infected plants revealed the presence of recombinant strains of PVY (NTN and Wilga). Four aphid species, Macrosiphum euphorbiae, Aphis gossypii, Myzus persicae, and Aphis fabae, colonized potato in all districts, occurring in greater numbers west of the Great Rift Valley than to the east. There was a positive correlation between virus incidence and aphid numbers in the long rains (main) potato-growing season. PLRV, PVM, PVS, PVX, and PVY were detected in solanaceous weeds. Ralstonia solanacearum was detected in soils from 13 farms in 8 of the 18 districts surveyed. Approximately 38% of soil samples were infested with Meloidogyne spp. Phytophthora infestans isolates belonging to the US 1 and 2_A1 genotypes were identified. Although many economically important diseases are present in Kenya, the lower aphid incidence in districts east of the Great Rift Valley may indicate that these districts are more suitable for seed potato production.

Viral diseases have been a major limiting factor threating sustainable potato (Solanum tuberosum L.) production in Pakistan. Surveys were conducted to serologically quantify the incidence of RNA viruses infecting potato; Potato virus X (PVX), Potato virus Y (PVY), Potato virus S (PVS), Potato virus A (PVA), Potato virus M (PVM) and Potato leaf roll virus (PLRV) in two major potato cultivars (Desiree and Cardinal). The results suggest the prevalence of multiple viruses in all surveyed areas with PVY, PVS and PVX dominantly widespread with infection levels of up to 50% in some regions. Co-infections were detected with the highest incidence (15.5%) for PVX and PVS. Additionally the data showed a positive correlation between co-infecting viruses with significant increase in absorbance value (virus titre) for at least one of the virus in an infected plant and suggested a synergistic interaction. To test this hypothesis, glasshouse grown potato plants were challenged with multiple viruses and analyzed for systemic infections and symptomology studies. The results obtained conclude that multiple viral infections dramatically increase disease epidemics as compared to single infection and an effective resistance strategy in targeting multiple RNA viruses is required to save potato crop.

Three consecutive potato crops are grown annually in Pakistan and Khyber Pakhtunkhawa (KPK) province is the main source for seed tubers. During the year 2010, 240 symptomatic and viral susceptible potato leave samples were collected from Swat, Dir, Abbottabad and Mansehra and serologically confirmed through Double Antibody Sandwich (DAS) Enzyme Linked Immunosorbant Assay (ELISA) against Potato virus X (PVX), Potato virus Y (PVY), Potato leaf roll virus (PLRV), Potato virus M (PVM), Potato virus S (PVS) and Potato virus A (PVA). The presence or absence of viruses was confirmed by observing the yellow and white color in ELISA plates respectively. According to ELISA results, overall percentage incidence of viral diseases was found highest in Swat (65%) followed by Mansehra (61%), Dir (53%) and Abbottabad (43.33%) while PVY and PVS were dominant in Swat (26.66%), Dir (20%), Mansehra (15%) and Abbottabad (21.66%) respectively. PVX was not detected in Abbottabad while Swat samples seemed to be free from PVM and PVA.

Polerovirus: potato leaf roll virus (PLRV), Potyvirus: potato virus Y (PVY) and Potexvirus: potato virus X (PVX) is more destructive and well distributed throughout the Pakistan. Incidence has been reported to be as high as 90%, 25%, and ≥ 15%, respectively in the potato growing regions. To find out the source of resistance, twenty-nine virus free potato varieties were grown under field conditions with good agricultural practices. The disease severity of PLRV, PVY and PVX was recorded to determine the level of resistance of the potato varieties according to the disease rating scale. Infectivity and biological assay of all twenty-nine varieties were done in green house on potato, Datura stramonium, Nicotiana glutinosa and Physalis floridana. Non-inoculated plants were served as control. Leaf samples from potato varieties were collected for serological detection of PLRV, PVY and PVX by Double antibody sandwich Enzyme-Linked Immunosorbent Assay (DAS-ELISA). Out of twenty nine varieties, none of the variety was resistant to PLRV although three varieties; Mirrato, 394021-120 and Orla were moderately resistant. Only FD 48-4 and TPS 9813 showed resistance to PVX and PVY. While FD 3-10, FD 9616 and FD 37-13 were moderately to PVX and PVY. Rest of the varieties was found susceptible to all three viruses.

A survey of six potato viruses, Potato virus A (PVA), Potato virus M (PVM), Potato virus S(PVS), Potato virus X (PVX), Potato virus Y (PVY), and Potato leafroll virus (PLRV), was conducted in New York and Maine during 2002 and 2003. Leaf samples were tested by enzyme-linked immunosorbent assay and PVY-positive samples were further tested to determine whether a necrotic strain of PVY (PVYN) or a strain able to induce necrosis in tobacco and in potato tubers (PVYNTN) were present. In both years, PVY and PVS were identified in a majority of the samples, and mixed infections predominated in 83% of the symptomatic leaves in 2002. Of the total 394 PVY-positive samples, 3 reacted with monoclonal antibody (MAb) 1F5 and caused veinal necrosis (VN) in tobacco. Two of these isolates caused tuber necrosis in the potato cv. Yukon Gold. Three PVY isolates reacted with MAb 1F5 but did not cause VN in tobacco, and two caused VN but did not react with MAb 1F5. None of these eight isolates were able to overcome the Ry resistance gene in the potato cultivar Eva, but several were able to overcome the Ny resistance gene found in Allegany. PVYN isolates were not widespread in the northeastern United States; however, several PVY isolates differed from both PVYN and the ordinary strain of PVY and may represent strain recombinants.

Potato tubers (Solanum tuberosum L.) is considered as one of the most essential vegetable crops worldwide, The most communal viruses attacking potato all over the world are potato leaf roll virus (PLRV), potato virus Y (PVY) and potato virus X (PVX). Our current study aimed to eradicate potato viruses PVY, PVX and PLRV through shoot tip meristem via tissue culture combined with thermotherapy and chemotherapy. Sprouts of potato cultivars ex. Spunta, Selana, Diamond and Cara were used as biological material for investigating their performance using shoot tip meristem. During multiplication stage, the resulted plantlets were subjected to ribavirin (50 mg/L), while the untreated plantlets served as control. In general, the control treatment (0.0 mg/L) provided the best results, while ribavirin (50 mg/L) gave reverse effect on the estimated vegetative parameters (shoot length (cm), number of leaves and number of shoots). Detection of the presence and absence of PVY, PVX and PLRV using DAS-ELISA technique indicated that, thermotherapy and chemotherapy treatments for shoot tip meristem culturing minimized the occurrence percentage of PVX, PVY and PLRV in all tested potato cultivars compared to positive control. The results of RT-PCR revealed that, the amplicons of amplified fragments and primed by PVX-, PVY- and PLRV-specific sense and antisense primers were appeared only in the positive control (lane 1 at ~750, 801 and 548 bp), respectively, while, no amplicons appeared in the rested treatments. In conclusion, shoot tip meristem followed by thermotherapy and chemotherapy treatments enhanced the growth of potato plantlets and suppressed potato viruses.

In August 2011, unusual virus-like symptoms consisting of distinct bright yellow spots, mottling (calico), mosaic, narrow leaves and stunting were observed on greenhouse-grown pepino (Solanum muricatum) plants in Usak (western Turkey). Leaf tissue from 10 symptomatic plants was sampled and analyzed by DAS- ELISA using commercial kits to Pepino mosaic virus (PepMV), Alfalfa mosaic virus (AMV), Cucumber mosaic virus (CMV), To- bacco mosaic virus (TMV), Tomato spotted wilt virus (TSWV), Tomato ringspot virus (ToRSV), Potato virus X (PVX), Potato virus Y (PVY), Potato virus M (PVM) and Potato virus S (PVS) (Bioreba, Switzerland). DAS-ELISA results revealed that four samples were infected by CMV, five by AMV and one by both CMV and AMV. There were no reactions with the antisera to PepMV, TMV, TSWV, ToRSV, PVX, PVY, PVM and PVS. The presence of AMV and CMV was confirmed by RT-PCR using to- tal RNA extracted from infected pepino leaves (Foissac et al., 2001) and specific primers designed to amplify a fragment of the coat protein gene of AMV (Martinez et al., 2004) (AMVcoat-F: GTGGTGGGAAAGCTGGTAAA; AMVcoat-R: CACCCAGT GGAGGTCAGCATT) and CMV (Faggioli et al., 2001) (CMV- coat-F: AACATAGCAGAGATGGCGG, CMVcoat-R: ACTCT- TAACCACCCAACCTT). PCR products of the expected size (700 bp for AMV and 280 bp for CMV) were obtained from plants that were DAS-ELISA positive for AMV and CMV, re- spectively. To our knowledge, this is the first report of natural co- occurrence of AMV and CMV in pepino in Turkey.