Abstract
The endoplasmic reticulum (ER)-transmembrane proteins, ATF6 alpha and ATF6 beta, are cleaved during the ER stress response (ERSR). The resulting N-terminal fragments (N-ATF6 alpha and N-ATF6 beta) have conserved DNA-binding domains and divergent transcriptional activation domains. N-ATF6 alpha and N-ATF6 beta translocate to the nucleus, bind to specific regulatory elements, and influence expression of ERSR genes, such as glucose-regulated protein 78 (GRP78), that contribute to resolving the ERSR, thus, enhancing cell viability. We previously showed that N-ATF6 alpha is a rapidly degraded, strong transcriptional activator, whereas beta is a slowly degraded, weak activator. In this study we explored the molecular basis and functional impact of these isoform-specific characteristics in HeLa cells. Mutants in the transcriptional activation domain or DNA-binding domain of N-ATF6 alpha exhibited loss of function and increased expression, the latter of which suggested decreased rates of degradation. Fusing N-ATF6 alpha to the mutant estrogen receptor generated N-ATF6 alpha-MER, which, without tamoxifen exhibited loss-of-function and high expression, but in the presence of tamoxifen N-ATF6 alpha-MER exhibited gain-of-function and low expression. N-ATF6 beta conferred loss-of-function and high expression to N-ATF6 alpha, suggesting that ATF6 beta is an endogenous inhibitor of ATF6 alpha. In vitro DNA binding experiments showed that recombinant N-ATF6 beta inhibited the binding of recombinant N-ATF6 alpha to an ERSR element from the GRP78 promoter. Moreover, siRNA-mediated knock-down of endogenous ATF6 beta increased GRP78 promoter activity and GRP78 gene expression, as well as augmenting cell viability. Thus, the relative levels of ATF6 alpha and -beta, may contribute to regulating the strength and duration of ATF6-dependent ERSR gene induction and cell viability.
Highlights
Stresses that alter the rough ER3 environment can impair folding of proteins synthesized by this organelle (1– 4)
The transcriptional activation domain (TAD) of N-ATF6␣ resides in the N-terminal portion of the protein, whereas the basic leucine zipper (b-Zip) and nuclear localization domains reside in the C terminus (Fig. 1B, N-ATF6␣) (8, 10)
N-ATF6␣ can bind directly to ATF6 binding sites (9), or it can combine with several other proteins to form a complex that binds to ERSR elements (ERSEs) and augments the induction of numerous ERSGs, such as the endoplasmic reticulum (ER) chaperone, glucose-regulated protein 78 kDa (GRP78) (8, 9, 11–13)
Summary
The use of small interfering (si) RNA targeted against human ATF6␣ and - has been described elsewhere (22). Cells were co-transfected with either pGL2P, or GRP78-luciferase, and CMV--galactosidase, plated, and 48 h later, extracted and analyzed for reporter enzyme activities, as described under “Methods.” Rel Luciferase is the mean value for GRP78-luciferase/ -galactosidase divided by pGL2P-luciferase/-galactosidase for each sample Ϯ. HeLa cells were transfected with the appropriate siRNA, as described above, after treatments, they were lysed and RNA was extracted using an RNeasy kit (Qiagen). The mean relative expression levels (i.e. N-ATF6␣ or N-ATF6/GAPDH) Ϯ S.D. are shown at the top of each gel. Real-time quantitative PCR was performed on cDNA using the Quanti-Tect SYBR Green PCR kit (Qiagen) on an ABI Prism 7000 (Applied Biosystems, Foster City, CA). All primers were determined to be 90% to 110% efficient, and all exhibited only one dissociation peak as follows: GRP78: (ϩ) CCACCTCAGTCTCCCAGCTAA; (Ϫ) GCCGAGCATGGTGGTAACA; ATF6␣: (ϩ) CACAGCTCCCTAATCACGTGG; (Ϫ) ACTGGGCTATTCGCTGAAGG; ATF6: (ϩ) CAGCCATCAGCCACAACAAG; (Ϫ) GGCATCACCAGGGACATCTT; and glyceraldehyde-3-phosphate dehydrogenase: (ϩ) GCCACATCGCTCAGACACC; (Ϫ) CAAATCCGTTGACTCCGACC
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
