Effect of RGFP966 application in key steps of sheep somatic cell nuclear transfer on cloned embryo development.

Nuclear reprogramming of somatic cells can be induced by oocyte factors. Despite numerous attempts, the factors responsible for successful nuclear reprogramming remain elusive. In the present study, we found that porcine oocytes with the first polar body collected at 42 h of in vitro maturation had a stronger ability to support early development of cloned embryos than porcine oocytes with the first polar body collected at 33 h of in vitro maturation. To explore the key reprogramming factors responsible for the difference, we compared proteome signatures of the two groups of oocytes. 18 differentially expressed proteins between these two groups of oocytes were discovered by mass spectrometry (MS). Among these proteins, we especially focused on vimentin (VIM). A certain amount of VIM protein was stored in oocytes and accumulated during oocyte maturation, and maternal VIM was specifically incorporated into transferred somatic nuclei during nuclear reprogramming. When maternal VIM function was inhibited by anti-VIM antibody, the rate of cloned embryos developing to blastocysts was significantly lower than that of IgG antibody-injected embryos and non-injected embryos (12.24 versus 22.57 and 21.10%; p < 0.05), but the development of in vitro fertilization and parthenogenetic activation embryos was not affected. Furthermore, we found that DNA double strand breaks dramatically increased and that the p53 pathway was activated in cloned embryos when VIM function was inhibited. This study demonstrates that maternal VIM, as a genomic protector, is crucial for nuclear reprogramming in porcine cloned embryos.

This study was carried out to assess the nuclear status after parthenogenetic activation in in vitro matured oocytes under different conditions. Bovine ovaries were collected from slaughtered cows at a local abattoir. Oocytes were aspirated from follicles of 3–8 mm in diameter and transferred to maturation medium: tissue culture medium (TCM)-199 supplemented with 10% (v/v) fetal calf serum, 100 mg/mL l-cysteine, 20 mg/mL sodium pyruvate, gonadotropins (each 250 IU of eCG and hCG/mL), and 10 mg/mL epidermal growth factor, with or without 5 mM hypotaurine and taurine. Oocytes were cultured at 38.9°C in 5% CO2 in humidified air. After 24 h of culture, oocytes with polar body were selected and submitted to activation treatments. Oocytes were exposed to calcium ionomycin (5 μM for 5 min) followed by incubation with 6-DMAP (2 mM), roscovitine (50 μM), or 6-DMAP + roscovitine for 3.5 h. After activation, oocytes were cultured in mSOF medium containing 0.8% BSA at 38.9°C in 5% CO2, 5% O2 in humidified air for 16 h and stained with Hoechst 33342 or aceto-orcein for assessment of nuclear status. Nuclear status was recorded as follows: 1PB (polar body) + 1PN (pronucleus), 2PB + 1PN and others. Data were analyzed using chi-square test. The maturation rate of bovine oocytes cultured in maturation medium containing hypotaurine/taurine (89.3%, n = 84) was higher (P &lt; 0.05) than those cultured without hypotaurine/taurine (72%, n = 93). In the oocytes matured with hypotaurine/taurine, the rates of diploid activation (1PB + 1PN) were 84% (n = 50) in oocytes treated with 6-DMAP + roscovitine, 78.6% (n = 56) with 6-DMAP, and 52% (n = 50) with roscovitine. In the oocytes matured without hypotaurine/taurine, the rates of diploid activation were 80% (n = 60) in oocytes treated with 6-DMAP + roscovitine, 72% (n = 50) with 6-DMAP, and 54% (n = 50) with roscovitine. The rates of diploid activation were not different in oocytes matured with or without hypotaurine/taurine and among activation treatments. The oocytes treated with roscovitine showed a lower rate (P &lt; 0.05) of diploid activation and higher rate (39.3–40%) of second polar body extrusion (1PN + 2PB) than the other activation groups in both maturation conditions. Cleavage rates to 2-cell stage were 40–45% in all groups. Development rate of blastocysts were 7–10% in all the groups treated with 6-DMAP and 6-DMAP + roscovitine and no blastocysts were obtained from the groups treated with roscovitine alone. Hypotaurine/taurine are known to be stable and potent antioxidants, and have shown the properties of supporting oocyte maturation and further embryonic development (Guerin and Menezo 1995 Zygote 3, 333–43; Mizushima and Fukui 2001 Theriogenology 55, 1432–45). In this study, although the effectiveness of hypotaurine/taurine on promoting oocyte maturation was observed, there were no significant improvements in the rate of diploid activation in oocytes matured with hypotaurine/taurine. These results suggest that the nuclear status of activated oocytes may not have a direct relationship with the enhanced maturation condition. This work was supported by BioGreen 21 Program(#1000520030100000-1), Republic of Korea.

Expression pattern of ATG4C and its effect on early embryonic development of porcine oocytes

DMSO supplementation during in vitro maturation of bovine oocytes improves blastocyst rate and quality

The aim was to analyse the function of the PI3K pathway during oocyte maturation in bovine by use of the specific inhibitor, LY294002. Genes studied in cumulus cells (CC) were PDH, G6PDH, GLUT1, and GLUT4. PDH is an important enzyme for oxidative metabolism, G6PDH is related to resumption and progression of oocyte meiosis, and GLUT1 and GLUT4 are glucose transporters. This study was performed in defined medium (MIV B) in absence or presence of 10 ng mL–1 of FSH. Polar body extrusion was analysed after culture and correlated with gene expression. Experimental methods were bovine COC (n = 35–40/well, n = 3 replicates) collected from ovaries obtained from abattoirs (DF, Brazil) and cultivated in either 400 µL of medium MIV B, or MIV B + 100 µM of LY294002, or MIV B + 10 ng mL–1 of FSH; or MIV B + 10 ng mL–1 of FSH + 100 µM of LY294002 during 22 to 24 h. After culture, COC were mechanically denuded and CC from 20 COC/group were isolated. Gene expression of GLUT1, GLUT4, G6PDH, and PDH were measured by real time PCR. The CC of immature COC were also collected and analysed as the calibrator group. Student-Newman-Keuls was performed as a statistical test. The percentage of oocytes that extruded the polar body was determined. Two-way ANOVA, followed by Bonferroni test, and t-test were performed to determine statistical significance. In MIV B, the polar body extrusion rate was 25.48 ± 7.64%, while FSH increased it up to 74.52 ± 10.58% (P &lt; 0.05). The extrusion of polar body was inhibited by LY294002 in the absence or presence of FSH (67.51 ± 6.13 and 31.02 ± 16.97%, respectively, P &lt; 0.05). Gene expression of PDH was not altered by any culture medium in contrast to GLUT1, GLUT4, and G6PDH expression (Table 1). Only G6PDH expression showed the same pattern as the polar body extrusion, in absence or presence of FSH. In conclusion, PI3-K inhibition affects polar body extrusion and expression of genes related to glucose metabolism in CC. Lower G6PDH expression in CC may be related to low rates of polar body extrusion in treated oocytes. Table 1.Gene expression of GLUT1, GLUT4, and G6PDH in CC of COC after culture The authors thank FAP-DF (193.000.577/2009), CNPq, CAPES and Ponte Alta abattoir, Brasilia.

In vitro maturation (IVM) is highly susceptible to influences of the culture environment, which can lead to increased intracellular reactive oxygen species (ROS) levels and thereby induce a stress response in oocytes, ultimately reducing the developmental potential of early embryos. Brain-derived neurotrophic factor (BDNF) is an ovarian endocrine factor that can enhance the function of follicular granulosa cells and promote oocyte maturation, but the specific pathways remain unclear. We supplemented IVM cultures of sheep oocytes with BDNF and examined aspects of oocyte nuclear and cytoplasmic maturation. The addition of 50 ng/mL BDNF promoted the expansion of cumulus cells and increased the rates of first polar body extrusion, cleavage, and blastocyst formation. Compared with untreated controls, BDNF-treated oocytes had improved Ca2+ homeostasis, enhanced expression of antioxidant genes, decreased ROS levels and expression of endoplasmic reticulum stress genes, and increased mitochondrial membrane potential, mitochondrial biogenesis, and numbers of cells with proper distributions of mitochondria and endoplasmic reticulum. Further analysis indicated that BDNF affected oocyte maturation by increasing the numbers of transzonal projections and gap junctions during the IVM process. In summary, the addition of BDNF during the IVM process improved sheep oocyte maturation and embryo development by reducing oxidative stress and endoplasmic reticulum stress. These findings deepen our understanding of the regulatory mechanisms of BDNF during IVM and provide experimental data to improve in vitro embryo production from sheep oocytes.

cGMP-inhibited cAMP phosphodiesterase 3A (PDE3A) is expressed in mouse oocytes, and its function is indispensable for meiotic maturation as demonstrated by genetic ablation. Moreover, PDE3 activity is required for insulin/insulin-like growth factor-1 stimulation of Xenopus oocyte meiotic resumption. Here, we investigated the cAMP-dependent protein kinase B (PKB)/Akt regulation of PDE3A and its impact on oocyte maturation. Cell-free incubation of recombinant mouse PDE3A with PKB/Akt or cAMP-dependent protein kinase A catalytic subunits leads to phosphorylation of the PDE3A protein. Coexpression of PDE3A with constitutively activated PKB/Akt (Myr-Akt) increases PDE activity as well as its phosphorylation state. Injection of pde3a mRNA potentiates insulin-dependent maturation of Xenopus oocytes and rescues the phenotype of pde3(-/-) mouse oocytes. This effect is greatly decreased by mutation of any of the PDE3A serines 290-292 to alanine in both Xenopus and mouse. Microinjection of myr-Akt in mouse oocytes causes in vitro meiotic maturation and this effect requires PDE3A. Collectively, these data indicate that activation of PDE3A by PKB/Akt-mediated phosphorylation plays a role in the control of PDE3A activity in mammalian oocytes.

The prefrontal cortex (PFC), a region responsible for high-order cognitive functions, such as decision-making, attention and working memory, is highly influenced by stress and corticosteroid stress hormones. Recently it has been shown that acute stress affects PFC functions by potentiating glutamatergic transmission via a mechanism dependent on glucocorticoid receptor (GR) and its downstream target, serum and glucocorticoid-inducible kinase (SGK). To identify the key regulators of stress responses, we examined the role of histone deacetylase 6 (HDAC6), a unique member of the HDAC family that could regulate the GR chaperone protein heat shock protein 90 (HSP90), in the synaptic action of acute stress in PFC. We found that HDAC6 inhibition or knockdown blocked the enhancement of glutamatergic transmission and glutamate receptor trafficking by acute stress in vivo or corticosterone treatment in vitro. In addition, HDAC6 inhibition blocked the up-regulation of SGK in animals exposed to acute stress. HSP90 inhibition or knockdown produced a similar blockade of the acute stress-induced enhancement of glutamatergic signalling. These findings have identified HDAC6 as a key molecule gating the effects of acute stress on synaptic functions in the PFC.

Selection of high potential embryos using time-lapse imaging: the era of morphokinetics

We compared the feasibility of ethylene glycol (EG) and propylene glycol (PG) for the vitrification of immature porcine cumulus–oocyte complexes (COC). Porcine COC collected from 3- to 6-mm follicles of slaughterhouse-derived ovaries were subjected to solid-surface vitrification (Somfai et al. 2010 Theriogenology 73, 147–156) either in 35% (v/v) EG or 35% (v/v) PG or in the mixture of 17.5% (v/v) EG and 17.5% (v/v) PG. After warming, the COC were subjected to in vitro maturation, IVF, and embryo culture according to Kikuchi et al. (2002 Biol. Reprod. 66, 1033–1041). Oocyte survival and maturation rates were assessed after in vitro maturation by evaluating membrane integrity and the extrusion of the first polar body. All live oocytes were subjected to IVF and in vitro culture. Cleavage and blastocyst rates were calculated from the total number of oocytes subjected to IVF on Day 2 (Day 0 = IVF) and Day 7, respectively. Total-cell (blastomeres) numbers in blastocysts were recorded on Day 7 after staining with Hoechst 33342. In Experiment 1, competence parameters of oocytes vitrified either in EG-based (EG group; n = 310) or a PG-based (PG group; n = 265) vitrification media were compared with those in the nonvitrified control (n = 160). The experiment was replicated 4 times. In Experiment 2, the competence parameters of oocytes vitrified with the combination of 17.5% EG and 17.5% PG (EG+PG group; n = 397) were compared with those in nonvitrified control (n = 245) and toxicity control (TC, exposed to cryoprotectants without cooling; n = 245) groups. Five replications were performed. Results were analyzed by ANOVA. Differences with P &lt; 0.05 were considered significant. In Experiment 1, the mean survival rate of vitrified oocytes was significantly higher (P &lt; 0.05) in 35% PG compared with that in 35% EG (73.3 and 25.9%, respectively). Maturation rates of surviving oocytes did not differ among vitrified (PG and EG) and nonvitrified control groups (71.1, 62.4, and 64.0%, respectively). After IVF of surviving oocytes, blastocyst formation rate in the group vitrified in EG was higher (P &lt; 0.05) compared with that vitrified in PG but was lower (P &lt; 0.05) compared with control (10.8, 2.0, and 25.0%, respectively). Mean cell numbers in blastocysts did not differ among EG, PG, and control groups (50.5, 47.7, and 48.7, respectively). In Experiment 2, survival of immature oocytes in the EG+PG group was 42.6%. After IVF, 10.7% of oocytes developed to the blastocyst stage in the EG+PG group, which was lower (P &lt; 0.05) than those of the control (18.1%) and TC (23.3%) groups. Blastocyst rates in the control and TC groups were not statistically different. Mean cell numbers in blastocysts did not differ significantly among the EG+PG, control, and TC groups (61.6, 59.3, and 53.3, respectively). In conclusion, 35% PG provided a higher oocyte survival rate after vitrification compared with 35% EG. However, presumably due to toxic effects, 35% PG greatly reduced the development competence of oocytes. The combination of 17.5% EG and 17.5% PG yielded higher survival rates than did 35% EG, without any toxic effect on oocytes.

Histone deacetylase 1 (HDAC1) is one of the most conserved enzymes present in the nuclei of cells. It was thought to be the most important enzyme in the regulation of histone deacetylation process. However, the function of HDAC1 in bovine fibroblast cells and nuclear transfer embryos is not clear. In the present study, sh299 (5′GCAAGCAGATGCAGAGATTTCAAGA GAATCTCTGCATCTGCTTGCTT3′) targeting of HDAC1 mRNA sequence was designed in the PGP/U6/GFP vector (short hairpin RNA, shRNA, expression vector). The sh299 vector was transfected into bovine fibroblast cells by transfection reagent FuGENE HD and the positive cells were identified by the expression of green fluorescent protein (GFP). Histone deacetylase 1 down-regulation in bovine fibroblast cells was measured by quantitative real-time PCR (qRT-PCR with the 2–ΔΔCT method) at 48 h after sh299 vector transfection at mRNA level. Immunocytochemistry was performed at 96 h after sh299 vector transfection to examine the HDAC1 protein level. Bovine fibroblast cells of the control group, negative control vector transfection group and sh299 vector transfection group were used as donor cells for nuclear transfer. Cleavage rates and expression of HDAC1 mRNA in bovine cloned embryos were examined at 48 h after nuclear transfer. Blastocyst rates and total cell numbers of blastocysts were examined on Day 7 post-nuclear transfer. Data were analysed with Statistics Production for Service Solution (version 16.0; SPSS) by 1-way ANOVA. A value of P &lt; 0.05 was considered to be significantly different. Our results showed that the expression level of HDAC1 was significantly reduced by transfection of the sh299 expression vector. The GFP-positive cells showed decreased signal for HDAC1 by immunocytochemistry. It was suggested that the transfection of the sh299 expression vector reduced HDAC1 expression in bovine fibroblast cells at both mRNA level and protein level. Following nuclear transfer, expression of HDAC1 was significantly reduced in the sh299 vector transfection group (donor cells were transfected by the sh299 vector) compared to the other 2 groups. No significant difference (P &gt; 0.05) was seen in cleavage rates among bovine cloned embryos in the sh299 vector transfection group (52.3 ± 3.4%), control group (51.1 ± 5.4%) and negative control vector transfection group (56.2 ± 3.1%). However, blastocyst rates and total cell numbers of blastocysts were significantly lower (P &lt; 0.05) in the sh299 vector transfection group (4.2 ± 1.3% and 75.4 ± 9.2, n = 89) compared to the control group (18.2 ± 3.7% and 97.6 ± 7.3, n = 78) and negative control vector transfection group (18.9 ± 1.7% and 104.2 ± 10.3, n = 83). In conclusion, HDAC1 down-regulation in bovine fibroblast cells and cloned embryos by the sh299 expression vector indicated that HDAC1 was essential for the development of bovine cloned embryos. This work was supported by the grant from National Transgenic Animal Program (No.2009ZX08007-004B) in China.

Methotrexate (MTX), an antifolate drug, is widely used for clinical treatment of malignancies and ectopic pregnancy. Many studies have documented that MTX has strong side-effects on rapidly dividing somaticcells. However, its side-effects on female reproductive cells have not been widely reported. Combined with in vitro culture, two-photon fluorescence imaging and three-dimensional reconstruction, this study analyzed the effects of MTX on oocyte maturation time, chromosome arrangement, karyotype, spindle morphology, and the localization of microtubule organizing centers (MTOCs). Compared with a control group (84%), the rate of germinal vesical breakdown in the MTX group dropped to 73% (P<0.05). The rate of the first polar body extrusion in the MTX group (53%) was also below the control group (63%; P<0.05). The rate of abnormal chromosomal arrangement in the MTX group was 60%, but 24% in the control group (P<0.05). The matured oocyte karyotypes showed 20 univalents in both control and MTX groups, while point-shaped DAPI signals were detected in the MTX group. The rate of abnormal spindle in the MTX group was 49%, but 17% in the control group (P<0.05). MTOCs in oocytes with normal spindles concentrated at the poles, while MTOCs in oocytes with abnormal spindles were scattered around the poles or in the ooplasm. MTX changes the structures of chromosomes and spindles, potentially by interfering with DNA methylation. The above results indicate a basis for understanding negative effects of MTX on oocyte maturation quality, and provide information for the clinical application of MTX in female patients.

Human cloned blastocysts generated from oocytes following in vitro maturation (IVM) are a potential resource for embryonic stem cells (ESC) with homologous immune systems. The purpose of this study was to evaluate the effects of multiple growth factors [epidermal growth factor (EGF), brain-derived neurotrophic factor (BDNF) and insulin-like growth factor-1 (IGF-1)] on human oocyte maturation, early embryo development, blastocyst formation and ESC line generation. Patients (n= 344) undergoing IVF owing to male factor infertility were enrolled in this study. Metaphase II oocytes were separated into four grades based on their morphology. Spindle assembly from IVM oocytes with or without growth factor treatment was assessed by immunostaining. Piezo-assisted micromanipulation technology was used to produce fertilized (ICSI) and cloned [(somatic cell nuclear transfer (SCNT)] embryos. Embryos received four different growth factor treatments; embryo development rates from pronuclear to blastocyst stage and embryo grading (for quality) at the 8-cell stage were analyzed. The presence of receptors on human cumulus cells and IVM oocytes was assessed by immunofluorescence. The blastocysts generated from fertilized and cloned embryos were used for ESC derivation. The combination of EGF, BDNF and IGF-1 can effectively increase oocyte maturation rate in vitro, and significantly improve the oocyte quality in terms of morphology and normal spindle levels (P< 0.05). Also, the developmental competence of fertilized oocytes to 8-cell and blastocyst stages was improved by the addition of growth factors (P< 0.05). However, there were no significant differences among the four groups in 8-cell grading. Blastocyst formation in cloned embryos cultured with the three growth factors was higher than the control group (23.1 versus 4.3%, P< 0.05). Receptors for the three growth factors were present in cumulus cells and IVM oocytes, and four human ESC lines were derived from fertilized blastocysts but none from cloned blastocysts. This study demonstrated that EGF, BDNF and IGF-1 can improve oocyte maturation rate and quality in vitro, and consequently increase early embryo development and blastocyst formation, which is very beneficial in improving the reprogramming efficiency of SCNT. The present study has identified a valuable culture system for IVM and cloned human embryos, potentially using these embryos to derive human therapeutic ESC.

Study question Which clinical parameters predict a high oocyte maturation rate in patients undergoing IVF treatment? Summary answer Time between oocyte collection and insemination demonstrated significant association with oocyte maturation and represents a parameter that could be optimised in IVF cycles. What is known already Oocyte maturation is an important factor determining IVF outcomes and can be a rate-limiting step for patients undergoing treatment. A number of clinical and laboratory variables may affect this process, including the choice of trigger prior to oocyte collection, and certain laboratory procedures. Identification of which of these are predictors of maturation in individual centres enables local protocols to be optimised. Study design, size, duration This is a retrospective study of 714 oocyte collections from 661 women between January 2020 to November 2020 treated in a large, single centre in the UK. Subsequent fertilisation on fresh oocytes consisted of 371 IVF and 343 ICSI cycles. Participants/materials, setting, methods Patient and treatment data was collected by clinical staff at time of treatment. Either GnRH agonist, hCG or double trigger were administered 36 hours before collection. Prior to ICSI, oocyte maturation was assessed by visualisation of polar body (PB) extrusion. After IVF, the number of 2PNs plus unfertilised oocytes with PB extrusion were assessed. Univariate analyses consisted of Mann-Whitney test, t-test, Fisher’s Exact test or ANOVA. Potential predictors were investigated by logistic regression. Main results and the role of chance The end point was maturation rate, defined as high (greater or equal to 70%) or low (less than 70%). Factors predictive of a high rate included insemination more than 4 hours after collection. Oocytes inseminated over 4 hours post-collection displayed significantly higher maturation rates than oocytes inseminated less than 2 hours after collection (69% and 61% respectively; P = 0.01). Oocytes inseminated between 2–4 hours also had higher maturation than those inseminated less than 2 hours post-collection, but this did not reach significance (67% and 61%, respectively; P = 0.06). Further, oocytes fertilised by ICSI had significantly higher maturation than conventional IVF (77% and 67%, respectively, P &amp;lt; 0.001). No significant difference in oocyte maturation between triggers was observed. Similarly, neither age, AMH, a diagnosis of PCOS or number of oocytes collected predicted oocyte maturation in univariate analysis. Logistic regression analysis showed only time between oocyte collection and insemination (aOR 2.12; 95% CI 1.03–4.38; P = 0.04) to be a significant independent predictor. Limitations, reasons for caution Varying means of data collection across clinics and between clinical staff inevitably leads to provision of incomplete data and should be taken into consideration alongside interpretation. Prescription bias of specific triggers to certain patient demographics should be noted. Wider implications of the findings: Collectively, these results suggest that greater time between oocyte collection and insemination could be recommended to IVF clinics that wish to optimise their oocyte maturation. Triggering final maturation with GnRH agonist versus hCG or dual trigger did not have a significant effect on oocyte maturation when adjusted for confounders. Trial registration number Not applicable

Increasing evidence has demonstrated that oxidative stress impairs oocyte maturation and embryonic development. Conventionally, antioxidants have been applied in vitro systems to improve oocyte maturation and blastocyst rates. Formononetin (FMN) is a flavonoid that has been shown to have various pharmacological effects, including antioxidants. In this study, we delved into the impact of FMN, acting as an antioxidant, on the in vitro development of oocytes and blastocysts within the culture system. FMN supplementation at 0.5μM enhanced the rate of first polar body extrusion and blastocyst formation post parthenogenetic activation. It also increased mitochondrial function and ATP levels, reduced intracellular reactive oxygen species, and elevated intracellular GSH levels in both oocytes and embryos. Moreover, FMN significantly decreased autophagy and apoptosis levels in blastocyst cells, potentially via regulation of the Nrf2/Keap1 pathway. This is the first study to report that FMN supplementation benefits the in vitro culture of oocytes and early embryo development, potentially by regulating oxidative stress, mitochondrial function, and autophagy.