Abstract
Extensive sequencing efforts have been taking place for the Atlantic cod (Gadus morhua) in recent years, the number of ESTs in the Genbank has reached more than 140.000. Despite its importance in North Atlantic fisheries and potential use in aquaculture, relatively few gene expression examination exists for this species, and systematic evaluations of reference gene stability in quantitative real-time RT-PCR (qRT-PCR) studies are lacking.The stability of 10 potential reference genes was examined in six tissues of Atlantic cod obtained from four populations, to determine the most suitable genes to be used in qRT-PCR analyses. Relative transcription levels of genes encoding beta-actin (ACTB), elongation factor 1A (EF1A), actin-related protein-2 (ARP-2), glyceraldehyde-3P-dehydrogenase (GAPDH), ubiquitin (Ubi), acidic ribosomal protein (ARP), ribosomal protein S9 (S9), ribosomal protein L4 (RPL4), RPL22 and RPL37 were quantified in gills, brain, liver, head kidney, muscle and middle intestine in six juvenile fish from three wild populations and from farmed Atlantic cod. Reference gene stability was investigated using the geNorm and NormFinder tools. Based on calculations performed with the geNorm, which determines the most stable genes from a set of tested genes in a given cDNA sample, ARP, Ubi, S9 and RPL37 were among the most stable genes in all tissues. When the same calculations were done with NormFinder, the same genes plus RPL4 and EF1A were ranked as the preferable genes.Overall, this work suggests that the Ubi and ARP can be useful as reference genes in qRT-PCR examination of gene expression studying wild populations of Atlantic cod.
Highlights
Following the publication of our article[1], an error in Table 2 was noted, the wrong accession number and primer sequences were stated for the EF1A assay
The GenBank accession number was incorrectly stated as: EX721840 Forward primer: CCCTGTGGAAGTGGCTGAAG Reverse primer: CATCCAAGGGTCCGTATCTCTT The correct GenBank accession number should be: EX722124 Forward primer: CGGTATCCTCAAGCCCAACA Reverse primer: GTCAGAGACTCGTGGTG CATCT We apologise for any inconvenience this may have caused
* Correspondence: pal.olsvik@nifes.no National Institute of Nutrition and Seafood Research, Nordnesboder 2, N5005
Summary
The GenBank accession number was incorrectly stated as: EX721840 Forward primer: CCCTGTGGAAGTGGCTGAAG Reverse primer: CATCCAAGGGTCCGTATCTCTT The correct GenBank accession number should be: EX722124 Forward primer: CGGTATCCTCAAGCCCAACA Reverse primer: GTCAGAGACTCGTGGTG CATCT We apologise for any inconvenience this may have caused. Correction: Selection of reference genes for qRT-PCR examination of wild populations of Atlantic cod Gadus morhua
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
